Loxodonta_africana Locus RPL3
snOPY snoRNA Orthological Gene Database
Loxodonta_africana RPL3
Loxodonta_africana
RPL3
GeneScaffold_1147
SNORD43
1484..1549
9582
GCAGACACCGGACGCCGCTCGCCGCCTGGGAGACCCTCAGCTCGAGCGCGGGCCACTCC
AGCTGCAGATCGGGAAGACAGGAACAGATGGGGTTTGGGGGAGGGAGCCCAAAATCAGGA
CTCGGAGAAGGCAAGTTGGTGTCGTGAAAAAGCATTCTTAAAAAAAGAATTCTCTCAATT
TTTGCACTGAGTTGGGACCCAGGAAACCAAGGTTTTAATCTTTCTTTTCAAGAGCTGGTA
AGACCGGCGGAGCTTGTTTCACTCCCCTGAACCTGTTTCTTCACTTGCAAAATGGTAACA
ACGCAGACCTACTGGGTGGAACTGAAACGGGGTTCGCCATGTGTTAAAGCGCCTTGGAAG
CGAAGCCTATAGCAGGGTTATTCAATTGCAGCGGTCACGGCAGCTCACGTGAAAACAAGC
GACGCCGCCATTTTTCTTCTGCGTAACAGCGCGTTTTGTCATATTTGGCTGCTGCCGAGC
GCCGTAAATCTGTTGCATTGTAAATCTCTTGCTTGCGTCTCAGCAGCGCTTCACCAAGTT
TGAACCCAATCACTCGCCGTAGAAACTCCCATGCGTGCCTCGGAAGTTGAGGTCTAGGTC
GGAAAGAATGCTAGACCTGGAGGAGCATGCGTGGAAGTGGCGCCGGTGCCCGCCCCCCGA
CCGGACGTTCCCCGCGGGCGCGCGCTCGCACGCCGGAAGGGGCGGGGCCGTGTACGCTTT
ATATACCGCGCGCCCACAGTCTGCCGACCTCTACCGGCAGGATTCGACGGCGCGATGGTA
CGTAGGGTAATGGCGGCTGTGTGGCTGCCGGCCACCTCGCCCCCGAATCCGTGGCGAATC
GCCGCCATCTGGACTCAGCAGGCGCCTGGGCCCTGCTTTAGAAGCAGGAGGTACTCAGTG
GGATCCCAAGTCAGGCCTATTTCTGGAAATGACGAGGCCCGAGGAGATGGCCGCGTGGAA
GATGAGCCTCGGGGCCTGCGGCCTGACTGGGCCCGACGTTCCACACCCGGCCACTCTTCC
CGTCAGTTTTTAAGTGCTGATCGCGATTGGGGGCCATCAGCACTTTACCTGGCCGTACCT
GTGCCTATCGGTGGGACCTTGAGTCAGAGAGGCGGGGCACCACTTTCAGTACTTGCTAAA
CTAGGAGGTGTAGCGATTACAGGAGGGTGCTGGAGGGGTGACTTTGGGCGGGTTGTTGAG
GCCCAGTTCCGAAGTGGTTGGGACAATTCTGGTGAGGCCTCTAGAGTTCTCAGAATCCAC
AGATGATGAGCCTATTGACGGGCGGACAGAGAACGCTGTGCTGATTGTCAATGTTCTGAT
GGGGCTCTGTCGAGCTCTAGTGGCCTGCTTTACCAGTCTCGCTCCTTTGGGAGCTGGAGG
GAGGAGACCTGGCGTTACCTATCAGTAGCTCAGCCACCCAGCTCCTGAAGTCTTCTTGCG
GTCGGAATCTTGATCTATGAAACCATCTGTACGAGGCTTCCTGTGCATCAAGTAAATGGG
CTGGTAGAGAAAAAGATGATTAACCTTCTTAAGTATTCTCGTTGATGAGACTCTCAGCCG
GGTAGCAGGGAACCAGAGAACTGAGAGCTGCTTGTAAGTTTGGATGTTAATGTCTGTCAT
TGTCTCCTAGTCTCACAGGAAGTTCTCTGCACCCAGGCACGGGTCTCTGGGCTTCTTGCC
TCGGAAGCGCAGCAGCCGGCACCGCGGGAAGGTGAAGAGCTTCCCCAAAGATGACACCTC
CAAGCCTGTCCACCTCACGGCCTTCCTGGGCTACAAGGCTGGCATGACCCACATCGTGCG
GGAGGTCGATAGGCCAGGATCCAGTATGTACACCTATACGTTTCATATTGGGGTGGGTAG
GAGTCAGGCAGACTCCGAAGGGGAATGGGGAACGTGTAGCTTGTCAGAACCCTTTCAAGA
GCATGTTCTAGGCTTGTTGATTGAAATTGAACGTGATGTGAGCGTGTCGGTCAAGAGCTA
CAAGGCAGAGAAGTGCGCTAGTTTTGAGATTGGAGCGGGTGAGGCTTTAAGAGGAACTGT
CTGCGTTTATTTTGGCGGGAGCACTTATCTAAGCATAAATTTTTGCCTCACCAAGAAGTC
CCCCGTGTTAGGGTGAAGTTCAAAGTAGAAGACCATAGCACTGGTAGTGAGCCATGGTAG
GTACTAATATTGCCATCGGGTTGATTTCCAATTCAGCAGCCCCGTGTGTGCAGACTACAG
CTGTTCATAGAGTTTTCAAGGCTGTGATCTTGGAGACACCAGGTCTGTCTTCCGAGGTGC
CTCTGGGTGGCGAGACTGAACTGCCAACCTTGGGGCTGGTATTGAAGCACTTAATTGTTA
GCGCCACCCAAGGACTCTTATTAACAGCAGGTGGTAATATCGTCTGTCGTTTGCCATGCC
GAGTTACAGCTGCAGTACTTAGGAGTATTGTTCAGGTAACAAGAGGAAAGGAACACTGGG
GAAATGTAAAACAGACTGGTCTTTGGCTGGCCTTAAAATGCAGTGGCGTTAAAAATGCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTGGGGTGTTGTAGCACTCTGTGAGTGGCTAGATT
GGAGCAAGAATTAGCGTGTGTGTTCCGAATGGCATGCCTTCCATTAACCTGTGGACCTCT
GCTCAGCTCCGCTCGGCTCTGCCCGATGAGCTCCATCCAGGCTCCGCTTGCCGGTGGAAA
AGGCTCCTTAGAAGCCGGCAATGAGCCCCGTCCCCGCCTGGTGCCAGTGTGCCTTCCGCT
CACCCTTCCTCGGAGGGGTTGATGAAGGCCTGTGCCCGGCCCCCTCCCCAACTCTGCTCT
GCTCCTGAAGGCATAAGTCCAAGAAGAAGGCTTTCACCAAGTACTGCAAGAAGTGGCAGG
ATGATGACGGCAAGAAGCAGCTGGAGAAGGACTTCAGCAGCATGAAGAGGTACTGCCAGG
TCATCCGCGTCATCGCCCACACCCAGGTGAGCACCTGTGGTGGTGCCCCAGAGGGTGACT
TGACTGCCTGCCCCTTTGTCTCCTGAGGCAACCTGTGTGTGCGATGCCACCTTCTGGTGG
CTGTGATCTTGTGGGTTCATCATGAGCTCAAACTGATAATTGCTAAGCCTCAGGATCCAG
GGCAGGGATAAGACTGCTGCTTTCAGGTTTCGTAAGCATTAACCTCCAAGTGGAGGAGAC
AGGCCACTGAGCAGCTTGAGGTTGGTTACACAGCAGCACAGTCCAGTAACTCCCTGGGCT
TCTGGGGCCACTTGACTGACAGTGGCTTCAGAATGCGTCCAGTCCCCCATATCTGGTGCT
TAGGTTTTTCTGTTGCCAAGCAGAGGGCACTGTGTCCCTGTTAGCTCTTAAGTAGGGAAG
TCATACCCGTTTTTAGGAAAATTCTTTGGCCTGGTGACTTAGTATTGTATAATGTTTGCT
TGAAAGAGTGGTGGTCAGAGGCTGGCTGTTAGGTATTTTGACTGCTAGGAGCCATGCCTA
TCGGTTGCCTGAGTAGAATGAATATTTCCATTTTTCACTGAGTGTTTGGCCTCCCTGCAC
ACTGCTGCCCTCTGAGACCCCTGCTCAGCCAGGCAGGTAAACTGCTCCTGACCCCAGAAT
GCCCAGCTCTGTGCCGTCCAGCATGGTGGCCACTGGCTGCTTTGTAACTCTAAGGATTTA
GTCGGTTTCACTAGCCACGTTTTGTACATTCAGTAGCCCTGTGGCTAGTGGCCACAGGTT
GTAGCATGTTTCTGCCACTGAATGAGGAAGGTTTTTTTGGGCAACTTTGCGAGCTTTGTG
GTTAAGTTCATTTCCTCCTTTAATTGTGTGATCAGCCTGTGATCTTGGTTGTTTGCTGTA
TTATTTTCTCCATGTCAGAGTGGGTTGTAAGGCTAGATGGCCACGCCAGAAGGAACAGTG
GATGAGTTGGTCACAGGATCTGGTCAGATCTGCCTGGTTGGCGTGAGCCCCGTGTCTCTG
ACCCTGGGTCAGACACCAGATTTGAAAGGAGAACTGAACCTGGTGGGGAGTTAACACGTG
GCAGTCCTTCGCTTTTGCCGGTGGGGAAACCTGAATGACGTTCAGAGGGACCTTGCTTAC
CTTGACAGCAGACCGCATGCCTCAGCCCTTCTGCCATGTGAGGGGCACTTCAAGTCCAGG
GAAGTTAAGCATCATCTCTTCTCCCAGATGCGCCTGCTTCCCCTGCGCCAGAAGAAGGCC
CACCTGATGGAGATCCAGGTGAATGGAGGCACAGTGGCCGAGAAGGTGGACTGGGCCCGT
GAGAGGCTGGAGCAGCAGGTGCCTGTGAGCCAGGTGTTTGGCCAGGACGAGATGATTGAC
GTCATCGGGGTGACCAAGGGCAAAGGCTACAAAGGTGAGGTTTGTGGGTCTTGAGTCTCT
GGTTTACCCTCTAATGTAAGTGATGTCAGGCCCAGCTGTTCAGTGATGAGGCTGTGGAAT
GAGCGCTGGGCACAGCGCCTGAGTCAAGACTGCGGAAACGTTCCTTGCTGCCTTCCTTCT
GAGAACAGCCATGTGGGCAGAGATGGCTGGGGTGGTGGGGCTGCTGTACACGTGAACCCC
TACTGTCTGCAGTCGCTGCAAAAGTTGAAGGTTAGGTACTTCTGTCGTCAGTGAACCACA
TTGTTAATGGGTTTCAATGCTTGCATGCACAGTCTGGTTCAGGATTGCTTCTCCAAGGCT
TTGTTCTTGCCCGGATCTGTAGCTTACGATACACCTCTAAGGAGAGGCACTGAGGCTTTG
AGTGTGACGCTGGTTGAATCTACCTGTGTTTGTGCCTCATTTATCATTGGGTGGTAATTG
TTTCAATGTTGAACACACTGTACTAGCACCTCAAACTCAAGAACACAAATGGGCATTCAC
CACAGAAGGGCCAGCGGGGTGAGGTGCACACCTCTGATGGTGCACTCAGTGACAGCAATT
TGCGTCCATTCCAGGGGTCACCAGCCGCTGGCACACCAAGAAGCTACCCCGCAAGACCCA
CCGAGGGCTGCGCAAAGTTGCCTGTATCGGGGCCTGGCATCCTGCCCGCGTGGCCTTCTC
TGTGGCACGTGCTGGGCAGAAGGGCTACCATCACCGCACTGAGATCAACAAGAAGGTGAG
GGAGATTTGTCAACTGAGGATGGCAGCCCTGGGCAGGGAAAGACAATCCCAGGATTGGCA
GTTGGGGCAGTGGGGGGTGGGGTTCCAGTCTGTTTCAGCCCTATTCTGACTTCTGGTACC
ACGTGGACTTAAATCACTCATATCTGAAAAGGGCAATTCTGGCTCTTGGTGTCAAGGCAC
TTTGTGAATTCCCATCCTTCAGGAAGTCTGGTGTGGTTGACCTTTGGCTTGCCCAGGGAG
AAGAGGTTAAGGCATCTCTGAGTTATACAACAGTGTCATTAGTCCGGTCCAGGCCCCTTA
TGAACTATGGGCTGGGCATCTCTGGTGCCTTGACTCCACCTAGGACTGAGGCCACAGCTG
CCTTCCTAGAGTCCATTGCAGGCCAGCCTAGTGGTGTGTCGGAGTTGTTAGGTGCTGCCG
GGTTGGTAACGACTCTGTACAACAGAATGAAACACTGCCCAGTCCTGCGCCATCCTCACA
GTCGTGGCCGTGTTTGACCCCATTGTTGCAGCCACTGTCAGGCCATCTCCTCTCCGGTCT
TCCTCTTTGCTGACCCGCTACTCCACCAAGCACGGGGAGTTCCTCGACCCTTCCCCCCGC
CCTGTCTAGGCTACGTGCCTCCCTGGGCCTCCCAGGCTGGCTCCCTGCCCAGTTTCCCTG
TCTTGAATGTTCTGCTCACATGTACTTCTTGTGTTTAGATCTACAAGGTTGGCCAGGGCT
ACCTTATCAAGGATGGCAAACTGATCAAAAACAATGCCTCCACCGATTATGATTTGTCTG
ACAAGAGCATCAATCCTCTGGTGAGCAATGAGCTGTCTCTGCCAAGTCTCTGATGTATGC
GGCCTGCCCTGTGGGGCCTCGCTGAGTGGCCTGTGGGGTGGGGAGCCAGGTGCTTCGGGG
GCCTGTGATTCGTGGGGGCTGTTTGCAGAGGCACTAGCCGATCCAGCCAAGGCGCCTGCT
GTGTACTCCTGTGTGGCACACCTTAACTTGCCTGTGGGTTATTGGTCTTACCTGTCTCTG
GTCCCCACGTTTGAGACCTTTGTTGACCCACTGGCTTTTTCTCACAGGGTGGCTTTGTCC
ACTATGGTGAAGTGACTAACGACTTTGTCATGCTGAAAGGCTGTGTGGTGGGAACCAAGA
AGCGAGTGCTTACTCTCCGCAAGGTGAGGCTGGTCCCTCCTGGCTGCGTGGGTAGGGTGC
TGTGACTGGGACCCTTCAGCAAGGGGCTGACTCCCGTGCAGAGAGGTTAAACAGACTGAG
AACGTGGGCCCCAGACACACAGGCCTTCTTTGGGAGTCTTGTTGCAGGGGAGTTGGAAGG
AAGGAGGGGAGGGTATTGCCACTGCGTTGAAGTCCCGGGAGGAGAAAATTCCCAGTCTGG
CCCGGTGGGGCTGTTTGCCTCTGTTCACATGCATCCTTGTTGCCTGGTGGCAGAGAGTGT
TTCTTGGCATGTGGGAGCTGGGTACCTTCTGGCCTCCGATCAGGAGGTGCCTGGGAGAAG
AGTGGGGAGGAGCCTTTACTCCAGATGGGGTGGTCTTGTTCCCTGACTCAGCAGACCCAG
TGGATCTTAATGTCTCCAGAGGTGGTGGGTGGGTCGTGACTTAATGTGACACTGAGAAAG
GCCTGGCTCTTTATAAGTGCCTCTTGTCCCACAGTCCTGATGCTGGTACAGACCAAACGC
CGGGCCCTGGAGAAGATTGACCTCAAGTTCATCGACACCACCTCCAAGTTTGGATCCATG
GCCGCTTCCAGACTATGGAGGAGAAGAAGGCGTTCATGGTGAGCTGATGTAGCCTGCTTT
GGGCCCCCATCAGTCTTTGGGGGAGCTGGGCAGACTGAAGCAGCTGGGCTGGCTCTGCGG
GTCTTGGGAAGCATCAGGCAGCATTGTGTCTGGAGATTGACCTAGAGTATTGGCCTCCTG
GCAGTTCGAATCTCAGTCACTCCTTGGAAACCGAATGGCGCAGTTCTACTCTGTCCTATA
GGGTCTCTGTGAGTCGGAATCGACTCGATGGCACACAAGAGGGTCGGGAAAGGAGCCCTG
GTGGTGCAGTGGTTAAGCACATGGCTGCTAATTGAAAGGCCAGGTGTTCAAATCTATCAG
CTGCTTCTACAAGAGAAAGATGACAGTCTGCTACCGGAAAGAGCACAGCCTGAGAAAACT
GTGCAGTAGTTCTCTCTGTCCTAAAGAGTTTCTGAGTTGGAAGTTGACTCCATCACAGTG
GGTTTTAGGGCCAGAGTGTTTGTCACTGGCCACGTTCCTCCACCTCTAATCCTAACCCCT
CTGCACCTCTCTCCACAGAGACCACTTAAGAAAGACAGAATTGCCAAGGAAGAAGGAGCT
TGATGTCAGGAATAGATGGTGCAGCTGGTGGGGTCTCAATAAAAGTTATTTTCCAGTGAC
ACCTGTGTCTTAACCTTTTGTCCAGGGAAGCTGAGAAGGCAGAGACAGTATAGGGGTGCT
TCCCTCAGCTACACCTGGACTGGATGGGGTGGGGGGATGTGAGCCTTGCCAAACCGTGGT
CTGCCCCTGCCTCGGGCAGCGGGTTGGTTGTTTGCACAGGGTGCTGTGGAGATGGAGAGG
AGGTGATGGCATGAGCACAGCAGGGCAGGCCTGCTGTGGGTTCCCTTAATCCAGGCAGGG
GCGGCTTCCAGTTAAGGCTTGTTAGGTCCTTTTGAATCAACACCCGTGGAAGCAGCAGTC
GAGATGAAGCATTGTTTTGGGCCAATCTGCAGAAGACATTAAAGTGTTCAAAAGCAAAAA
TGTCACTTCAAACCATGGGATTTTCAATTGCCTCTTGAGTGGGAAAGCTGGACAATGAAT
AAAGAACACTGGATTGATGCCTTTGGGTTACGGTGTTGGCGAAGAGTACTGAATATGCTG
TGGTATCACGGAAGAGGGAACAAATCTGTCTTGAAAGTACAGTCAGAATACATTTGGACT
CAAACTTTGGGCATCTTATCAGAAGGGACCAGTCCCTGGTAGGGGGGTCAGTGAGAGAGG
AAGGCTCTGAACGATGTGTTGACACAGTGACTGCAATGGTGGGCTCAAACAGCAATCACG
GGGAGGATGGCCCAGGGCTGGCAGTATTGTGCTGTATGCGGGGTTGCTGTGGGTTGGCAC
CCTAGCAGGTTCTGTAACCTGGCAGTGGATATCGGACCCGGAGGGCAGGTGGTGGGAGGG
GGTATGGCACAGGAGGGTGTGGTGGCTTCAAGCTTAAGTGCTGCCTGTTCTGGGTCCTGC
AGAGTCCTGCACAGCACCTGGAGCAAATAGGAAAACATTCTGGAGTGTTTACATTGAAAA
GGGCTCAGCTTCGTAGTATAGATGAGAATGCACACAGAGGAGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1857..2049, 3244..3412, 4197..4332, 5534..5720, 6301..6461, 7165..7266, 7534..7629, 8121..8124, 8127..8199, 8202..8244, 8765..8809
1001..1003, 1857..2049, 3244..3412, 4197..4332, 5534..5720, 6301..6461, 7165..7266, 7534..7629, 8121..8124, 8127..8199, 8202..8244, 8765..8806
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved