Loxodonta_africana Locus ENSLAFG00000017777
snOPY snoRNA Orthological Gene Database
Loxodonta_africana ENSLAFG00000017777
Loxodonta_africana
ENSLAFG00000017777
GeneScaffold_1192
SNORA28
1909..2035
53304
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTTAGGGCTTA
AACTGATTGATGATTTAGTAGTGTCATTCATAACGTAATCTGAAAAGAGGAGGAGGTATG
CTACGTAAATATGGATGCTTAAAGATTAGTTTTGTTAACTGTAAAGAGAGCCCTGGTGAC
CTAGTGGTTAAGCTCGTGGCCATTAACCAAAAAGTTAGTGGTTCGAACCCACCAGCAATT
CCATAGGAGAAAGATGTGGCAGTTTGCTTCCGTAAAGATTAAAGCCTTGGAAACGCTATG
GAGCAGCTCTGCTGTATTCTGTGGGGTCACTATAAGTCAGAATCAACTCGACCGCAGTGG
GTCTGGTTTTGGTAATGAGTCAGAACTTTTTTCAAATAGATCCCACCAAATATTTTGGTT
GTGAGCTGGGAGCACAGACCCAGTTTGATGTTAAGAATGACCGTTACATTGTCAATGGAT
CTCATGAGGCGAATAAGCTGCAAGACATGTTGGATGGATTCATCAAAAAATTTGTTCTCT
GTCCCGAGTGTGAGAATCCTGAAACAGATCTGGTGAGTACCTTTGAGGTTTTTGTCAATA
AAAAAACAAAAGCTGTGTATTTCTTTTGTGCTCAGTCCTGTGATATCACTCAATGATGTT
CCTGGGATGGCAGAACAAAATTACTGAGAAGTAACAAGATCTCAAATATTGGGGGTATTT
TCCTTACTGAGCTTTGTTTTTTAACAGATTTCTTTATGAAAATAATTCTTGGTTATTGAG
TTCATGTTTTAGATGTCTTTTGAGAGTTTTGTCTGTATACTTGGTTTCTCACAGTAGAAT
CGTTTTATATTACAGATAATATACTTGTTTTTATTTTTCTGGCAGCATGTCAATCCAAAG
AAGCAAACAATAGGTAATTCTTGTAAAGCCTGTGGCTATCGAGGCATGCTGGACACACAC
CATAAACTGTGCACGTTCATTCTCAAAAACCCACCTGGTAAGTCTTTGTGATGGATTTCT
AATGTCTTAACATGAAGCCGCTAATTGTCAGAAACAGAATGGCAGCTTCTTTTCTCTAGA
ACCAGAATGTAAGGAATTTTTAATTCTCATGGTGTACGTAATCTGCGATTCCATGAATGT
ACCATCAAAGCTGCCGTTTAAGCTATAGCAAATTTTAAGACAGCTTATCTTAGAAGGGTT
GAAAGAAAGTATAAAACGGAGTGATGGGATCCCAGCAAACAGAAGGTCTACTGCTGAATT
TGGGGGTACTGTTTTATAAACGGGGCTAGGCTCAAGCTTAAGTTTATGCAAGCAACACTC
TGTGGCAGATGAGCAAAACTGTCTGACACAATTTGCGCTTGCTATAGTAAGAAAGTCTAA
CCTATTCCGGTGTTTTCTTCCTCAGTGGGACAAGCCGTTATATAGACTTAAACATTGTTT
GAGCTGTTGATTAAAGCTCAGTTGAGATTTGGTCTTGTTCAAAGTTCATGAGGGATGCAG
GGGAGAGGTCATAAGGGACAATCTTCACTACCTGATATTTGAAGCATCAACAATTCTTGC
TAATCTTACCCAATGGTTATTTTAGAAATGTCTCGAAAACTAGATAATAAAAAAGGAAGA
ATGGGGAGCTAAAAGGATCTCAGTGTTTAATAATGATTTTGCCACTAGTATTTTGGGTCA
CTGTATGCATGGGCTGAGTTTTTTCATGAAATGGGTACATAACTTTGATATGTGAACCTT
AGAATTACAGGCAAAATTGTTTTTATGGTTTTATAAAGGAAGGTGTCCCACAGCATTCAT
TGGACTCTTCAGAGTGGGGGTGTATATGGTACAAAAGGCCAGAGTTTTAAATGTTCCCAG
TGGGCAACGAGGTGAAGTAACGTGGGATTAAACATTTATTTCCTTGTAGAGAATAGTGAC
AGTGGTACAGGAAAGAAAGAAAAGGAAAAGAAAAACAGAAAGGGCAAAGACAAGGAAAAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCTGCGTCCCAGCCGAACA
GTGTCCCCAGGCACAGCCAGCATCCCCTGTCACTGCTTGGCCAGACACTGCCCCACCCCC
ACCTGGAGCTGTCATCCTTCCCTTCCCGTGCTCCCCGCCTCACCCCCAGCACCTATGAAC
AGGCACCTTGGTGTCAACGCATCAAGGAAGTTCTCAGCTAACTTGCATCTTCCTCCCTTG
CCTATGAAGAAACCCTCCACCCTAGCAGTCAAGAGAAGCACCAGAAACCCCAGCCCAGAC
ACCACCCCCAGTGGGGGCCTCATGGACAGCCACCTCTGTGCAGCCCCTACTGACTGAGGC
CTCAGGAGCTGCCAGGTTCCTGGAAGAGGCCCCCTGAATACTCCCCACACCCGGCACCGA
GCCCTCAGCTCATGAGCCAGTTCTCTGGGTTGGGCCCTGGCTGCTCCCACCACCCTACCT
CTGCTGACACACCCAGACACCCCATTTACCCCAAAGCTGTCCCTTACTCAGATGCCCCCG
ACCTCCACAGGTTCAAATATGCCAGCCCAGTTAGGTCACCCTGAGCTCCCCCTGCCCCAC
CTAACACCACCCCCGAGCCTGGCCACAAAGGAAGTGCCATCAACCTCCACCAGGGACTCT
GAAGGGGCAGGCTGGCATTTACCTCAAAGATTTCCAAGAACGTCGGGCAGGGAGACTTGG
CCCACTGTCTCGTGTCACAGCTTAGGACCTTCTCGAAAGCATTTTCTACCTTGTTCTGTC
CAAGAAACAGTAAAGTGACTTCCACCTCAGTCTTCTCCCGGCCTGGCCACAGCCCCTGGA
CCGTTGAGGCTGGGGGTGGGAGCCACTGGGGCTGAGGACTGGAGTGAGGGGAAGGCCTGG
AGCAGCCCTGGGGGACACCAGCCAGGTTAGTAGGAACCTTCCTTGAACTTGGGCGAGAAG
TCCTGAGCAAAGACTGTCCTCCTTGGCCTCTCTCTCCATCAGGAGCTGGCCTGTGAGGTC
CATTCCAGGCCCCGTCCTCCTCTCTCCCTTCCCATGTGGCCGGCTCTCTGTTGGGGGAGC
AGAGCACCCACAGCGGCCGGGAGCTGAAACGGGGCATCCTGGGCACCCAGGCCATAGGCT
GCCAGGGCCCAAAAGGCTTGGCCAGGCACCGGGGGTACCCAGGCCTGGGAGACCAGGGCT
GGATGGGAGGGTCTGCCCCCAGGAAGCTCCTCAGTCCCTTCCCTAGCCCCGCCCACCCAC
TCCCCATGAGGCCAGAACAGTTCCAGAGTTGAAGTAAAGCCTGTACTCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTGAAGGT
TGGAGGTCCCAGTCCACCCAGAGGCGTCTCGGAAGAAAGGCCTGGAGATCTACCTCTGAA
AAATCAGCCACTGAAAATCCTATGGAGCACAGTTCTACTCTCACACACGTGGGGGTGCCG
CGAGTCAGGGTCCACTCCATGGCCACTGGTTGGTGGGGGGGATTCTTTAATCCAGCCCAG
GCTAGAATTTAGCAGCTCCGCAGAGAAGTGTGAACGGCCAGTGCTTCAAGGAGACAGAGC
CCTGAGCTCAGCTATCACTCTCCTCAGCAGCCAAGGAAAAGGTTGGCTGACATTTCCATG
CCACTCACTGGAAAAGTCTGGTTAAATCTATACTTATTCTCCATCTTGTTGTCACAAGGT
TGAGTTTCTAGGCCTGTTAATACCCAGGGCCGAGAGCTCTCTTCATTCCCAAAATTCTCC
CACTTGTCCGCTCCTTGGTGCCTAAGCGCCCGTCATGGGAGCCACATCCATTCAAAACGA
TGGTCGTGGGAAATTGTGATGTGCCCATGAGTCCCACCTGCTCACCATGGAGCAACTGTA
TCCACTCGCCTTGCGACAAGGAACTTGCCACCTATGAACCTGCGGCTTTGCCAAACCCAC
TCTCACGGTGCATGTGTGTGTGTGAGTGTGTGCATGTGTGTGAAAGTGTGTGTGAGCGTG
TGCATGCATGTGTGTGAACATGTGTGTGCGAGCAGTGCATGTGTGTGCAAATGCGTGTGA
GTCGTGCATGTGTGAGCACGTGAGTGTGCTTGTGGGTGAGTGTGTGCATATGTAAACATG
TCTGTGTGCTATGCATGTGTGTGATTATTGCATGCATGTGAACGTGTGTGTGAGCATATG
CATTGTGTTTATGTGAGCATGTGCATTGTGAAGCCGTGAGCACATGCGTGTGCTCGTCTG
CATGTGTGTGTATGTGAGCGTGTGCGTGTGTGCACATGTAGCTGGACCTCACTTACTAGT
CAAGGCAGCATGACACATGATTTGGGCTTCTCCCCATGTGCTACTTTGTCATGACCCCGG
CTCCCGGGTCATTGCTAAGCTGCAACACCCTGTCACATTTCCTGTGTCAGTAGTCAGGGT
CAAGACTCGGCTGCCCCACCCCAGGCTGGGGACGGGCGCCAGCCTAGCACTCGGGGCCCA
CTCGGGCCACCATACCCTCCGCCTTCTCCCCTACATGCCATTTACCTGGATCAGCTCCAC
CAGCTTCTCCTGCAACTGTGACATCCAGGTAACGAAGACCAGCAGGTCCAAGAGGCTCCC
TGCCTGGGAGGCACGGGAGGTGGGAGGCACATTCTGAAGCTTCTCCCTGCTGGAGGGAAG
GAGCACGAGAAGTGCAGAAACAGGGAGGGGCAGGTGAGGCCAGGGCTGGGTCGTGGGGGG
CAGCTCAGAGCTAAGAGCAGTGGACTCCAGGTGGGACCTGCTGGGGAGCCTCACCAGCCT
CCAATGCCCCCCGTCCCTGCTCTCAGGGCTGGGCAGCAACTTGAGAGGCATTTGGGGAGG
ACAGATGGGAGCAAAAAGCTCTGCTTGTATAGACGAGCCTCGACGGTCCTACGCAAGACT
CGGCCATGTGCTCCCTAAACACACGCACATGCTACCATGTACACACATGCATGTACATGT
ACATGCTCACACACTCACATGCATGCAATACACCTACACACAGCGTACACATGCTCACAT
GTATGTAAATGCATGTGCGCCTTTACATACACACATGCTCACGTGTACACATGTCTGCTC
ACAGACATGTGTGCTCACACACATGCACATACCCCCAAATGCTCACATGTACACATGTCC
GCTCACACAGATGCGTGCTCACACACATGCACATACCCCCACACATGCTCACATGTACAC
ACACCTCTGCTCACACACGTGTGCTCACACACATGCACATACTCCCACACATGCTCACAT
GTACACACACCTCTGCTCACACACGTGTGCCTCACACACATGAAGTTATGTGAAACACAC
AACACTCCCATGCATGGACATATGTGCACACGTGTGCACATACATAGCCCAGGCACACAC
ATGCACACCACACGCTGTGCACCTCCATGCATCCCATACACCCCACACACATGCATGTGC
ACATACGCACACTCGCACTCATGCACAGACTCTCCCTAGGCCAGCTGAGGCCACCCTGCC
CTGCCTCCCCCACCCAGGTGGCTCTTCTAAAGGCCTCTTCCAACTATCGCCGAGGCCGAG
GTCCATCACCAGAAGGCAGTGGCCTCGCCCAGGACCCAAGGAGAGCTCACCCCCACTTCT
CAAACAAGATCTTCTTGCTCCACTTGTACAGTTCAGAAGCTCTTGTCCATTCGTTGCTGC
AGAAGCGGATGAGCTCTGAGAGGTTGCTGACGAGGACATCCTGGAAGCAAGCCCTGTAGC
GGACCCAGAGGCTAGGTCCCAGCTGCTCTACCCGGCCGGATCCCAGGCTCTGCTCCACGG
CCTTCTCCAGCTTCCCCAAGTATGGGCTCAGCTGGTCATGAGGGTCTGGGGTGGGGATCC
GGGCCTCAGCGTCCCTCCTCAGCAGTTTCTCTAGCTGGCTGCCCCAGGTGGCAACACCAC
TGGCCTGGAGGTCACTAGTCTCCGGGGTCTGGGGGTTACTCTGAGCCCAGGCCACGGCAG
CCACCACCGACTCGAGCTGTGGCTCCAGCTCTCTGTGTGGCCCATGATGCTCCAGGGCCT
GCTTGACCACCTGCCACATCCTCTCAGCCACAGCCTGGAACTGGGGGCCACAGTCCTGCC
CTTCCATGTGGCCTGATGAAGCAATGCTCTGGCAGGCTTCCAGGAACCGACCTTCCATGA
TTAACTTCTGCAAGTCTGGAAGAAAGGGGTCCAGGAACAATGGCTCAGAAGGGGCCTTGG
GAACAGGGAGAAAGGGTGAGGCAGGGCAGGAGGGTACTGCCTGCCCGTGAGTGTTAAAGC
TTAGTTCTCACTCACGTGAGGATGTTGATGTTAGCGCCATGGCGTCAGCCTGACTCCTGA
GACCCCATGTACGAGAGAACAAAACGCTGCCCTGTCCTGCACCATCCCCGTGATCAGACT
GTTGTGATCTACAGGGTTTTCACAGTTGATTTTCAGAAGTAGATTGCCAGGCCCTTCTTC
CTAGTCTGCCAAGGCTGTGAATCCTTGCAGAAGCAGACTTACTCATCTTTCTCCCATGGA
GCGGCTGGTGGATTTGAACTGCTGACCTTTATGTACAATGGAATATTATTCAGCCGTAAA
GACACATGAAGCTCTTACACATGAACATTGAAAACGTGCTGCGGGAAATAAGCCAGGCAC
AAAAGGACAAAGATTATACAATCTCGCTTTTGTGAAATATCCAGAATAGGCAAATACGTG
GGGACCAGAGTTCCTGAGTGGTCACCGGGGCCTCGGAAGAGCGGGGAAAGGAGGAGTCAC
TATTGAAGGACCACTGAGCTTCTGTTTGGGAGGAAGGAAATTGCTCAGAAATGGATAATG
GTGACGGTTGCCCAACACAGGGAATGTAGTTAATGTCACTGAGTTGTACACTTCAAACTG
GTTAAAACAGCAAACTTTTTCTTCTATATTTTACCACAATAAAACTTCAAAAAAAAAAAA
TTTGTTTTTTTAAAATCAACATTTTGCCTTCTCCCAAGTGTGGGACCCATTCGTTATTCT
TTCACAGAGCCATTCCAGGAGGCAGCGGTGCCACGCCTTTTTCTGCCCCTCCCTCACAGG
GTGCCCGGGACACTCAGAGCTGCCCATTTCCAGCCCCTTGCACAGACACGAAATGCTCCT
GCCGAGAAACCCCAGCCCCGAGCCGCCCTCCTCAAAAGTCAGACCTTGGAGCTCAATGCT
CTGGCCTTGACAGCCTGAGTGCTCAGAGGGAAAGAGGCCTCGTCTGGGGTGGACACAGCC
CCGCCACCCCCATCCACCCCCTGGATAGAAGTCTCCTGCTTGTGCCCTCAGCTCCCCAGG
ACAGGGTGAGGCCCCCTAATGGCCCCGTGGCCCTTTCCTACCTCACCTCACTGCCCCACC
CCCAGCCCACCAGCGGGTTGCCCTACATTCCTGCAGAGCTCCCACCAGCACCCTGTTCCA
GACCACCACCCCCACAACCCCACAAGCATCTGTCAGTTTGCCTCACTGTGGGGGATGGGC
TGTTCCTGTGATGCTGGAAGCCATGCCACCGGTATTCAGATACCAGCAGGGTCACCTGTA
GAGGACAGGTTTTAGCTGAGCTTCCAGACTAAGACAGACTAGGAAGAAGGACCTGGCCGT
CTACTTCTGACAAAAGTTACCCAGTAAAAATCTCATAAATAACAGCGGAACATTGTATGA
TATACTGCCAGAAAATGAGCCCCTCACGCTGGAACCCAAAACCAAGCCCATTGCTGTTGA
GTAGATTGCGACTCATAGCAACTCTATAGGACAGACTAGAACTGCCCAATAGGATTTCCA
AGGAGTGGTTGGTGAAGTCAAATTGCCAGCCTTTTGAGTAGCAGCCATCGCTCGCTAACC
ACTGTACCACCAGGGATCCCTCAGGTTGGAAGGCACTCAAAACACCATGGGAAAGAGCTG
CCTCCTCAGAATAGAATGGACCTTTATGACATTGATGCAGTCAAGCTTCTGGGACCGTCA
CTCGCTAATGTGGCGCCACTCAAAATGAGAAGACACAGCTGCAAACATCCATTAATAATA
GGAACATGGAATGTAAGAAGTATGAATCTAGGAAAACTGGAAATCGTCAGAAATGAAATG
GAACATGTGCAGATCAATATCCTAGGCCTCAGTGAGCTGAAGCGGACTGGTACTGGCCAT
CTTGAATCAGGCAATCGTATGGTCTACTCTGCCAGGAATGACGAATTCAAGAGGAATGGC
ATTGCATTCATCATCAAAAAGAATACTTCAAGATCTATCCTAAAGTACAACACTGGCAGA
GAAAGGGTCCTGTAGGGTTACTACCTGTTGGAATTAACTTAATGGCCATGGGTTTGGGTG
TTTTATTTTGTTTAGCACATAGATAATTCTCCAAAAGAGCCCAAGACCTAAGGCAAAGCA
GTCTCCTGTAACTTGTTTACTAGGCTATTGTTTGACCTACAGGTGACTCCAGCTCCTTCA
AGGCTCAAGGTTCAAAAGGACACCTCAGGGCAAATGGCCTGAGTCACCCCAACTCCATGG
ACCCCAGAAATCTGGTTTACAGGAGAACTGAAATGGTTTCTCAGTTTGAATACAAAATGA
ATGTAAAAAAAACTCCTTGAGAATTATTATGTTGATTGAATGTTTAGATATGTTGAAACA
GTAACTTTTTAACTACATTGGGTTAAATAAAATATATCCGTGCTATTAGATGACTTGAGG
TACTTACTGATGAAGATCAAAAGCCACAGCCTTCAGTACGTTCAGTATGTTCAGGGTTAC
ACCTCAACATAAAGAAAACAACAATCATCACAAAGGACCAATAAGCAACAGCACGACAAA
CGGAGAAAAGATTGAAGTGCCAAGGATTTCGTTTTACTTGGATCCAGAAGCAACACCCAC
GGAAGCAGCAGTCAAGAAATCAAATAACTTTGCATTGGGCAAATCCAACTCAAAAGACCT
CTTTGAAGTGTTGAAAAGCACAGATGTCACCCTGAGGACTAAGGTGGCCTGACCCCAGCC
ATGGTGTTTTCAATCGCCTCATACGCACGCAAAAGCTGGACAATGAATAAGGAAGACCAT
AAGAAGAACTGACGCCTTTGAATTGTTGTGTTGGCGAAGACTGTTGAATATACCGCGGAC
TGCCAGAAGAACAAACGAACCTGTCTCGGGAGATGTACGAGCAAAATGCTCCATAGACTC
AGGGATGGGGAGACTGTGTCTCACATACTTTGGGCATGTCATCAAGAGGGATCAGTCCCT
GGAGAAGGACATCACGCTTGGTAAAGTACAGGGTCAGTGAAAAAGAGGAAGACTGTCAGT
GAGATGAATTGACCCAGTGGCTGCAAGAATGAGCTCAAGCATAACAGCGATCCTAAGGAT
GGCGCAGGACCGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTGAGAAGGA
AACATCTTACTAAGCACCTACAGATCTAACCCAGATCTGAGAAGCAAGTCCAGAAATACC
AGAAGCAGGTCATAGAACGCACCCTCAAGATTCTGTCCCTCCAGAACAACTGTCCCTGCC
AAAATCTGTCTTAGGGTTCTCTAGAGAAATAGGGCCAGTGAGAAGATACACGTGCATGTA
TAGACACATTCAGAGCTCCGCTGCTAACCAAAAGGTTGGCAGTTCAAAACCACCCTCCTT
GGAAACCCTAAGGAGCAGTTCTACTCTGTCCTGTAGGGGCTCTATGAGTCGCACTCCACT
CGACAGCGACAGGTTTGTTTTTATATATATACAGGAGTCGCTGGCTGGTACAAATGGCTA
AGCACTGGACTACTCGCCGAGAGGCTGGCAGTTTGAACCCACCCAGAGGTGCCTCAGAAG
ACAGGCCTGGCAATCTGCTTCTGAAAGAGCAGTTCTACTCTACACATGCAGGGTCATCAT
GAGTCGGATTTATTTTGAGGAAATGGCTCACTCAATCGTGGGGCCTGGTGAGTCCAAAAT
CCCCAGGTCAGGTGGTGGGCCAGAAACTCCAGCAGTCTTATCTATTCACGGTCTTGAAGC
AGAGTCCCCCTTCCTCAGGAAACCTGGGGTTTTGCTCTTCAGACATTCAACTGAACGAGG
CCCACCCACATAATGGAGGGTGACCTGTTTAGCTTAAAGTCACTGATTTAAATGCTAATA
CGTACTTCCTAGGAACACCTAGATAGTATCTGACCAAACACTGAGCACATCACCGGGCCA
TGTGGGCACATGGCACTGAGCACCACAAGTCCCTTGTCCCTGCAGGCAGCACCTGTCCAA
TCAATCAGGGAGAGATACAGAACAGGGGGGATGAAGAAACAAATGAACAAAAGTGGAGCT
CGTACCTATCTTTGTTTCTTGAAGGAGAATATCTGTCTCAGGTCCTGTCTTCCCATGAGG
TCTGCGCCAAAGCCCTTTAATCCGCGTGAACAGCTTGGGCTTTGTCAGGTGCCCGTGCAC
CCCTCTAGGCTTTTTCTGTCCCGACTCGCTGCCTGGGTCCTCCTCGTCTATCCTCTCCCA
CTTCTTTCCTTTGTGCTCCATGTTCCTCTCGCCGCCCCTGCCCGGCAGCCTGGACCTGCA
GGCCCTTCCCCAGATCCAGCTCTCAGGGACCTGAACTTCTCACTTTTACTCTAGAGCTTT
ATATGAGCTCTGAGTCACTGGGTTTGTCCTCAGTCTCTACCAAACAAATGGACACGGGAG
GTGGCTGGGCCACTGCCAGAGGAACTACCTCTGGGACTGAAATACAGAAGTCAACACCCA
ATTACAATTTCCCAGATTGCACTGACCAGGGTTTTCCAGAGCAAGGACTGTGTGGGTGGG
GTCATTATTCGTCCCAGGGTGCCTCCCTGAAACGGTGGAATCTCGGGGCAGCCCTAGGCC
AGAGTGAAGGCAGTTCTGTTAGGTGACCATGCAAAGCCCAGGGTCTCGGCCGACATTGCC
CACCTGTACTGTCATAAATTGAGAATCAACAGTTGTTCACAGGTCATTGACAAAGAAATT
ACTCAGGGCTGTGGTTTCTTTTTGTAGTCTCTGAGTGGTGCGAATGGTTATCCTGCTCAG
CTCCTAACTGAAACTTTGGATGCTTGAGTCTACCAAGAGGTGCCTTGGAAGAAAAGCCTG
GTAAGCTACTTTCAAAAAATCAGCCATTGAAAACCCCATGGAGCACAGTTCTATTTTGAC
ACACATGGGGTTGCCATGAATCAGGGCTACCTCGACAGCAAGTAGTAACTGCTCCTCGTT
GTTTCTTTTTAACTGACAAGGCTATGGTTTTCAAAGCCCCATTCACCTGGGAACTGTTCA
CCTGCCCAGGTGGGTGGCTGGGGTCCTCATTTGATAAAGGGAGACACTGAGGCACACCTT
TGACTTTGGGTTAGAACTTCCCAGGAGGCCTTAGTGAGATCCCACCAACAGCAGTTATCA
CTCAAACTCTGGAGTGGGTTTTATTTCAACGTGGCATGAGGTAGGGATCCAACCTCATAC
TTTCCCTGTGCAAAACCCTTTTCTCCAGCTTCAGTTGTTAAGCGGTGCCTCCTTTCTGTG
TCCACCTGACATGCTACTTCTTTCATATACGCCCAACATTTAAACACAGATATGTCTGAA
TCCAGGGCTCCGCTTTATAACCACTAACCCCGAATTCTTGTAAACATGCTCAGGCATCTC
CTGTCTTTAAGGAATGCCTCCTGGACCCCATATACACTGTATGAGTTTCCTCTGGCTGCT
GTAACAAATTACCACAAACTTAGTGGCTTGAAACAGTACAGATTTATTATCTTTCAGTTC
TGGAGATCAGAAGCCCAAAATGCATCTCACAGGGCTAAGGTCAAGGTGTTGGCAGGCTGT
GAGGCTCTGGGGAGAATCCGTTTTCTTGTCTTTTCCAGATTCAAGATGCGACCTGCACAG
CTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGTTTTGTATTGCACAAAAGGGTCTCCCACAGCATGCTGAGCTTTTC
ACGGACAGCCTCCTGTAATTCTCATGACAACCCTGCTGGTTAGGCGCTATTTTACAAAAG
AGGAAAATGAGGTTTCAGGGAAGTGAAGTGGCTCCCCCAGCAGGTCTCCCAGGTAGAAGG
TGCCATTGCCAAGATGCAAACCCCTATTTGGAATGCTGGGAGGATGTCTACTGATCTCAC
GTACCCCTTTTTCGTGATTCAAAAGGTATCTGGGATGTAAGAAAGCACATGTTCTCAGAG
TCCAGAGCAAGCAATCCCTTCCGACTGCCTGCAGGAAGTTTAGACAGATGTGTTTTCACA
GGTCAAAGGCTTGGATGGGAGCACTCAGCTCAGGCGGAGGGGGAGAGCCGCAGTGGCCCA
GCAGAGGGTGCCACAGGGAAAGTGAGGGTCCAGCAAGAGGCTTGTGACATGAATGTCCAC
TAGCGAAAGTCTCTAGGCACCCCAGATGAACAATGGTGAATGACCGTAGTGCCTATTTCT
CATGCATGGAGGTGGTGGACCTCCACATCGTGCCTGGATCTGGAAGCCTAAGGACAGAGG
CACACCTCAACTACAGGACCCCCACTCTTCAACATAAAGTCTCGTGACCCCCATGTCTGG
GCAACATGCACCATTGGCAGCTGGAGGGGGTGGGCAGGAGATGTGCTATGAGAACAAAGC
CAGCCTACCAAGTTGGCTTCTGCTTCCCTGGGACTGCCCAAGCACATGTTTCACACAGCC
ATCATTGCCCAGCCCTGAAGTTCCCAGCCCCTGTAAACCAACACCCCCCAGGTGTACAGA
CCCTTCCAGAGGCAGCACTACACAAAGGCCGCCAGGAGCACACCTGCAGTTAGACAAAGG
TAGTCACGCTGGTTTGCTGCAGCAAGGAAGAGAGGGAACCAGGGACCAGTGGGGTGTCCC
ATGGGGGCACAGCAGGATTACCCTATAAGTAAAGTACTCACGGGCCCAGTCGTGCCTTCG
CACCAATCTGCAGTGCACCATTTCACCCGTCCCCCACCACAGCAAAGATGTGGTAAAACC
CATGAGAAATAGCTTGCCACAGATTAGCAAGTAAACACAGTTAAGCCCGTGTGTACCTTG
CTCAATGCTAGCCAGTGTGTATAGTGCTCAAGGGTTAATCCACCACTGCGTGGGGGAGTC
AGGAACAGGGTGTTATTCAAAACAGGGGCGGGGGTGCGGGGGACAGGGGATGGGAGACGG
GGGGGGGCATCCGGTGGGAGTCCCCTGAGCCACCACATCACCTCAGGCGTTTACTTTCAG
TTTTGTTCTCTTCCAGTAAACACTGGAGCTTCTCGGAAATCACACGGGAAGTTCTCATTT
GTTTTGCTTCTAGCATAAAACCTCTTGGGAATAGAGGTCACGCTCGAATCAGGGGTCTTC
TGTCTGAATCTAAGACTCCTCACTCTGCTCGGGGACCTGAACAACGTGCGGAGGCCCCGG
TGTTGGACTTTATGTGGATTACGAGCCCAGCCCCACGCTGAAGTTTGGTAAACAATTGTG
CAAGGACAGGAATGCATGGCCTCCCTTGATGACCCACAGTAATGAGACATCGAAGTTGTG
GTTAGACAGAAGTTTAATACTGAACCAACATGAGACGTAAAAATAAATAAACAAAAGGCA
AACCTGTTGCCGAAGAGCTGAGTGCAACTCACAGCAACCTCATGCTTCGGAGCAGAACTG
CTCCACTGAGTTTTCTTCGCTTTAATGTTTATGGCAGTAGGTCACCAGACCTTTTCCCGC
AGCACCTCTGTGTGGATTCAAACCACCAATCTTTCGGTTAGTAGCCGAGAGCAAACCATT
TGTGCCACCCAGGGACCTATAACATGATACCTAGCTTTTCTAAAAATACCTCCAGGTGCA
TTATTAAAAAGAACGATGTTCTGAAAAGGACAACAAGACACCTGGGGAATGCAAAGCAGA
GGGAAGAGAAGGTACAAAACAGAAGGCGTGAAAGTATGTCACCCAGTGCACAGGTAGGTG
GCTGGGCGGGGGGAGCCTGCCTCGCGGGGAGCCGGCGCTGCCAGTGGAATGATGTGATGG
ACTTAGTTTGTGCAGGGTCTTCAATGCCAGATAACGTAAGGAATTTAGTCGTCGTTTTCC
AACTCAGGAGTGCTACTATGGGGTGCTAAGCAGGGGATTAACCTAAACTGATGGACTTTA
GTCACTTTTCTCCTTGTGTGCAGGTAGGTTCAAGACTGTTGTTGTTGTTGGATGCCATTG
AGTCGGTTCCGACTCACAGCGAGCCTGTGTACAACAGAACGAAACACTGCCCAGTCCTGC
GCCAGCCTCACAATCATTTTTATTCTTGAGCCCATTGTTGCAGCAGTCGTGTCAATCCAT
CTCGTTGAGGGTGGTCCTTTCTTTCCCTGACCCTCTACCAAGCGTGATGTCCTTCTCCAG
GGCCTGATCCCCCCGATAACATTTCCAAAGTATGTGATAGGCGTAGTATTTCCATCTTTG
CTTCTGAGCAGCATTCTTGGTGTACTTGTTGTAAGACAGATTTATTTGTTCTTTTAGTGG
TCCATGGTATATTCAACATTCTTCGCCAGCACCACAACTCAAATTGTCAATTCTTTCTTT
GGTGCAAAACTAGAGCCAAGGAAAGTAGTCCAAAGGTTCTTGAATAATCCAAACAAGAGG
TTCTTGTGAGGCAGACAGCCTCAGAGCCCAACCGTTCTTAGAGACACCTGCTGTGGCTTA
TCCTTCTACACCGAGCAGAAAAGGCTGCCCATTCTTCTGGAACTGTCCTGGACGAGATAC
CCACAGAACAGCCATAGCTGGCCTCAACCAGTTTTAGCAGGTTTTCTACACCATCTTAAC
ACTTCAAGTGACCTATCAGCTCATTAAGTGAAAAATACATACTGGGTGGAGACTTAACAT
GCTAATGAAGGAGAATTGACCTCTTCTTCCATCCCAGAGAAAACCCTCGTCTAGAGAAAA
CGCATCATCACCCCCCAAGCCCTGAGTGCCTGTGTGAAAGTCAATCCTGAATATTCATGA
TGAATTTGCATTTCCTAGTCTGCTCTCTGTAAAGCCCACCTCCCTGAGCTGCCAGCAGCC
TTGGAGGCAACAGCCCCACTTGCTCCTTTCCTTGTGCAACGTAATAAAGATGTCTTTCTT
CTTCCACCTCGGCCTCTTGTTTATTGGCTGTAACAAGTTTTTTTTTTTTTTTAACAAGTC
ATGCCAAGCGGAACCTGGGGTTTCCACCCAGCAACACTTGAACTAAGAGGGCAGCAGTGG
GGATGGAAAGGAAGTGGATATGAAAGGTGTTTGGGAGACAAAATCTGCAAATCCAGGGAC
TCAGGGGAGAGAGGAGGAGCTGAGCTGCAGGAGACAGCAGGCACGGTTCCATCATCTCCA
GCAATCACTCTGAGCACTCCCATTATAGACTGCTTGGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNACATGTCCAAAGTATGTGAGACGTAGTCTCGCCATTCTTGCTTCTAA
GGAGCATTCTGGTTGTGCTTCTTCCAAACAGATGTGTTCGTTCTTTTGGCAGTCCATGGA
ATATTCAATATTCTTTGCCAACACCACAATTCAAAGGCATCAATTCTTCTTCAGTCTTCC
TTATTCATCGTCCAGCTTTCACATGCATATGATGTGATTGAAAATACCATGACTTGAGTC
AGGTGCTCCTTAGTCTTCAAGGTGACATCTTTTCTTTTCAACACTTTAAAGAGGTCCTTT
GCAGCAGATTTGCCCAATGCAATGCGTCTTTTGATTTCTTGACTGCTGCTTCCATGGCTG
TTGATTGTGGATCCAAGTAAGACGAAATCCTTGACAACGTCAAACTTTTCTCCGTTTATC
ACGTTGCTGCTTACTGTTCCAATTGTAAGGATTTTTGTTTTCTTTATGTTGAGGTGTAAT
AAATACTGAAGGCTCTGGTCTTTGATCTTCATCAGTAAATGCTGCAAGTCCTCTTCACTT
TCAGCAAGCAAGGTTGTGTCATCAGCAAAACACAGGTTGTTAATGAGTATTCCTCCAATC
CTGATGCCCTGTTCTTCTTCATATAGTCCAGCTTCCCAGATTATTTGCTCAGTATACAGA
TTGAATAGGTACGGTGAAAGGATACAACCCCGATGCACACATTTCCTGACTTTAAACCAC
GCAGTATCCCCTTGTTCTGTCCAAACAACTGCCTCTTGGTCTATGTACAGGTTCCTCATG
AGCACAATTAACTGTTCTGGAATTCCCATCCTTCATGATGTTATCCATATTTTGTTTTGA
TCCACACAGTCAAATGCCTTTGCATAGTCAATAAAACATAGGTAAGCATCCTTCTGGTAT
TCCCTGCTTTCAGCCAGGATCCATTTGACCTCAGCAATGATATCCCTGGTTCCACACCCT
CTTCTGAATCTGGCCTGAATTTCTGGCAGTTCCCTGTCAATATACTGCTGCAGCCACTTT
TGAATGATCTTCAGCAAAATTTTGCTTGCATGTGATATTAATTTCCACATTCAGTTCAAT
CACCTTTCTTGGGAGTAGGCATAAATGTGGATCTCTTCCAGTTGGTTGACCAGGTAGCTG
TCTTCCAGATTTCTTGGCATAGAGCAGTGAGCACCTCCAGCGCTGCATCTGTTTGTTGAA
ACATCTCAATTGATATTCCATCAATTCCTGAAGCCTTGCTTTTCACCAATGCCTTCAGTG
CAGCTTGGCCTTTCTCCCTCAATACCATCAGTTCCTGATCACATGCTACCCACTGAAATG
GTTGGACGTCAACCAATTCTCTTTGGTATAGTGACTCTGTGTATTCCTTCCACCCTCTTT
TGGTCCTTCCTGCATTGTTTAATATTTTCTCCATAGAATCCTTCACGATTGCAACTCGAG
GCTTAAAATTTTTCTTCAGCTCTTTCAGCTTGAAAAATGCCAAGCATATTCTTCCCTTTT
GGTTTTCTATCTCTAACTCTTTGCACATGTCATTATAATACTTTGTCTTCTCGAGCCGCC
CATTAAAATTTTCTGTTCAGTTCTTTTACTTCATCATTTCTTCCTTTGCTTTAGCTGCTC
AATGTTCAAGAGCAAATTTCAGAGTCTCTTCTGACATCCATTTTGATCTTTTCTTTCTTT
CCTGTCTTTTTAATGACCTCTTGCTTTCTTCACATATGATGTCCTTTATGTCATTCCACA
ACTCATCTGGTCTTTGGTCATTAGTGCTCAATGCAACAAATCTATTCTTGGGATGGTCTC
TAAATTCAGGTGGGATATACTCAAGGTCATACTTTGGCTTTCGTCAACTTGTTCTAATTT
TCTTCAGTTTCAACTTGAACTTGCACATGAGCAATTGATGGTCTGTTCCACAGTCGGCCC
CTGGCCTTGCTCTGACTTATGATATTGAGCTTTTCCATTGTCTCTTTCCACAGATGTAGT
CGATTTGATTCCTGTATATTCCATCTGACGAGGTCCATGTGTATAGTCACCATTTACATT
GGTGAAAAAAAGGTATCTGCAATGAAATAGTCGCTGGTCTTGCAAAGTTCTATCATGGGA
TCCCTGGCATCGTTTCTATCACCAAGGCCGTATTTTCCAACTACTGATCCTTCCTCTTTG
TTTCCAACTTTCGCATCCCAATCACCAGTAATTATCAATACATACTGACTGCAGAAGCTG
ATAAAAATCTTCAGTTTCTTCACCTTCGGCCTTAGTGGTTGGTGAGTAAATTTGAATAAC
AGCTGTATTAACTGGCCTTCCTTCTTGTTATTGTTGTTAGGTGCCGTCGAGTCGGTTCCA
ACCCATAACGACCCTATGCACAACAGAAAGAAACACTGCCCGATCGTGCTCCATCCTTAC
AATCCTTGTGATGCTTGAGCTAATTGTTGCAGCCACTGCGTCAATCCACCTCATTGAGGG
TCTTCCTCTTTTCCGCTGACCCTGTACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNAAAGGGAGAAAATAGGAGAAAATAGAGATAAAAGCAATTTAACTTTCCAGAATG
GGAAGAAAATACTTAAGTCCTCACCCTGAAAGAGCATACCAAGTCCTGAAGCGAGATTAA
AACAAAACAAAAATAAAATCAGTTTTATCCAGAACATATAAAGAACTCTCAAAACTCAGT
AAGAAAATAAACATGATGATTTTTTAAATGGTCAAAAAGTTTGAACAGATATTTCACCTA
GTAAAATATACAAACGGCCAATCAGTACATAAAAAGGTGCTCAACGTCTTTAGTCATCTA
GGAAATGCAAATTAAAACCACCACGTGAGACATTCTGCACCAGTTAGAAAGGCTGGAGTT
CAAAGCGCCAATCGCACCAGCACCACGCCTTAATGAGGACGTGGAGGAGCTGCAACTCTC
CTGCGCTGCCCACGCGAACGTCAAGTGAAGCAACCAATTTGGAAAACAGTCTGAGTGTTC
CTTAAAAAGTTAAATATGCATTACCGTGTGATCCAGCCATTCCACCATGGAGAGAAGAGG
AAACATATGTCACACAAAGATCTGTACACAAACACTCACAGCAGCTTCACTTGTGATCCC
CATCCCTGTACTCACACCCGTTACTGTCAAGGCGATTCCTGTAGCGACCCTACAGACAGG
GTAGAACTGCCCCCATGGGTTTCCAAGGCTATAACCTTGCAGAAGCAGACNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATCAGTC
CTCCTCCCCATGCTGTGGTGAGTGCAAGATGACAGCAGGTGGGCGCTCAAGTTGGGCAAA
GTAGAAGGCATTGGCTGAGGTGGGCAGGAAATGATGGAACTAGCTTTCAGTATAACAGGA
CAACCAGCATTTTGACTTCTGGGTCCTGTTGATTGAATTAAGATGAACCCAGTTTGTTTT
AGTAGAAAATTAAGTCAATGCCGTGAGCTTGATTGTTTCTCATATTTTGAAAACTTTTGA
CCAACCGTTTCTGTAAACAGGAGGAGGAGGAGGATGATGATTGGGGTGAGGATACAACCG
AGGAAGCTCAGAGACGCAGAATGGATGAAATCAGTGACCATGCGAAAGTTCTGACCCTCA
GCGATGACTTGGAGAGGACTGTTGAAGAGCGCGTCAATATCCTGTTTGATTTCGTTAAGG
TAAAGCATATACTTCAGAGGTAGTCTACAAGCAGTCTCAGCCCAACCGTGGACTGTTAGT
TACTTTACAATGGGTGACTGGTAACTTTTTTTCAAGGTTGTTATCTTTGGAATACTTAAC
ACATGGCTTATTTTTACCCCCCATCCCTGCCCTATTTTTGTCTTGAAGTCATTTTGGATT
TGCGGAACAATGAATCGGGTTTTTACAGTTGATTTGACCTTTCTTTTTAATATATGGTTT
TTTGTTAAAATATGTCACTACTTTTTTTCTCACGGAAGACCAGTTATCTGTGAGTCCAGT
TTGATGTGTCCCCGGAAGAAACCAGAAGGAAGTCATAAGATTCCAGACCTGCACTGCGGG
TGGAGCAGAATCCATGGTGGTTCTCTGGCTGCCTGTTAGGATCCACCTTCTTAAATAGTC
AAGCCCTCTTAACTGCTTAGGTTTTGTGAGCCTTAAATTCACTCATTGCTGTCAAGTCTA
TCCTGACTCATAGCTACCCTGTAGGATAGAGTAGAACTGCCCTTACAGAGTTTTGAAAGA
GCACCCTGGTGGATTTGAACTGCCAGCCTTTTCATTAGCAGCCATAGCACTTGATCACTA
TGCTACCAGTATTTCCATTGTGGGCCTTAGGATTCTTTTAAAATTGTCATATCTTGCTGT
TGTATTAATTTCCTGATTATCTTGCCTGGTCTGTGATAGGGTTTTTTTCTCTATAAAAAT
GGGTGTTCCGCCAATGGGCATTATCATTTATAAGTTAAATTTCAAAGCGGGAACTTTTCA
AGGTGTAGTGTTCTCTTAATTCTTAGGGATTCCTAGTAAAGAATAGGGACAAGTTGTAGG
AAAACACGAAGTTGATGAGAGCAGGACTCACCGTGGTTTCTGCGTCCCTCCATCTCAGTG
TATTTTGCTTCCTTCTGTTTACAGAAGAAGAAAGATGAGGGTGTTATCGATTCGTCTGAC
AAAGAGATTGTTGCTGAAGCAGAAAGGCTGGATGTCAAAGCCATGGGCCCTCTTGTTTTG
ACTGAAGTTCTTTTTAATGAGAAGATTAGGGAACAAATCAAGAAATACAGGCGCCATTTC
CTACGAGTAAGCAAATTATTTTCTAGGCTTATGTAAATGCAGTTACCGTTGTGTGAATTT
GGGAACGTCACTTAACTTCTTTTGCTAGCTTGTTTTTCCTGCCATTCTGAAAATGCTCCC
CATAGACCCTCTGGGTAAGTGACGCAGAGATCTTTACGTATTGGTCTTTTGCGAGCCATG
GGTATCTGGGCCGTAGCCTTGAGAGGATGGATGAACATCTTTCAATATTAGAGTTGTCAG
CTTGTTGATGCCAAAATTTATCTATTTGCAGTTTTGTCACAACAACAAAAAGCTCAGCGG
TACCTTCTTCATGGTTTGGAGTGTGTGGTGGCAATGCATCAAGCTCAGCTCATTTCCANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTTGAGAATTAAAAGATTTG
TGAGCAGTAATGTAAAATGGCAGATCCCGGTAATTCAAATTTTAAATTTTAGATAACAAT
AATAAAAGACAGGATTTTGCCAATTTAGAAGATACTCACGTTACTAGAAAAGATCCCAGA
CAGTAAAGATAGTCTCTTTAACGCAGGTTGCATATAGAAAAATTGTCAGTAAAAATTTGC
AAGCTGTCGTTAGGCTCCGGGGACCATTTAAAGATAACTTTTAGTTTCTGATATCAGAAA
CTTTCATGTAGAATGATTGCAGTATCTAGGTGGTTTGTTTTTTTTCTGAGAACTTTTTAT
TTACTCTTTCATTAGCAGATTATTGGGATGAGGGTTTGCAAATCAATGAAAAAAAAAAAC
GATTTATTTTATCAGGTGGTGTATTCAAAGACTGCCAGTGTTCCTAAGGTTGAAACTGTG
AAGTCTGACAACAAGGATGACGACATTGATATTGATGCCATTTAAAGTGATGGATGCAAC
CTAGCTTAACAGTGTAATGCTGCAAAATTTTCTGCATTATCAGCCAGAAGTGCAACATGT
ATGTGCCAAAGCTGCAATGGCTTAACATCATGCTACACTTTATACTAAAAACGTTATACT
GTGAGTGGTCTGTAATTAGCCCAATGTGACATCTAAGGAGTCCATACACATCCAGGAGCA
GATGTAGTTTGCTTATTTATAGCATGTTTCTTCCTGAAAATCTAATGGTGGACCCATTTG
GATCATCACATTTATACAGTTATAAAAATAAAGATTTGTTTTTGGTCATTCTTCAGATTT
TTGGCTCTGAATGACTTAAGCTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1171, 1485..1596, 2509..2629, 47752..47776, 48020..48178, 49104..49265, 49531..49545, 49548..49694, 50433..50567, 52215..52304
1001..1171, 1485..1596, 2509..2629, 47752..47776, 48020..48178, 49104..49265, 49531..49545, 49548..49694, 50433..50567, 52215..52301
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved