Loxodonta_africana Locus FLT1
snOPY snoRNA Orthological Gene Database
Loxodonta_africana FLT1
Loxodonta_africana
FLT1
GeneScaffold_7350
SNORA32
181198..181314
189558
CCATGAAATGTGCTTGTCAGATGCCCCATTAAGAGCGAAAGAGTTCCCTTTTCACTGTG
CCATCATAGAGGGAATGCGTAGATGATGTAAGACAAACCAAATGCCTTCGAAAACGGATT
TTGATTGAGCATGTGGTAATTCTATAATTAGCTTTCCAGATGAGGAAACTAGTTCCGTAA
GGGGAATGAATCACCCAACATATCAGGGCTCAGTTAATGGTTGAGCTGGGTCTAGAACCC
AGGAAAATGTCTGTACTTTTTTAATTCATAAAAAAAGATCAGACAGGGCTGTATAACCAG
ATAACCTACACTGGTAGAAATAGTTCAGAAATGTATTTTGGATGAAGCTAACGTTTAATC
CTGAGAGTTTTTATGGTGCAATGGTTAAGTGCTCAGCTGCTAACTGAAAGGTTGGCAGTT
CGAACCCACCCAGCAGCTCTTTGGGAGAAAGACCTAGCAATCTGCTCCCTTAAAAATTAC
AACCTAGGAAACCCTATGGGGCAGCTCTGCTCTGTCACATGGGGTTGTTATGAGTCAAAA
TGGTCTTGACGGTACCCAACAACAGCAATGTTTAATCCTGAGTGTTTTTAATAGGTTATT
TCATAGTCTTAGTATGTTTGCAGTTCATATTCACCAGGCGCTCCTTGGAAACGCTACGGC
GCGGTTTTTTTCTGTCCTGTAGGGTCACTATGAGTCAAAATCGACTCAACGGCAACAGGT
TTGGTTTTTTGGTTTTATGAATCTATTAACATTCTAGGTGAATAGGTTTTTGGATATTAT
TTTGGTCACTTAGTGCAAAGGGCTATATAAATATTTGTGAGTAAGGCTTGAGGTAGAAAA
ACTCATGAAGTAAGCGAAATTGTGTGAGATGTGTCTTTTTGCATATCTGAGTAAATAACA
GATGAAAATACACCTTTATGGAAAGATATAACTTAAAAAAAAAAAAAAAAGCTGAGAAGG
CAATTTTCAAACAAGCTATTTTTAAAATTTGTTTTCCAGGATCTAGTTCAGGTTTAAAAT
TAAAAGGTCCTGAACTGAATCTCAAAGGCACCCAGCACGTCATGCAGGCGGGCCAGACGC
TGTTTCTCAAGTGCAGGTGAGTGACTGTTGGTTTGGGAACAATTCCGTTGCCTTTTCCAA
GGTGAAGTAATTCCCTGGCAGAGTAGGAAGGTCGCCTCACAGAGGCACTGGTGACTTCCG
CGGTCTGCTGTGATCTGAAAAACGCAAACCACGTGTATCCAGCTTCACAATGAGGGTGGT
CTGCCGAGGCGGGAGAATGCGTTCCCTCAGGGGGACTTGGAGGAAAGGGTCCCCCAAACT
TTTCTGCATACTTATTCTGAGTGTAGCTTAGAAGCTTTTCTAGATGTGCTGCTTTTCTGT
GAAGAGGAAGATGACCACCCTTAGGGAAGGACCTCGGAATCGCACTTGCTCATGAAGTGA
ATGGAGGGCAGCGGTGGTTGAGTGGTAGAATTCTCACCTTCCATGAGGCAGACCCTGGTT
CGATTCCCAGCCACTGCACCTCACGCACAGCTACTGTCCCTCGTCAGTGGAGGCTTGCAT
GTTGCTGTGATGTGAACAGGTTTCAGTGGAGCTTCCAGACAAAGACAGACTAGGAAGGAA
GGCCCAATGATCAGTTCTGAAAATCAGCCAGTGGACGCCCTATTGACCGCAGTGGTCTGA
CCTGTAACCCATCATGGTCTTGTCGCTGGACCAGTTGTGCATGGGGTCACCATGAGTTGG
GGGCTGACTGGTGCTGAGCCCTGGTCCTCAGGCATAATTGCGTTTTGTTTCCTTCTCTGT
GATCGCAGGGGGAATGCAGCCCTTTCGTGGTCTGTGCCAGACCTGGTGAGTACGGAAAGC
AAAAAGCTGAGCATCGCCGAGTCAGCCTGTGGGAAGAATGGCCAACAGTTCTGCAGCACT
TTGACCTTGAACGCAGCTCAGGCAAACCACACTGGGTTCTATAGCTGCAAATACTTATCA
AAACTTGCTTCAAAGAAGACGGGAACAGAGTCCAAGATCTATATATTTATTAGTGGTAAG
ACTTCCATTTTTCTAAGTTTTGTTTGCCGCCGCACCCTGAGTCTTTTGAAAGGTGCCTTT
CCTAGCGAGTGTGAAAGAAATGCACCAGTAAAGAGATTTCACCCTAGGTGTAGAAACTTG
AAGGAGCCCTGGTGGCGCAGTGGTTAAGTGCTCAGCTGCTGATAGGTTGGTGGTTCGAAC
TCCCAGCCACTCCATGGGAGAAAGTCTGCTTCCATGACATTACAGCCTTGAAACCCCTCT
GGGGAAGTTCTGCTCTGTCCTATAGGGCTGCTAAGAGTCGGAATCGACTCAACAGCAGTG
GTTTGGGTTTTGGTAGAAACTTGTGGAAAGCATTTTTAATGTGTTTCTTTGGTGTCAACC
TGAGGGTCGGTTTTGTTCCTGCTGTGTCTGCAGCAGTGAGAATCGTGCCAGACACGTAGC
TAGATGAATATAATGAGTGACAAAATTTTAGTTCTGTTTCTTAATTACCGAGAACCCCAA
AAGAGAATACAAGGTTTTTTTGTCTTTTTGGTCTTTTTACACACCTGCATTCTCTTATAT
GCTGGGTGGTAAAATACTGAGTTTTTTCCTACTAAATTAATAAATGTAATGATGTTAATG
GTTCTTCGTTATTACAAAATTGGTTCCAATTGACGAAGTTGTATTAGTTCATGTTCATTA
GTCAAATATTATCATTACGTAAGAGCTGGCACGTACCGTTGTTGTAGCGAAAAGGACAAA
AGATAAAAAATAAATCATTTTGCAGTAATAATTTTCATGGTACTATTTCCCTCTCCCCCG
CTTGGAGAATGAACAAATGAAGTGATATTCGGAAGAAAGAGGCACAAAATCCTTAAAACT
GTATACTTTGAAAAACAGGAGGAGATCCCTGAGAACGAATGAGAGAACACTGGCCTATCA
TCTTGTTCTCTGTTGTGTAGTTCCAGCCAATTTTCACAACGTATGGAGGGGAAAACCAGA
AACCAAAAAAGCACAGCCAATGAGGCTTTAAGGAACATAAGCTGAAGTTAGTAGGCACCT
CAGACACGAAATCAAGCTAAAAAGAAAACAAAACAGCCCACAGTCAGCATCAAGAGCCGA
GATACACACTGTGGGCCTACCCCCTGGTGGCTTTAAAGAAGGGGTCTTTACATTGGAGGC
AGCCAAACAGAATTTTTAAGGGGGATTCTTTTTTGATTTTTAAAATAAGGCAACTAGATA
GTGCTTTACCCGAGCAGAAATGTGGTTACTCAGTTGAGGATTAATCTTAGGAGACACTTA
TTTGCTATCGACGGTAACATCTTTTTAACTCTTATCCTAATTTATGGAGCCCTCATTGTG
TAGTGGATAAGAGGTCACCTGCTAACCAAAAGGTTAGCAGTTCAAATCCTAGGAAACCCT
ATGGGGCATTTCTACTCTGTCCTGTAGGGCTGCTTTGAGTCAGAACTGATTCAACGGCAC
CTAACAACAACATCCTAATTTATTAAAAAAATTTTTTTTAATTGTATTGTGGTGGAATAT
ATGTGACAAAACATTTTGGCCATTTTTAAATGTACAATTCTGTGGCGCTAATTGCAGTCA
CCCTGTCGTCACCATTGTCAGTATCTTTTTCCAGATGTTTCCATCACCCTTATTAGAAGC
TCAGCGCCCCTTAAGCAATACCCCCTTTTCCCACTCTATCACCTGCCCAAAGTAACCCCT
AATGAACTTCAGTCTCTCTGCATTTGCCAGTTCTTATCCTAATTTTTAGTGAAACACTTT
TATTTCCCTGCTCTTCCAAATTCTTGCTCTTACACTTTGCACTTTTCCAACGGGGTAGAT
AACTGTCGAATGGAGCCCTGGTGGCACAGTGGTTAAGCACTCAGCTGCTAACTGAAAGGT
TGGCAGTTTGAACCCATCAGCTCTCCGAGGGAGAAAGATGTGGCAGTCTGCTTCCATAAG
GATTACAGCCCTGGAAACCCTACGGGGCAGTTCTACTCTGTCCTGTAGGATCCCTGTGAG
CCGGAATTGACTCGAAAGCAACACGTTTGGTTTTTTGGTTAGATAACTGTCAGTGACAAG
TTCCAAGCAGTTACCGTCACAAGAATGCCGTCAGCCCTGTCAGAAGTAACAGCAGGTGGT
AGACCAGGGAACTTTGCTTGCTCAGGTCTGTGTTGTTATCGCTAGTTGTCGTCGAGTTGA
TTCCGGCTCATGGCAACCCCATGTGCATCAGAGTAGAACTGTGCTCCACAGGGTTTTCCA
AGGCTGATTTTTTTGAAGCAAATTGCCAGGCCTGTCTTCCGAGGTGCCTCTGTGTGGGTT
CAAATGGCCAACCTTTCGGCTGGTAATTGAGTGCGTAACTGTTTGTACCACCCTGGGGCT
CCTTGCCCACATCTACAGGAAGGAAGAATGCGTGTGGGCAGGAAATGAGGCGGAGTGGTT
AAGGGGCAGAATTAGAAGAGAGATTTCACAGAGGTAGTTTTGCAAATCAGAGAGAAAGAA
GACAGAAGCTTGGTAGTGGTAGAAAAAGTCACATACTCAGCGGTCCGCCCTTTGTTTCTA
GTTCCACCTCATAGATTATGTACTCCCCAGCACTTGAAGAGGAAAGAAAGCACTTGTATT
CTTGCCTCTCTAGGAGAGTGGAAGAAAAATTCATTCATATTAAAATTCCCATAAAACTTC
CTCTCCTGCGCTTATTAAAGCCTGGCTTGTGAATCAAAGGCTTAAGTGTGTAAGTACTGC
TGCTAAGGAGCCTTGGTGGCACAGTGGTTAAGAGCTCAACTGCTAATAAAAGGGTTGGCA
ATTCGAGCCCACCAACCACTCCTTCGAGACCCTATGGGGCAGTTCTACTCTGTCCTGTAG
GATCACTGTGAGTCAGAATCACCTGGACGACAATGGGTTTGGTTTTGGTTTACCTGCAGT
ATAGGGTCACTATGAGTCAGAATCAATTCGACGGCAATGGGGTAATGTTCAGCTAAGGGA
GCCCTGGTGGCGCAGTGGTTAAGTGCTCAGTCAGCAGTTGAAANNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGGGAAAAATTGCTTGGGAGATATAGAGACTGATTATTTTTAATAGTACTAATACTAA
AAGATGTTTGAATCAATTATAATAGTCATAGATGAGCTCTGAATCTTACTTGTGTAAAAA
TTTAACCATCAAATATTAGGGAACAAATGTGTGCTATATGCCTGTAACTGTATTTATTCT
GAATAGTAACCCTGATTTTGTTGTCTATTTCCTGGAAAAATGATATTGGCTTCATAATCA
CAACTTACTATAATAAGTCCCAAGGTAGCTGTGATTAATGCATTAAGCAACTATAACCTT
TCCAAAGATCCCAACATTTTGTGCAATTCCTGCTTTCATTATTTTATTAATTGTCTCGCT
GAAAAAATCTGGTCTCACGTGTTCATCTTCACTGAACACTTAGCCACATGACAGACTGAA
GTTTAGGGGCACAAAACTTGCCTCTGATGACTTGGAGGATTGTCTGTGGAATTACTAAAC
TTCTGACCATTTCCTAATACACGGCTTTGATTACTCACTGGGTAGTAACTGGTCATCATT
TATTTTTTGTTGTTGAATGTTTTCTTTAGAAGGTGTTACTCTGTTTGGAGAATTCCTGCC
CATGATGAAGCATCTGCAGAAGTATTGGCATTTCATCTTGGTTTTCTATGTATTAGACAC
ATCTTTGGAAACGGCAGATTTGTAGTCTGATAGGCTTCTGAGCAGGAGAATCAAGGCTGT
AAAGCTTTGTCAGAAGGAGCCCTGATGGCGAAGTGGTTAAAATGCTTGGCTGCTCATCGA
GAGGTGGACGGCTTGAACCCACCAACTGCGCTGAGGGGGAAGAATGTGGTAGTCTGCCTC
CGTAAAGATTACAGCCTTGGAAACCCTATGGGGCAGTCCCACTCTGTCCTATAGGGTCAC
TATGAGTTAGAATTGACTCAGTGGCAATGGGCAATGTCTACAGAATGCCAGATCCAGCAT
ATGTGAACTGTGGGCAGACGGGTACTTGGATATTACTGAGCGCCTGCTGTGTACAGGCAC
AGTCGCCGCCGGAGCGCTGCCGTGGACGTGACTGCTGATACGTAGTGTGCAAAGCATCAG
TTACAGCTTGTGTAAATCCACCTGGCTGCTGACAGAAGGCATTGAATCAAATTAATTATT
CAAGTAATTGTATTCAATGGCTTCATTTAATTATTTAATTGTTGGGTGAACTAGTCATTG
CTGTGGGGTCAATTCCCACTCAGAGTAGAACTGCCCCATAGGGTTTCCAAGGCTGAAATC
TTTATGGGAGCAGATCACCAGGTTCCCCCACTCTGCCCCCCGCCCCCCGGCCCAGGAGAG
GCTGGTGGGTTTGAACAGCTGACCTTTCAGTTAGCAGCCCAGCACTTAGCTGTTACACCA
ACAGGGCTTCCTTTTGGTAAACTACAATTACCATTAATAAAACAACTTCTTACATTCCTC
TATTTCTTTTTTTATTTAAACAAATAATTTTGTTAATATCTTACGCTGTTTAGTTCTAAC
AACAATCCAGTGAACCATTATTCGGTCCGTTTTACACGTGAAGGAACTGATGCAGTTCAC
AGCGAGGTCAGTGGGGAGCTGTGGAGAAGTTGTAGCAACAGAGTCAGGTGGTCAGGTTTT
CCCTTCAGATTCTCAGTGGCTGCAGTGGGGAAAGGAGTCAGAGGTCGGTAGTACAAGTCC
ACCCACAGGCACCGTGGAAGGAAGGCCTGGCAGTCTACTTCCGAAAGATCAGACACTGAA
AACCCTATGGAGCACAGTTCTGCTATGACACACATGGGGTCTCCAGGAGTCAGAGTCAAC
TCGGCAGCAGCTGGCTTGGGCTGGACTTGGCAGTGGGGAAAAGAGATCAAGGTGGGAGAC
TGAGGCAGGGAGACTGAGGCAGGGAGGCCCAGATAAGGGGCTGCTGTGGTGTGCGGGCAG
GAGAGATGGTGGCCAAAGTTAATTGTAGTTCCTGCACAAGTTGGTTGGACGTTAGAAAAT
TGTCTATTTCAAAGACTGTGTTCTTGGAGAGGAAACCCTCGTGGTGTAGTGGTTTAGTGC
TACGGCTGCTAACCAAGAGGTCGGCAGTTCAAATCCTCCAGGCACTCCTTGGAAACTCTA
TGGAGCAGTTCTACTCTGTCCTATAGGGTCGCTATGAGTCGGAATCAACTTGACGGCAGT
GGGTTTTTTGGGTTCTTGGAGAAACTGATGGAGTTGAGGGATTCAGTCCTTGGTGACTAG
ATGTCGGGGTGGGCCTAGGCAGGGGGAGGAGTCAAAGCGATGGCCTTGAATTCTGGTGGG
GGCAACTGGGCAACTTGTTCCTGGTCCCATAGCCTGGTGGAGCTTTGTCCCACCAAACTA
TATTTATGCAAACACGTAATCGTCATCCTCTCCTGATGGACCCTTGGCTTGGTCTCAACA
AATAGTTGTGAATGAGTATTGTGAAAATGAATCAACTCCGCTAGTAGAGTTACAGTATTC
TGGGTCAGAAAAAAACAAACAAAACTGTAAAGCGCTTTCTAATTTTGTGCTAGTTTTAAA
ACAAAACGAAAGTTGTAGACACATGGTCACGTCAGGTGGTGTGCATCCCCTTTAGAGAGA
GAAAAAGGACTTCACAATTTTTCTTTGTTCCTCTGGGGTAAACAAGAAATCGACCTTAGC
TAAGACCTAAGGAGCCCTGGTGGCGCAATGGTTCGAACCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGCATGCATAACATTATTATAACGTTGGAAGTATAATTTGTTTACTGGACATTTTG
GTGCTCCATTTTATATATATTCTTTTGATCTCCAATTTCTTCACCTCGGGGATAAAAGCC
GAGTTGGTGTTATTTCTTCAGCTTTGTATATGCGAATACAGCCTCTGTGACTTGCATACA
ATTCCCAGAGTTAATACAGTGACAAACCAGATTGGGGATGGGGCCAGACCCCTGAAACTC
GTTGCTGTCGAGTCAACTCCAACTCTTGGTGACCCTATAGGACAGAAAGCACTGCCTCCT
AGGGTTTCCAAGGTATGGTGTACATATCACGTGTCTGTTCAGTGGCTCTGATGTAGAGTG
TATTTCTTACTGTAGAACTCTGCATAAACAGCTTCAATGTTACCAGGGTAGGCGGTATCC
GTACTTTTTATTTAGCAAAACAGTGCCAATTGTAAACACTATGGCGTTTTTGTGCACCAC
TACTGAAACAGAAAGGAGCCCTGGTGGTGCAATGGTTAAGCACTCAGCTGCTAACCGAAA
GGCCAGCGGTTCGAACCCCCCCAGCTGCTCCATGGGAGAAAGACCTGGTGATCTGCCCCT
GTGAAGACTGCAGCCTAGAAAACCCTGTGTGGCTGTTCTACTCTGTCACATGGTGTTGCT
ATGAGTGGGAATCTACCTGACGGCACATGACAACTGAGGCTTGGAGGGAACTGGGCTGTG
AAAGGACCCCTCTCCTCTCGTGGATGTGGGGGCGCTGCTGTGAACTCCATTCACCTCCTT
CCCGAAGTGGGTTTCCCACAAGTAAGGCTGACCCAGGAGGTTCCGTCAGCAGATGGTCTG
TGTGCAGGTGTTTATCACACACGTGCTAGATGCATGGCCCTGCCGTTTGTTCTGGGGCAG
GCATGAAGAGCAAAGTCATGGAGTCCTGTAATTTTGAATTCCTGTAGTCACTTTCTGCAG
CCCATGGTTGGTGCAGATGGTTAGTGCACTCAGATGCTGACCGAAAACTTGGCAGCCCGA
GTCCGTCCAGTGGCACCTTGGAAGAAAGGCCTACTGATCTACTTCTCAAAAACCAGCCAT
TGAAAACCCTATAGAGTGCAATTCTACCGAAACACACATGGGGTTGCCATGAGTCAGAAC
TGACTCAGTAGCAGCTGGTGGTGGTTGTTTAAGTTATCTTCTAGGACTGTGATTCACAAT
ACATTTGTGAATATTTAAAAATGCACAGGCTTCCTTTTTTTCATTTTTTAAAGAATAAAG
AATTATTTTTTAAAGAATGAATGTGTTATTGTTCGAAAGCAAGCCCTGCAAAAGTTAGCA
CCAAGGAGTGTAGCACAGTTTAGCTCTCCTTTAGTAGTCTTCAATGAGAACCTCCCTCCA
CTCATGTCCTGTGGAGCACAGGTGCTCTGTTCCCACACTGCTGTCCGTCATACCTGCCCA
GGTGGTGCTCACAGAAGGTGCTCAGTCAGCAGTGCTTGGTTGGGTGGTGGTGGAGCAGTT
GGTGGCTTATTGCCCAATCTGCCATACTAGTATGGCAAGTGCAAGAGACACAACCATTCA
AACAAGTAGGGCCGGCAGTGAAGACAGTAGCCTCCAGCAGACTGACTCCCAGAAGCCTTG
TTGCCTCCATTTTCCCCACTGTGGTGATGGGATGACTCTTGTGAGGTGGGAGTGTACCCA
GGTTGCTAGCCCTTTCTCTTAACCTGAAAAGGAGGAGTTACTGCTGTGGATGGCCTGGTA
GCCTCCTCAGACCACATCTTGCAGCGCCAGAACTGTGGTGGCAGAGAGCGCATCTTATGC
CCAAACAGATTTCCAGAGTCTCTAGAACATGTCGACGGAATCAGTGTCATAATTTTGTGA
GAAAAGCATTTAAGAGAAAATACCCTTTGCATTCATCGAAGTTCTCCTATGAAGGAAAAC
TGGCTAAAACAGTTGATATTTTCTAAGCAGAAAAAAATCTATTGAAAAAGAAAGAAATAA
AACTCTTAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAT
CCCTGAAGAAAATGAGCAAGGGCCTTTTCCAGAGAAATTCCCTTAAGTTGAAAAGGCTTT
AAGCTTCTGACATTCTATAACTTCCTTTAAAAACAATAATGAAATACCTACCCTGTCTGG
AAATGAAGAGCTAGCTGATTTGTTTTGATCTTTAAGGTTCTTGCAGCTATGATGTCCTAC
CGTTTAACTTTACTGTCTAAAATTTGTCATTTGATCCATTTTTGCTGGGTTTTGTTGGCA
GTTACCTTGGTTAAATGTGTTATTCAAAATCAGCGACTTGCTAAAGCAATCAACACCTCA
CCCTTCCTTCCTTCCTTATCAAATACTAATTAATAAACTATAGTTAAAACAACATGATCT
GGGCATCAGATTGGGCTCAAATATCAGTTCTGACACTAGCTAGGTCTTTGACTGGACAAA
TTGGTTGTTAAGGGTAATGGTTAACATTTCAATAGGTCTTCCTCTGTGCTGGGCACTGTT
CTAAGCATTTTACGTATGTTAATGATTTCGTCCTCATAACAACCTTACAAAGTAGTGCTA
TCATGTTCATCTCCATTTTACAAAGAGGTTAAGAAGCTTGCCGTTGGTCTTGTAACTAGT
GCACTGCAGAGAAGGTAACAAAGTTCTTGCCCTTAACCATGTCTCATAGTCCGGAGTCCA
TGTATATAAAGCCTTTAGAACAGTGTCTGGCATGCAGTAAACGCCATGGGAGTGTTCACC
GTTACTGCTACTACTATTGTTGCCATCGTTATCATCTTCCGAGCCTTGGTTTCTTTATCT
GGAAAATGAAAAGAGTAAAACTTCCTGGGGTTGTTAGAAGATTAAATGAGATGTTATATG
TAGATAATATAAGGAGCCCTGGTGGTGCAGCGGTTAAGCACTTGGCCGCTAACAGAAAGG
TTGGCAGCTAGAACCTATCAACCTCTCTGTGGGAGAAAGATGTGGCAGTCAGCTCCTGTA
AAGATTACGGCCACATCTTACTCCTGAGGAGCGGCTGATGGGTTCGAACGGCAGACCTTT
CAATTAGCAGCTGAGCACTTGACTTAAGGAGACACTTTCTACCAACTGGTGCTATCCAAA
AGTGGAGTGATCTGTCTTGGGAGGTGGTGAGTTTCCCATGCATCTAGGTATTCAGGTATA
GGACAGTTGCTTACTTGTTGAGATTGGACTAGATGGTACTGCGGTGCCTTTCCACTGCTG
AGATTCGATGAGTGCCTGGAAGATATCACTACCGTTTATTGAAATCTATCTCAGGCTATC
TCAGACTGTCAGGTCACTATGAGTCAGAAATCAACTTGCTAGCACTGGGTTTGGTTTGGT
TTTTTGGCTCTCAGGCTTACATATATCATATATCATCTCATTTAATCTTCAGAACAACCC
AATGAGATAAGTTGCTTTATTAGTCTCCTTTTACAGAAAAGTTGGAGGAATTCAATAACT
TGCTCAAGGTCACATACTTTGTAAGTGACCAAGTCAACCTTTGTGCCCAGGTCTGATTGA
TTCCAAAACCCCTGCTTTCTCCAGCACGTCCTTGCCCGGGTTTCTACCCCAGAGCTTTGT
GTGCAGTGCATAATCGGGGAGGGACAGAGTTGCAAACTGTAGTCCAAACTCGTTGCTGTC
AAGTCAATTCCGACTCATAGTCACCCCTATAGGACAGAGAGTAGAACTGCCCCATAGGGT
TTCCAAAAGCAGACTGCCACATCTTTCTCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGTACAACAGAAACGAAACACTGCCCAGTCCTGTGCCAT
CCTCACAACTGTTGTTATGCATAAGCCCCATTCTTGTAGCTACTGTGTCAGTCTGTCCTT
ATGGAGGAGTCTTCCTCTTTTTCACTGACCCTGTATCTTACCAAGCATGATGTCCCTTCT
CCAGGGAACTGATCCCTCCCTGATATACCTGTCCAAAGTATGTGAGACACAGTCTCGCCA
TCCTTGCTTATAAGAGATTATTCTGGTTGTACTTCTTCCAAGACAGATTTGTCCGTTCTT
TTGGCAGTCCGTGGATATATTCAATATTCTTCTGCAACACCACAATTCAGAGGCATCAAT
TCTTCTTCAGTCTTCTTTATTTATCATCCAGCTTTCACATCCATTAAGAGGCAATTGAAA
CCACCATGGCTGGGTCAAGCACACCTTAGTTTTCAAGGTGACATCTTTGCTTTTCAACAC
TTTAAAGAGGTCTTTTGCAGCAGATTTGCCCAATGCAATGCGTCTTTTGATTTCTTGACT
GGTGCCTTATCTGTGAGTTTTTTACAGAGGTCTGCACTTAATTTTCCTCTAATCGACGTG
AGTGGTTCTGTGTGTGTGAGGTGTGCGTTGTCCGGGCAGCAAGACTGTAAGAACCTCTAA
TGCATGAACCACACCTTGTGCTTCTTTTCATCCTCCATAGTGCCTCATTCGTAGTAGGTC
CTTTTCCATGGTTTTCATTGCTTCAGCTGATCCCTTCATAGACTTCTGTTTGCCTGTGTG
CCATGTGGCAGCCAATGGTAGACAGTAGTTGAGATGGGTGATTTTCTTGAGCCTCTGCTG
CTAGGCACCCAAATTTCAAGAGCTTATTCATAGTGCAAGTGGAAGAGAGACTGAACGATT
GTCCTTGTTTTCTTCTCTCTTCCCAACACAATTTCTTTTCTCTTCTCTTGCTATTTAATC
TGTTCTTACAAGTGAGGCAACGGGGCTCCAAAAGACGAGGGGAAACTGCACCTGTGTCTT
CTGAGGAAAGGTAGGTGGCAGGGAAAGCCTTTTTTAGAAAGAGCTCTGAAGATTACAATC
CTCCAACTTTCTTCTTTTTCAAGATTGTTTTGGCTCCTCTGCGTCCCTTGCAATTCCATA
TGAATTTTAGAATCAGCTTGCCCATTTCTGCAAATGATCTAACTAGGATTCTGATAGGAA
TTGCATTGAATCTCTAGATCACCCAGGGAAGTCTTGCCTTCTTAATTAAATCTTCTGATT
CGTGAACATGGGATGTTTTTCTGTTTATTTAGATTTTCTTTTTTTATTTTGTACCACACA
GACAATAATTTTTTAGGAAAGTATCTGTGGGATTTGAAACACGATGACTTTGTTTACCTT
GCTCGAAGAAAAACATATGTGGAAGTTATAGGTTTCCATCTGGGTGGCAAAAACTGGCAA
GTGAGCCTCTCTAGGTCAGCTTCCGTGAGATTTGTCATCGTTTGAGTCTGGTTAACTGTC
AGCCATAGTAGCGAAAGTTGCCATATTTTTAGGCTTGGTGGTAAATTTCAGTTGAGGGTT
TTATGATATTCTCTTAGATAACCAGGGTAACTCACTAGGAAGTGATAAATTGCACACTCT
GTAGGGACTGTGATCCACAGACACAGCAGTCAAGGAAGTTCCCCTCTAGATGGAGGCAGA
GATGTTTTACTTATGCTCCCCCGCTGACCTGGGGCTGCCCATGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTAGGGTTTCCAAAAGCAGACTGCCACATCTTTCTCCC
ACGGAGTGGCTGGTGGATTTGAACCACCCTTTGGGTGCTTTGATCAGGGCTCCTTACTCT
GTAGGCAGTTGGCACATACTTTGATTGGCAGGCACAGAGGTTTTGGTTGCCAATATTTAA
TCATTGGAAGAGTCCACATAAAAATCTGGTTTTCTACTTGCCTTTTCCGCATTGGCCTGT
ACTCGCACGTGACAACGTTGGCTGGAGCACACGGGGACTGCCCCTTCAAACGTGGCCACC
CATTCTCAATGGCCTCCACTCCTCCTGTTCCACATTTAGCCTCTCCACTCATTTGCCTCC
TCTGGATGTCAGTGGGAACGTGTGAAAAGAATGCATAACAAATCATGAGTTTGGGAATAA
GACAGTGCATGTTGTGTTTCATGGATGAGGTACTGAGACCCAGGGAGTTCCGTGGTTGCA
CGGGTCATCAGTTTCAGGGCCTCAAAAGAAACCCTGGCTCGAGATTCCCTACTACGTATG
ACTATGAAGGAAGCATTCTTCTTATGGAAAGTTTTGAAATTGCTGTCTAGGAGAAGCCAG
TGTCCCAGCTGGAGACGAGTGTGACCAAGCACCTTTGAACTTGAGCGTGGTTCACCCTTG
GAAGAAATCTCAATTCTGTTGTTGTTCAGTGCTGTTGAGTCACTTCCAGCTTATAGCAAC
CCTATATGACAGAGTAGAACTGCCCCATATGGTTTTCTTGGCTGTAATCTTTAAAGAAGC
ACATTGCCAGGTCTTTCTCCCACGGAGCCACTATGTAGGTTTGAACCATCAACCTTTCAG
TTAGCAGCCAAGCTCTTAACCATTGTGCCACCAGGGCTTCATGATACAGGACTTGCTCTG
CGTGACTGCTCTTGATTCTGAGGTGGCTATCACAGAGATTCCAAACAGTCCCCAGCACCT
TATAGCAGAGAGAGCTCAGCAGAGGAATCGACGACTCTAGCTTGATTTAAATAGTGAGCA
TTACTTCTCAGTCTGTTGTTTCACATTTCTAAGTTCTGTCAGAAGGCTTCACGGTACCCT
TGCCTATGTGTCATCATTTCCCCCACTGGGTGTTGTCATTGAAGGTATAATTGACTCCTG
AGTCGTTCACTGTGTCAGGGCCAGAGAAGGCACTGGACTAGCAGCCAGGAAACCTGAATC
CTGTTTGGGGTCAGCAGTATTTTTCCTGTGCTTGTGGAAAGGTCTCGCCTCTCTGGGCCT
CAGTTTCCTCAACAATACCATGAAGGGTAAAATTAGGGCATCTTAAAAATCCCTTAACAG
TTTTAAAACTTTGGGACTCACTGGCAACTGTGGAAATAATAATGTTTAGGACATGACCAG
GAATCTTGACAGTAGAAGAAAGAGCTATAGTGGTCCATTGGAAACTCTTGCTTATTTCTT
TCCTTTCTCCTTCATTTGTTTGTCTTCTCTTCCCTTCCTTTTCTTTCCTTTTGAGATGCC
TCAGCCTCTTTAAAGTGTTAAAAAGCAAAGATGTCACTTTGAGGACTAAGGTGCACCGAA
ACCAAGCCGTGGTATTTTCAATCACCTCATATGCATGTGAAAGCTTAACAATAACGAAGA
CTGAAGAGTTGATGCCTTTGAATTATGGTGTTGACAAAGAATGTTGAATATACCATGGAC
TTCCAGAAGAATGAACATATCTGTCTTGGAAAAATACAACCAGGATGCCCCGTAGAAGCA
AGGACAGCGAGACTTCGTGTTACGTACTTTGGGACATGTTATCAGGAGGGACCAGTCCCC
CAGAGACGACATTATGCTTGGTTAAAGCAGATGGTCATTGAAAAGAGAAGACCCTCAGTG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGGTCAGCTTCCGTGAGATTTGT
CATCGTTTGAGTCTGGTTAACTGTCAGCCATAGTAGCGAAAGTTGCCATATTTTTAGGCT
TGGTGGTAAATTTCAGTTGAGAGTTTTATGATATTCTCTTAGATAACCAGGGTAACTCAC
TAGGAAGTGATAAATTGCACACTCTGTAGGGACTGTGATCCACAGACACAGCAGTCAAGG
AAGTTCCCCTCTAGATGGAGGCAGAGATGTTTTACTTATGCTCCCCCGCTGACCTGGGGC
TGCCCATGGTGAACCGAAGCATGTCTTTACAATCCTGATGACTTGGTCACAGGTGAAAAT
TCCATGTGAGAGGCCTGCCTGGATATGGGGAGGTGGGGACGTGCGGGGGCTGCAAGGACC
CATAAGATGAGGAGCTTGTCCTGGATAGTCTCCAAGAACCATTCCAGCTTAGAAAACAGT
GGGTCAGCATTTCTAAGAAAGCCCAAAGCTCCGTGTTGTTTGCTTAAATAAAAGCTTTAT
GGATACATAATTCCCATACCATACTCTTCGCCCACTACAATGTACAATTCAGTGTTGCTG
TTTTAATATAATCACAAATACGTGCAACCATCACCACAATTTTAAAACTTTTTCATCACC
TGAGAAAGAAACCCCATACCCATTAGCTGTCGCCTCTTATCCCTCGGTCATAAGCAGGTA
CGAATCTACCTTCTGCCTCTACAGAGTTGCCTGTTCTGGGCATTTCATTTAAATGGAATC
ATATAAAATGTGGTCTTTGTGACTGGTTTCCTTCATTTAGCATGTTTTCAACATTGATCC
ACGTTGTAGCATGTATCAGTACTTCATTCATTTTTATGACTGAATAATATTCCATGGAAT
GGATGGATCACATTCTCTTTATCCTTTTATCAGTTCATGGACCTTTGGGTTCTTTCCGCC
TTTTGCCTATTACGAATATTGCCATAAACATTCATGCACAGGTGTTTGGACGGACATATG
TTTTCATTTTTCTTGAGTAGATGCCTGGGTCATATGGTAACTCTGTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGCGACAGCACCATATTATATTCCCACCAGCAGTG
TCTGACTCAAAATGACAAGCTGTGTATGAGAGTTCTAATTTATAACAGTCATCCTAGTGG
AAGTCGTATCTCATTGTGGTTTTGATTTGCTTTTCCCTGGTGACTAATGATGTTGAGCAT
CTTTTCATGTGCTTACTGACCGTTTGTATATCTTCTTTGGAGAAATGTCTATTCAACCCC
TTTGCCTATTTTTAAATTGGATTATTTGTTTTTTTTTATTGTTGTGCTGTAATGTTCTTT
TTATATTTTAGATACAAGTCCCTTATCCAGTATATAATTTGCAAATGTTTTCTCCCATTC
TGTGGGTTCTTTTGACTTTGTTGAGAGCGTACTTTGAATCACAAAAGTTTTTAATTGTAA
TGAAGTTCAGCTTATCTGTCCCCCACCATGGATCATGCTTATGTTGCCATATCTAAGAAT
CTACTGTCAAATATGAATTCATGAAGATTTATCCTTATAGTCTCTTCTAAGGGTTTTGTA
GTTTTAGCTCCTACATTTAGGTCTTAGATCTTTGAATTCATTTTTGTATATAATGTCAAG
TAAGGATCCAAATTCATGTGTGTTCCAGCACATTTGTTAAAAAGACTACTCTTTCCCCAT
TGAATGGTCTTGGTACTCTTGTGAAAAATCAGTTGACCATAGCCACATGGGTTTATTTCT
GGACTCTAGAGTCTATTTCATTGACCTGTATGTCTGTCCTTATGCCTGTTCCACACTGCT
GTGATTACTGTTGCTTTGTAGTTTTAGTAGTAAATTTTGAAATTGGGACGTGTAAGTCCT
CCAACTCTCTTCTTCTTCTCCAAGATAGTTTTAGCTATTCTGAGTCCTTTGCAACTCCAC
GTGAAGTTTAGAATCAATTCGTCCATATATGCAAAGGATCTAGCTGGGATTCTGATGCGG
ATCGAATTGAATCTCTAGATCAACTTGGGAAGTCTTGCCACCTTAACGAACCTTCTGCTT
CATAAACTTGGCTTTTTTTAAATTATTCTTTTAGATTTTCTATCATTTCTTTCAACAGCG
TTTTGTAGTTTTCAGAGCATAAGTTTTGCACTTTTTGGGATACGTTTATTCCTAAATATT
TTATTCCTTTTTTGCTATTGTAAAAAAAGATTTTTTTCTTAATTTCATTTTCAGATTGTC
CATTGCAAGGGTATAGAAATACAATTGACTTCTGCATATTTTGATCATATCTGCTGCAAT
CATGCTGAACTCATTTGTTAGTTCTAATAGCTTTTTAGTGGGTTTCCTAGGATTTTCTAT
GTATAAGATCATGTCATCTGTGAATAGAAATAGTTTTACTTCTTCCTTTCCAATCTCAAT
GTCTTTTATTTATTTTTCTTGCCTAATTGCCCTGGTTAGCACCGCTCTACAATGTTGAAC
AGAAGAAATGAGAGCAGATATCCTTGTCTTGTTCCCAATCTTAGGGAGAAAGTGTTCATT
CTTTGACCATGAAGTATTCTGTTAGCAGTGTAGATGCCTGTTATTAAGGTGAGGATGTCC
CCTTCTATTCCCAGTTCATTGTGTGTTTTTGTCATGGAAGGTATTGGCTTTGCCAAATAC
TTTGAGTTTATTGAGATGATCGTGTAGTTGTTTTGTTTTTGTTTTTGTATTTTTTCTAGT
GGTATTGCATATTATATCAAGTTATTTTCAAATGTTAAACCAACCTTGTATGCCTGAGAG
AAATACCACTTGATCATGGTATGTAATTCTTTTTATATGATGCAGGATTGAGTATGCTAG
TATTTTGTTAGGATTTTTGCATCCATTTTCATAAAAAGATACTGGTCTGTAGTCTTGTTT
TCTTGTAATGTCTTTCTTTGTCTGGTTTTAAATGAGTTTCTCTTTTTTTGAAGAGTTTGT
GAAGAATCCACATTAAACCCACTGCTGTCGAGCCATTCCGACTCATAGCGACCCTATAGG
ACAGAGTAGAACTGCCTGATAGACTTTCCAAGGAGCGCCTCATAGCGACCCTATAGGACA
GAGTAGAACTGCCCGATAGAGTTTCCAAGGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGCATAGAAA
GGTTTTATAGCATAGATAGGGAAAATATATACCATATACTAAGACAAACATCTGACTAAC
GGACGCTAAATAAGAACCGAATGCATCTGTTCTGACTTACCTACAGATTCCACTTCAAGA
CAGACTTGGGAACGGATCTTACTTGTAACCCAAGGGCTACGTATATAGTACTTATGGCTA
TAAATTTCCCTCTAGCTGGATCCCAAAAGTTTTGTTATGTCATGCTTTCATTCTCATTCA
TCTCAAAGTATTTTCTAGTTTCCCTTTTGATTTCTTTGACTCTTTGGTTATTTAGGAGTG
TGTTAATTTCCACATGTGTGAGTTTTCCAGATTTCTTTCTGTTACTGATTTCTCATTTCA
TTCTGTGGTGGCCAGAGAACATACTTTGTGTTACTTCTTGCCTTTTAATTTTATTGAGAC
GTGTTTTATGGCCTAGCATATCGTCTGTCCTTTAGAATATTCATTGCACTTGAGATGAAT
GTATATTTTGATATTATTGAATGAAATGTTCTATAGATGATAAATGTATTTTAGGTCTGG
TTAGTTTCTCACGTTCAAGTCATATATTTTCTTGTTGATTTTCTGCCCAGTTCTATTCAT
TATTGAAAGTGGGGTATTGAAGTCTCCAACTTATCGTTGAATTATCTATTTTTCTCTTCA
TTTTTGATAGTTTTTGCTTCACATATTTTAGTGCTCTGTTGTTAGGTGCAGATATGCTTA
TAATTGTATCTTCCTGGTGGATCGATCCTTTTATCACTATAAAATGCCTCCTTTTATCTC
TAGTAACATTTTTGTCTGTTTTGCCTGATATTAGTACAGTCGCTGCAGCTTTCTTGTGGT
TGCTTCAAAACTCTGTTTTGAATTCTCAAAGGCTTTTTTTAGTAGACAATATAAGTCAGT
GAAAAACGTGTCTCTTTTCCTTTTTCCATCCGTATTTCAAATGTGATGTTTCATCAGTCA
ACAAACTCTCCTTGAGCTATGTGCGTGGTCCATAACACACGTGGTATGAAAACTCAGTTC
TTCATGGGATTGGTTAATTCTTTTCTTATTGTTTTCCCTTTCATTCTCAAGAAATTAAAA
TCATACCCACCTTTAATGTAACTATTAGGTGTCCTCATGACCAGAACTTGGGGGTAAAGA
AAATAAATTCAAAGAGAAGGGAATTAAGGAAGAAGTTTATGAGAATCATAAGAGCATGCA
TATGCTAGGAAACAGGATGTTTATTCTTGAATCCCTCTTCAAGTCAGAATATCTCCCCGA
AGTCTTTGAGCCACTCGTTTGCCCTGAACCCAGTAGGGGAACTTCCAGTTGATGTCAGTG
GGAAATGGAGTGGAATGATTGTGACATGCCCGGGCCTCAATGTCTGTGCACCTTAATGTG
CCAACATGATTACAGATTTCAAAAGGAAAACACACATTTAAAAAATAGATGTAATTTCAT
TCTAAACAAGGGTCCCTGTTTGATCTTTCCCTGTGTTAGATCCTGCTTATTGTCCTGAAG
GGTAAGTGACAGCCCTGACACTCCCATTGGGTGAGAAAACCTCACAATCGGTGCCAGTTT
CCTGCCCCTGCTTTGAGTTCTAGGAGTTCAGAGAGGTGAGGGTGGTGTAACCTCTGCCTA
ACTGTGTGCTGGCATGGGCCCCTGGTGACAGTGTGTCTGAGCTGGCGGTACACCGGGAGG
TTTGGAGCAGCTCTTCCTTGCTCTTTCAACGACCAGCCAATTTGGTCTCAGGAAACCACT
CTGCAGTGCTGGCTGAGTTTGGAAGTCATTTTTAATTTCGTGACAAAGACAAATATGTCC
TACGGGAGTAGTAAGTGGTTTTACTGGTGATAATAATGGAACTGTGACCTCTTCTGTATC
TATGGTCCTTCAAAACAAAAAATGTTTGTATTATTATATGGCAGGCAAGTTCATTCTTAG
CTCTTCCTTGAATCAAATCACAGAGGAAGTGTACTATTAATAAGCCCAGAGAGTATTGTT
TGTGTGTGTGTGTCTACAATCATAAGCTCGTTTGCAACAGGGTGGATTTACAATGCCGCT
GTTAACCAGGACACAAGCGTTGTGTTTTGAATTGTGTTGGAATGGACATAAATCATTAAA
GTTCTGCCATCTTTGAATAGACTGCAGTGGGCTCAGTGCTGAAATTGGTATTGGCTTTTA
AAGGGCAAACCAGTATCTCTAGAACAGTTTAAGCATCTTGGAAATCTCATTAAGTCACAA
AGGAAAGAAGAAATTCAAAGCCGTATTGAATTAACGTCTTCTATTTTTTTTTTTATTTCA
TTTGGGGTTGGCATTCATTAGCCTAGAAATAACTACACTGATCTTTACTATTTCCTGTAG
GAACTTTTTATGCCAGTGTCCTTTGTTGAAAATGGTTGCTTCAGGAGACAGTAAATTCGA
TATGAAGGATTTACAGTTTAGTTAAATGAATTAAACCATTTCCTGGTGTTTGTGTTTACC
TTGGGTCTCACAAAGGAGACAAAAATATAGACTCACAGGAGGAAGGAAAAGAACGATCAA
ATCCCAGTAGTCCTTGCCTGAATGGCTAGCTCAGCAACTCTATTTACAGGAGGAATTTAA
TGCTGATAAGTGAATCCTTCGTGTCTGTGTAATTAACTTTTCCTCTCTGCACCCACTGAA
CTTCCCTGCTAAGCACATACCTTTATTACATGTGGCAGTTAATGTCCCATTCTACTATGT
ATTATAAAACTAAAGCAAAGGCAAGATTTATGGTTGTCCTCAAGTAACAGTGAATGCTGT
TGTATAATTTTAGTTTTAATGTCAATAATGAAAAATGTTATGAAGGAAAGCCTGAGCATT
CTAGAAAAATCTGACAAATGCAGAAGAGGGTAAATAAGGAAATCACAATGACCTGCAAAG
CCACTACCCAAAGATGGTCATTGTTAACAATGGAGTTGTTGTGGTTGTTGGGTGTCGTTG
AGTTGATTCTAACTCTTAGTGACCCCATGTGACAGAGTAGAACTGCTCCATAGGGTTTCC
TAGGCTGTAATCTTTACAGGAGCAGGTCGACAGGTCTTTCTCCCTCGGAACCGCTGGGTG
GGTTGAAACTACCAACCTTTCAGTTAACAGCTGAGCGCTTAACCATTGCCCCACCAGGGC
TCCTGGTTAACACGTGACAAATGACAAAGGGAAAGAAGAAATTCAAAGGTGTACTGAACT
AAGCTTTTCCATTTCATTTGGGAATGACATTATATTATATACTAGCTTCTAGGTCTTTTT
TGCTATGCCACTTTGTGAATATATGCTTATGTTTTTCTATAGTTAAGATCATGAGTCTAA
TGTTTTATTTCCATGTACCTCCCTCTCTCCATAAGTTCACATCTCTCATGATAAAAGTAG
ACACTTAATAGCTACACATATACGGTGTTAACTATCTGCCAAGCCTCGTTTTAAATGCTT
TTCATGTCTTAGCTCATGTAGTCTTCATAATAACTGTTAAAATTCCCACAATGTTAAATT
TATGTAAGAACTCATAGGCATTAGTTCTTGCAGTTCATGAATTTAGGGACATCTGGTCTG
AATACAGAAACCCTAGTGGCGTAGTGATTAAGAGCTACGGCTGCTAACCAAAAGGTCGGC
AGCTTGAATCTGCTAGGCTCTCCGTAGAAACTCCATGGGGCAGTTCCACTCTGTCCTATA
GGGTTCCAATGCGTCAGAATCGACTCGACGGCAACGGGTTCAGTTCTGTTTGGTTTGGTC
TGAATACAAGAACGGCACAAATCTGAAGGGATTTTGTCAGCTCTGACACACAGGAGAAAG
GAAGCTATGCTGGGCAAATTTCAGGTTGGCTGGCGGGCATTTTCTTCCCTTATATGGGGT
TAAGGGGGAAATTTAAACTAGGTTAAACTGAGCAGGCAAGTCCAGATGGGCTAGTTTAAA
TTTCCACTTCTGGGAGAGCAAATTGATTGACTTGGGCTTTGGCTCCTGGAAAGGTTAGGC
ACTTAAAAGAAACAGAAATTTAGGTTTCAGTTTGCTGATGTGGGGCTCAGCACAAGTGAC
CCCATTTTGGGCATAGTATTTTTTTTTATTATAGTCAGGTTAAGAAGCTCTGGTGGCACA
ATGGTTAAGGCACTCAGCTGCTAACCCAGAGGTCGGTGGTTCGAACTCAACAGCCACTCT
GCGGGAGAAAGATGTGCCATTTTGCTCCCATAAAAGATTGGCAGGCTTGAAAACCCTATA
GGGCAGTTTGTTTTACTCTGTCCTATTATAGGGTTGCCGTGAGTCAGAATCGACTTTACA
GCAATAGTTTGGTTTGGTTTTTGGATATAGTCGCTAGAGGAGCCTTGGTGGCACAGTGGT
TAAGGCGATTGACTGCTAACCAAAAGGATGGTGATAGGAAACCACCAGTGGCTCCAGGGA
AGAAAGATGTGGCAGTCTGCTTCCTGGAGATTTACAGCCTTCGAAACCCTAAGGGGTTGC
TGTGAGTGTGAATGGACTTGACAGCAGTAGGTTTAGTTTTTTTGTTTTTATTCTTTTAAT
AGGGTTGCTATGAGTCAGGATCGACCTGATGGCAACCATTATGAGTCAGAATAGACTGAA
GGCAGTGGGTTTGTTTGTTTTTTGGATAGTAAGGTTAAGGAGCCCTGGTAGTGTAGTGAT
TAAGCCCTGGGCTGCTAACTGGAAGGTCGCTGGCCATTTGAGCCCACCAGCTGCTCCACA
GGAGAAAGATGTGGCAGTCTGCTTCCATAAAGATTACAGCCTGGGAAACCCTGTGGGGCA
GTTCTACTCTGTCCTGTAGGGTCACTGTGAGTCAGAATTGACTTGATGGCAACGGGTTTG
GTTTTTGGCTTATAGTCAGGTTAACATCACCCTTTGAGGTAGATTTTACAGATGAGGCAC
AGAGGGTAAAATGATTTGTCTGGGTCACCCAGGGAGTAAGGGGCAGAGCCAGGAGCCTCA
CCCAGATGGTGAAGAGTGCACTCTTACCACCATGATGGGTTGCCCCCTGACTCCAAGCAT
CATAGTTACTGTCCCTTGGAAATCACCCCCTTCTCGGAATTTCTCTAACACCATACCTTA
TGACATGGCACTTAACTTTCCCTCCTGAACATGTGAAAATCAGCCTTTGAGTCTCTGAAA
AACAGTTACTAGCCATAGCCCTTCCTGTGGGAGGCGCTACCTCAAGAAAAGGAAGCCAGG
GATGCAGCCCTGAGTGTGGTTGAGGGCAAGAGCTTAGATTGGAGGTCAGGAGAGGCTGGC
CTCCAGGTCTGCTCTGCTCACATCTAATTGTGTGAACTTACCCAGTTCAGTTCACCTGTT
TGGGCTCTTTTTTCCTCATCTGCAAAATGGCAGTGCTGCATAGCTGTTCATTATTGAATG
TACTTTAGACAGAGATGAATATGAGACATTTCCTCTCCTAGGGGTTCACCATTCACTGTG
TAACCAGAGAAATAAACTGTCAGTTATAGTTCAGGGTTGCAAGTGTTGTAATGGAAGAAT
GCTGGGAGAGCCCACAGGCGGGGCTGGGGTGGAGAAGGAGGCAGGAAGGAAGGGTCTGGC
AAGGCTTCCCAGAGGAAGAATAGGAATTACCCAGCTGCCAAGGGGATATGAGCCTCTGTC
CCACGCCATTGGGTGCCAAACTATCCCATCTTCAGCAGGCAATGCCATACTCTTTAAGAC
CTTTTCCAGACCTCTTTGTACATGCTTGTATAAAAAAAAAAAAACCATTGCCATTAGGTC
AATTCTGACTCAGTAGAACTGCCTCATAGGGTTTCCAAGGGACACCTGGTGGATTTGAAC
TGCCTACCTTTTGCTTGGAGCCCTCGTGGTGTAGTGGCTAAAAGCTCAGCTGCTAACCAA
AAGGTCAGCAGTTCAAAATCACTAGCTGCTCCTTGGAAACCCTGTAGGACAGTTCTACTG
TGTCCTATAGGGTCGCTATAAGTCAGAACTGATTCAGCTGTACTTAACAACAAAAACCTT
TTGCTTGGCAGCCATAGCTCTTAACCACTATGCCACAGAGTTTCCATGTCTTCTGCATAT
GCTTTCCTTGTACTAGATAAGTAGTGCATACTAAAGAAACAGACCTAATGTGCATATGAA
ATAAATGCAGTCTTCAACCCTGCTTCTCTAGCCTCTCCGGTGTCCACCCCTAGGAAATGT
CTAGAAAACCTTTAAGTCCTGCTTCTGTCATTCAAATGGTGATCCTCCTTCCAACCTAAC
CTGCAGCACCTGTGCTCCAGAGGGAGTGGACTTTCCCTATTGCTCCTGCCCCCTTTGACT
TCTTACAAAGACTCGGGAGGGAGCTTCCTGAGGCACTTAGCATAGCTGTGGCAAGACGTT
TATGCAGAATATTCTCCCTTCTCTATGACTTTTCCCCACAGTGTCATGACTGCTTACTAG
GGCACCAGGGCAGTCCGTTTAGAAAACCAAGACCCCAATGAGGAATTAGGCTTTTTTTGA
GAAGGCTTCTCTTTCTGGGCAGAAACACAGAAGACTGAATTCAGAGAGAACAAATGTGAA
TTTAAGTATTACATTAAGGGGAGGACATGGTGACTGTAGCAGCACCCATATTACCCCACC
AGCTACAGTGTTTGTTGTTGTTGTTCGGCACCAGTCGATTCCAACTCATAGCGACCACAT
GTGACAGAGTAGAACTGCCCCATAGGGTTTTCTAGGCTGTAATCTTTACGGGAACAGATT
GTCAGGTCTTTCCTCAAGGAGCGCTGGTGGGTTCGAATCACTGACCTTTCAGTAGGCAGT
TGACCACTTAACCACTGTGCTACCTATATTTCACTCATTTGCATTTTTTTTCTCATTTTC
TCCTCGTTCAGATACAGGTAGACCTTTCGTAGAGATGCACAGTGACATACCTGACATCAT
CAACATGACGGAAGGACAGGAGATCGTCATTCCCTGCCGGGTCACCTCACCCAATATCAC
CGTGACTTTAACAAAGGTAGAGTGGAACCATGAGAGCCTCAGAATATTTTCACCTCAGAA
GGACCCTAATGAATGTTTCATCATTTCCTCCCTCTTGAACCTTTGGGTTTCTCAGTGGAC
TTCTCTGCAGCATCTGTTCACTGCACTGGATGAGAGCTATCAGTTATACCCACGCATGTT
TTTAAGTGGGATGAAACAATAACGTCTTCAGAAGCTCCAGTGAAGACACATGAAGATGAC
CTGGCTGTCCTAGTGGGAAAAAATTGCTAATTGGTCTCTCTCTTGAGTGTCAGGCCAGTT
TATGACGAAGATTCCAGAGGCCACAGAGATAGGGGCTGGCCCACTAGAACTCTGACATGA
CTAGGCCCGTCCTAGGTGGGTGCAGCGTGTCGCCAAAGGTGACGGAAATCTCCTCACAAC
AAATTTACATCTTGCTATATTCAGAGGAAACTAAAAAACCAGTTACAACACATTGGGTTT
TTTTTTCAATCTGCCATACTTTCATTTTTGATGAAAGAAAAGAATGTTTTCTCAAACTGT
TAGTGAAACAATATTCCCACAGTGCTAATATGATTTTCTTCAAGCATTTTTTTTTTTTTT
TAATTTCAGTTTCCACCTGATACTCTGATCCCTGATGGGAAAAGAATAATCTGGGACAGT
AGGAAGGGTTTTATAATCTCCAATGCAACATACAAAGAAATAGGGCTTCTGATCTGTGAA
ACGAGAGTCAACGGACGTTTGTATCAGACAAGCTATCTAACATACCGGCAGAGTAAGTGA
TATTCTCAAGGCGTGAACGTAAGCCAAAATTGTCTGTGGTTTATCTACTTTGTGAAACCC
TAATTTTAAAAAATGTATCTCTTACCCTTGCAGGCAATATAATCAAAGATGTCCAAATCA
GCACACCAAGTCCAGTCAAATTATTTAGAGGCCGTACTCTCACCCTCAACTGTACTGCTA
CCACTGCCTTAAACACGAGAGTTCAGATAACCTGGAGTTACCCTGGTGACGTGAGTGACC
TATTTTTCTATTTCTTCTGTAAAACAGTATTTATTTTTAGTAAGTGAAATCCCACTAGGT
TTGGGGGAAAAAAAGGTACTTCTCAAAGGGAGGAGTAATACCTGTGTAAGTAGGGTTCCA
GAATGTTCTCAGTGTGTTTCATTTAGGGGATCCATGCTCTGGTTTTTGGTGGTGGTTTAG
TCATTGAGGAAGCTTTAGGATTTGGTACTTTCCTCTTGGATTTCATGGGTGTGATATGCA
TAGATCTGGTCTTTTGATGTGTGGGGTTTTTGTTTTGAAGCTTATAGGCTGGTATTTCTA
TTGCATGATTCTGGGTGGAAAAAGGGATTGTTTCATCCTTGGAAATTGTTCTCTAGGATT
TAAAGATGAGAGAGAAAGTTATCACCAAATGCCAGGCAAGGACTGTCTTTTGTGACAACA
ACACAGAGTTTTCCGGAGGCTGTCTTTGTCAGCACATCCATTTAAGAGACTGGCAGACAG
GCAGGCACCTGATTGGAGCGTGTTTGGAAAAGATATTACAGTCCAGCAATTCAGTACCCC
ATTCGTCAAGTGTCAAAGGAGCAATGCTGTCTTCAGAAAAATGAGAAGAATGAAGACTGA
GTAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTAAAAACCTGT
AGATGGGGAATCTCTGATAAACTGTGAGGAGAATCAGACAGTAGTTCCAGCCCCTGTTTC
TTGTGTGTCACTATGATTTATTGTGGCATATCCCTCGTACAGTCATTTATTGTATCATTC
AGATCTTCCAATCACAAAGTCAACTTATGATTCAATTAGGTATAAAAGTTGAATTCATCA
GCCCCCAAGCCATTGTTTGTTTCATTAACATTTCTTTCAATGGAAATAAAATAGCTTAGC
AACAAAAAGGTATAATAGGTGCCCTGTGGTGACACATTAAGGAGTTATCAGTCAGTAACT
ATTCTCTAGAAAGTGGTGTTGTTTCATGTAAATAAAATGCAATGACTTGTAGCAATATTT
CCAGTATTTTGAGAGAAATAAAATATTCTCAATAAATTCCAAGAGGGAAGGCAGCTTTTA
TCCTGTTAGCCTTACTATTATAAGTAAGAATACTCCTGAATTATTGACTGCCAATAATCT
AAAATGGTGCTGTCCAGTAGAATTGTCTGATGGAAATATTCTACACCTGTGCTATCTAAT
ACAGGGACCTCTAGCTATATGTGACTGTGAACACTTGAAATGAGGCTAGTGCATCTGAGG
AACTGAATTTTAGATTTTAATTAACTTTAATCAGTGTTAATTTAAATAGCCACATGTGGC
TGGTGGCTGCAGGACTGGACGGAACAGTTCTAAAACACAGGATCTGTTGGTTTCCAAGGT
AAAAGCAAACACCAATGTTACTCAACCTGGGGGAAAAGAAGGTAGCTCTCAAACGGAGGA
GTAATACCTATATAAGTAGAGTTCAGAAAATTCTTCAATCTGTCTAATTTAGGGGATTGA
TGCTCTGAGTTTTGGTGGTGGTAATTGACATTTTCTCTCAGGGTACTGCTGAGAATGAAG
AAAATGGCCTAATCGTGTGTCTGTTCCCAGAGGGCAATAAAAGGATAGGTGGGTAGACGT
TTACTAAACATGGCCCAGAGGAGAACTAAGTCTAAGACCCAAAGATCAGTTCTGGACAGC
TTCTGAAATCTTTTTTTCCATGCCCCCTTATGGGAAGGACTGAGAGGAAGAGATAGCATA
TTATGGGTTATAAAATGTAATGCCTAAAAAGAAAAGAAAAAAAGGAAGGAATAACTAAAG
GGTAAGGTAATGTGATCTCATATCTCAAAACGGGAGAAGGTCATTGTGGCCAGTCCAGAT
TGATGAGCCTCCAGGTCTTCTCTTGGTCTTCCCTGAGGTAAGCGTGGGATGACAACCCCC
TCCCCACCTCCAGGAACTTCTAGGTCTTCCCTGAGGTAAACATGGGATGACATCCCCGCC
TCCCCAGGAGCCCCTGGGTCTTCTCTTGGTTTCCCCTGAGGTAAACATGGAAGTGACAGC
TCCCCCCACCCCCAGCCTCTGGGTCTTCTCCTAGTCTTCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNACACTCCACCCAAGTGTTGGCTAAACTTGTTGATGGCTTTG
CATGTCCTCCAGGTCTATTTACTATGATTTAGCAAAGAATTGGCAAGCACTGCTCAAATA
ATGAAATAATGCACCTAGAATTACCACACCTCAGTAGGTGTAGGGCTGACTCATTATCTT
TTCTTTCATTTCTAGTACGGCAGCAATAGGAAACTCCAATTGTGATTTACTGAGAGAGGC
ACTGTCATTAAGCCAGATACTAATAATTATTGTCTGTGTTTGTGTGTGATGTTTATGCCT
AGAGTGCACTAGACCTGTACTCCAACTGAGTTCCCAGCCTCCTTTGGCTGGTGTTTATGT
CGCATCAGGGACTTCATTGATAGAAGGGCAATTATCCTGCTGATCTCAAAAGTTTGTTGT
GAGAAAAACGGAGATAGTGTATGTGAAAGTCCATTTGGAGATAATGAAGTGCTAAATAAA
TACTATGTGTTACATATTTTAAACACATCTAGGCAGAGATGTATTTCCAAACATCTTGCT
CTAGTTGGGTTTGATAGGCTTCTTAACATAAAAAGAAGCTGTTGTTAAAATAAGGATTTC
AGCAATGATCTGAGAAATGCTATAACTTTAAGCATGAACAATTACTATTTGTACATTTAA
GTTATACCATTTCCTTCCTAGATAAATAACAGAGCTTCCATAATTCCACGGATTGGCAAA
AGCAATTCGCTTGGCAATGTATTCTACAGTGTTCTTATTATTGACAAAGTGCAGAACAAA
GACAAAGGACTTTATACTTGTCATGTAAAGAGTGGACCATCATACCAATCGGCTAACATC
TCGGTGCATGTATATGGTAAGCAATAGTTCACAATTACCAACTCAAGGTGTGCTTTCTCA
TCATCGTGGATTCTTAAGGTTCTAGAAAACAAGTCAATTTTCTTTGGGCCATGAGTTACA
GTGTCTTGAATGAATGGAACTTTGCCATGGTTCCCTCATCCCCTTGCCACAGACTAGAAA
GCAAATCACGTTAAGTTCTCTTTAAATTGAGTACTTTTGAATTGGATGGGGAATCTTTTC
TTTACAAGTTTTTTGTGGCCAGTAACTCAGATAACAGTATAATTTTGTTTATGAAATCAC
TTTATTTAGTATAAACAAAACAGAAAAAGATAACTAGTTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTTTATCTCAT
GGCATCCTAAAATTGTTGCTTGATATCGGTATGTGAATTCTGTAAACCCCATCGGTGTAG
TTGTTGGCTGCCTCAAGGCTCTTCCCGCTCCTGCTGAGGCCACGTGACAGGGTAGAACTG
CCCCATAGGGTTTTCTTGGCTGTAATCTTTATGGAAGCAGATTTTCAGGTCTTTTATCCT
GAGGAGCCACCAGGCGAGTCTGAACTCCCATCCTTTCCATCGGCAGCCAAGCACTTAATC
ATCGCGATCCCAGGGCTCCTTATAAACCCCATTCACCAAACCAAACCTGTTGCTGTTGAG
TCAATTCCAACTCATAGTGACCCTGTAGGACAGAGCAGAAGTGCCCAATAGGGTTTCCAG
GGAGCGGCTGGTAGACTTGAACTGCTGACCTTTTGGTTAGCAGCCGAGCTCTTAACCAGT
GGACCGCCAGAGCTCCATAAACCCCATTAGAATCCTTAAAAATCTGAATTATTTCAGTTG
TTGGAAGATAAAAAATCACCAAGATGGAGCAATTCCATCAGTTTTCCTTTTGACATTCTC
CAGTTGATTTCTGATATCAAATTAGTGGTTTTATGATGTTCACAGTAACTTTCCCCCATC
TTACATTTGCCAGGTAGATTTTTAGAACTTTCTTTCCACGTTTCTGTTATTATGATACAG
CTGTTTAAGATTTTTCGCTTTCTATTGCCCTCCCATGGTGGTTTTCTTATCTTTATTTTT
GAAATTGTGGGTCTGTTGTATTGCCCTGCTGTTGTTTTTATGTCTCTGGGACTTACAACC
ATTTCATTTTAAAGTATTTCACCAGCTAGGGTGCTTTTTTAAGTTACTTTAATCATTGAT
CAACATTTGGGCTTATTGACAGGCTCTATCACAATTTTTGTTCATTGGTTGCGTCCTCCC
TAAATGAGACAGTGAGGTTTTGTTTTATTTTGTTACTGGTTTTTTTTGTTTGTTTTTTTG
ACATAAATATGGGTTTTTTTTCTAATGTATTTATCAGTGTCACTTCTTTCAAAGATAAAG
CGTTCATCACTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGCAGTGACTAGGACGCATCTTCAGTAT
GCACATGCTCTATTACCTGGAAGAAGTGGCCTCTGTAATGACGATGCTGGAAATAATTCT
TTTATGTACAGCTGGATGGAAAGTTCCAGTCTTGTTTTCAAATTAAGCAAACATTCATAG
AGACAAGATCTATTCAGTTGCGGGGTGGACGAATGGGCCTGCTTGAACTCTTTTTTTGGC
TCGAAGGGTGCATATTCAGAAACTCTTTAAGCATTTTTTTTTTTTTTAAATACTAGCACA
ACACCTTGATTTAAAACAATGTAATCTGTTTATAATCTGCAGTCATTTTTGTTAAGTCAC
TTTTGAACACCAATATCTTTGGCTCAAGTCATTACGTTTTTAACAAAGGGTATAGTCCAA
AGCTGATTAGGAAAACAACCCACACAGCACAGAAGGGGTGCCGTTTCAGAATCTCCGCAA
CCAGAGTTCATTTTTCTTTCAACATCATGAGTGTAGTGTTTAATTGTTTTCTGTTTCCTC
AAATAGTTAATTAGGAATTAAAGAGAAAATCAAACTTTCTGCTATACCCTCCCCCCGAGT
AGAAAAGAGACTTTTTTTCTTTCTTTTTTTTGCCTTGTGATATCTAAAAAGTTTATTAGT
AAATTTCCTATGCCCATTGCCATCCAGTCGATGACAACTCATAGCAACCCTATAGGACAG
AGTAGAACTTGATGGTAACGCGTTTTTTATTTTTTGATTCTATATTTCAAATTAAAAAAA
AAAAAAAAATTTTTTTTTAAGTTTATATGTCGTTGTGAGTTTGTGTTTTACTGTCTTCTC
AGGGAAGAAATCCTGATAGTCTGATTCAGTATAACTTATGAAAGGACCAACTGGTGTGAC
ATTTATATAACTAATAAGAACTCCACATGAGATCACAATGGGAAGGTCTATTTTTACTTT
ATCTGGAGAAGTGATCTGGTCGATCTGTCTTACAATGGCCCTTGTATTGCTGATGGAGTC
TCATGGAAAACTGAAAAATATCCTGGGTGGAATCAGACATGGTGCTTCTGGGTTAACACT
TAACTCACAATGGCAGCTGTGGGTGCACTTAAAAAATAATAAAAAAAAAAACTGTTGCTG
TCGAGTTGATTTCAACTCATAATGACCTTGTAGGGCAGAGCAGAACTGCCCTATATAGAC
CTGCCAGACTGCTCCCTGGAAGCGAGGGGGATGAGACCCCACCTTACATATTTTTGACAT
GTTATTAGGAGGGACCAGTCCCTGGAGAAGGACATCATGCTTGGTAAAGTAGAGGGTCAG
CGAAAAAGAGGAAGACCCTCAGTGAAATGGATTGACATGGTGGTTGCAACCATGGCTTCA
AGCATAGCGATAGTTGTGAGGATGGCGCAGGACTGGGCAGTATTTTGTTCAGCTGTTGTA
CACAGGGTCACAGTGACTTGGAACTGACTCAGCGGCACCTAACAACAACAGAACTGCCCC
ATAGGGTTTCCAAGGAGCTACTGGTGAATTTGAACTGCTGACCTTTTGGTGCTTTTAACC
ACCACAGCACCAGGGCTCACTTTTCTTTCTTTCCTCAGCTTACTTCTTCCCCTTTGCCAA
TAAATACGAAGCTGTCCCCAGCCGAAAATCATACCTGCCTGTACGGAAAAGTTTGTGCTT
AAACTCCTTAAAACAACATTGAGAGTCAGGTAGTTTGAGACATAAAAACTTGATCTCACA
ACAAACCTCAGTGGCAGGGTTAGCAAAGTGGTATCTGAGAGGCAGTAAGTACCAAGTGAC
TCACTGATGATTCTCTTCACCAAAGGTTAAAAGACGGGTTGCCTGCCACAGAGAAATCGG
CCCGCTATCTGGTCCATGGCTATTCATTGATAATCAAAGATGTGACAGCAGAGGACGCAG
GAGATTATACCATCATGCTGGGCATAAAGCAGTCCAGACTGTTTAAAAATCTCACCACCA
CTCTAACTGTAAATGGTAAGTTTACTGTTTGTGCTTTCTTCTGGTTCCAGTAGGGGGGAA
GTGAATGAAAATTTGTACATTTAAAAGCCAGTGTAACAACATTAAAGACAACAATTTTTG
CCAAATAATAGACAAACACATAAACAATAACACCTCAGAGGAACCCTACTCCTTAGAACA
ATCAGTTGTACGAGATTGAAAAGGCATTATCTGCCCCAAAGCAAAGATGAGAAGTTGGAA
AGGGGTAGAAAATCAGGACAAAAGGAAATGGGAAANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATGCATTACTCTGTCTGAG
AGACACAAGTAAAAACCAGCCCCAGAAAATGATGTGAATACTTCACTTTGTAAAACAAAT
GACTCACCCTTACTTACAAGAACACTTTTTGAAGTGTCCTGCAGAACCCCACACACATTT
AAAAAAATCTAATTTAATATTTACTTTAGCTCTGTGAGGTTCCAGCCTTGATGGTGCAGT
GGCTAAGCACTCAGCTGCTTACCAGCAGGCTGGTGGATTGAACCCATCAGCCATTCCGCG
GAAGAAAGAGGTGGCAGTCTGCTTCTGTAAAGATCTACAGCATTGGAAACTCTATGGGGC
AGTTCTACTCTGTCCTACAAGTTAGAATCAACTGAACAGCGATGGGTTTGGTTTTAGTTC
TGTAAGGTACATAGGAGCCTTTTTACTATCTCAGTCTCACGTATAAGAAAACTAAGGTCT
AACCCTTTGAAAGCAATGGCATCCAAACCTTATTTGGCTGCCATTGAGAAAGACAACACA
ATTCTTTGTGATTGTTCTAAAAACCACGTATACTTCTACCATAACGATTTCCCGTTCACT
TGTTACCTTCCATAGGCAGCCTTTTTTTTTTTAAACATTGCAATCATAGCGTACATACCA
TGGAATTGAATTTTTAATGTTCTTGTAAAACACTCCTACTTTTTTTTGTTTGTTTTATAT
TGGTATTTTCTTGACAAATATGAGGAGCTATTTGGTGTTTGTTAATGTGTTTACTTCCCT
GACATCAGAACCATTGAGAATGTGGTCCTTCATGCCCGTGAGGAGGTTACTCGAACAGCT
CTTGACTTCTGTCCTGTTCTTCATCTCCTTTCCAGTGAAGCCCCAGATTTATGAAAAGGC
CTTGTCATCGTTTCCAGACCTGACTCTCTACCCCCTGGGCAGCAGACAGATCCTGACTTG
CACGATTTATGGTGTCCCACAGCCTACGATCAAGTGGTTCTGGCAGCCCTGTCACCATAA
TCGCTCCAGTGCAAGGTAGGGATGACTTGTTTCTTGATGAACTTTTAGATATTTTCTGGC
ACCTGGGATCAGAATCCTTTACTGGACAGAGAGATAGTGGGCAGCTTATTTATTTCTGAT
GGGTGGTATATTTGGGGCAAAGGCTTCGCCCGCCTTGGGAAGAGGTAGATAACAGCCACA
CTTCTTCTTACTGTTACCTACCACGGACTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACACACACATACACATGCA
GAGACTCACAGTGACCCACCCCCCCCCACACACAAACCCAAAAAAAAACCTAGCTTGATT
AAAAAATAAACAAGACATAACTCTAGCATAAACATAGCCAAGTGGCTATTATTTGGCTTC
CTAGATTTCTCCTGCAGTCCCAGCTCTTCTTCCTCTTGTGTTCTGATCTTTTGTTCGGGA
CTGTTTTACTCTGAAAGGGGGAAGATACTGGTGAGTTAAGGCATTCCTGAAAAGTAGCAG
TTTCCACACACCTCTAATTTCTCATTTGAGTGTCATCTTCTAAAAATAGAAACGTGGTTA
CATGTCTTGAATATCTTCTACCTTTGTGACTATTTAACCCAAAAGAGAGTAGATCTGCTG
AGATTTCTCATTGTATTGCTAATTTGGAGTAAAATCCGTATTTGTGGGTCCATCCCTTTA
AGGTTTTGACGATCGTGCTAGCCTAACATACAAACAAATTTAAAGGAATTAAATAATGAA
GCTGTTAGATTTGGATTAAAATGCAGAATTGAGTTCTCACAGAACAATATAGCCTTTTAT
GGATATTTTAAAATTTTGTTTTGACAATATCAAATCTAAACTTCCAGTTCTATTTAGGAT
TAGCATTAGCTACCATATGTTGGAAAAGAACAATTATAGCGTTACTTACCATATGTTGGA
AAAGACCATAATGTTACAAAGTCAGGTGTGAATATTGCTAGTAAAGTAAGGTGTGGAGAA
TGAGGCAAGCTGAGGTGACTGCTCCGTAAACATTAGCTCTCTTTGTGGCATATGGAAACC
CTGGTGGCACAGTGGTTAAGAGTTTGGCGGCTAACCAAAAAGGTCGGCAGTTCGAATCCA
CCAGCTGCTCCTTGGAAACCCGTGGGGCAGTTCTACTGTGTCCTACAGAGTCGCTATGAG
TTGGAATCAACTCTGTGGCAATGGGTCTTGTGGCATATGGGATCCTTTTACCATATTATG
GAATAAGCTCACCGATGCAGCAAAGATGTCTGATTGCTTGTGAAAGCCTCTCAGGACTCA
AGAGTAATTACTGCCTTAAATGTTAAATACAAGTTTGTCGTTTGAATTATTCCCTGACAG
TGCCGTTCACTCACTTACCATCTCAAGACAGACGAGAAAAGGAAGCTTTAACTGTTTCCA
TGATAATTCATTTTTGTATATGTTGTTGCATGAAATTATCCACTGAAAGTGTGCATCTCC
ACAGCAGTTCTCGTTCTTCCGGTCAGCAGATAAGGCTGATTTGCCCTCCCTCGTGTCAGG
CCCAGCTTGGTTGCGTGATAGTTAAATCAGTGCCTTTAAGTTAGTAACATTTCTGAAAGA
TATATAGGGCCCTTCTTCACTCTTTAGGGAATAAATAGAGTAACCCATGAACTATTTCAC
CTTGTCAGGGGAATAAAAGCTAACATTTACATATAAACGAAGTCCTCTTTAATTACTAAA
TTTTTTTAAATGAAAGTTTTTATACAGGTATGTTTTTATACACGTAGATGAATAGATTCA
CTCGGCAGTTCAAACCCAACAGCTCTCCACGGGAGAAGGATGTGGCAGTCTGCTTCCGTA
AAGATTTACAGCCTTGGAAACCCTATGGGGCAGTTCTTCTCTGTCCTGCAGGGTTGTTAT
GAGTCTGAGTCCACTCAGCAATAGGTTTTAACATTTGAATAAGGGATGTTCTATCACACA
GATTTTTAAAATCTTACTATTTTGAGTTATATAGTAACATCTGCAAAGTGGTATGTATGT
ATGGTCACGAAAACTGAATGATTAAGAGAGACACGTTAAATTACTCTTAATATGTAGAAT
AATCCATGTTATTTAAATTTTAGGCTCTAGTTAAAGGACACAGTTAAATATTGACAAAAC
CAAAGCATTACTTTAGTTTCGAGTGTGGAATGTGTGTTTTTAAGTAACTCAAAATTATTA
ATTGATTTAACATGGCTAGCTGGTTAATGTATCTCAGTTAATACAGAGAGATGTAAATTC
TGCCATTTCCTGGAGCCTACAAAATATGGAGATATATTTCTTAACTATCACAGCTATTGC
ATAACTGTTTCGTATTTATGGATATTAAGAGCCTTATGTAAATTTCCCAGAAATGTCTTC
CTTTTTTTTTTTCAAATGTGGTAAGATACTTCAGACGAGCTGTGCTTTGACTGAATGACA
TTGTGGTTTTTGTTTTTTCTAGAATTTGTTCTTATAAAATATTAGGAATAAAAGAGAGTA
GGTGGGGACACAGGTGGTTATTTTAAAATTCACGTAACTAATGAGCTGAGAAGAAATACA
ACAGAATCTTTCCCCTTTTCTCTGCAGATTTGAGTGGTAAAGTGGTCGTGGGATTAGGAT
ATTTCTTTTGAGTACTTGATAATATTAAAATAAGTAATCCATATTGAATGAGGTGGAATT
TTGGGTTTTTCTCATCCTCGGCAACTGATAAAACCAAACCGATTACCATCAAGTCAATTC
CGACTCATAGAGACCCTGTAGGACAGAGTAGAACTGCCCCATAGGGTTTCCAAGGCTGTA
GAACTTCACAGAGGTAGACTGCCACATCTTTCTCCCGTGGAGCGGCTGGCGGGGTCAAAT
CACCAAACTTTCAGATAGCAGCCGAGCACTTAACCACTGCACCACCAGGGCTCCTTCCAG
CAACTGATAGGGACTTCTAAATAGATATTTATAAACTTGCTGTATGTTAGCCGGGGTGTA
AACCTGGGGAGCACCCATAAGGGTATTAAGCTTATGATACTTAGCACGTGTCTATAGTTT
ACATAAAATGAAAATAATTATACACACCTCATACAAAGAATATGAGGATTGAATGAAGTA
CTTAGAAAAAGTACCAAATGCCAGAGAAATGCAAGAGTGTAATTGTTACTAATCGACTCA
GTGGCAATGGGTTTGGTTTTGGCTTTTGTCACTGAAGGAGCTCTGGTGGCCTAGTGGTTA
AGTGCTTAGCTGCTAACCAGAAGGTCAGTGGTGTGAACCCACCAGCTGCGCAATGGAAGA
AAGATGTGGCAGTCTGCTCCCATAAGGATTACAGCCTTGGAAACCCTGTGGACAGTTCTG
CTTTGTCCTGTAGGGTCACTGTGAGTCAGAATTGACTTGACAGCAGTGGGTTTGGTTTTT
TTAAATTGTTACAAGCATTGGAGTAAACTTCTCTAAAAAAGGGCCGAGAACTTTTTAGGA
ACTCGAAAGAAAATTTCTGCCTGTTATAGAGCTAATTTCACAACAGTGAGAAATTTTACC
AAACGTTTCTGAGAAATGAACCAAAATTGGGCATTTGAAAGTAAAATGCAATGTTGCTGT
GCTTTAGAAATAGAAATTTAGTGGGTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGAAATGCTCCA
TAGAGTTTCCAGGGAGCACCTGGTGGATTTGAACTGCCAACTTTTTGTTAGCAGACATAG
CTCTTAACCACTACATCACCAGGGTTTCCTACTAGGCACTAGCCGTATACAAAACAAAGA
TAAACACCATTTGTCTTTAATTGTGTAAAATCAAACATATTTGGTGATTTCTTTTTGGAT
CTGTACATGTATTTACAGAATCTCTGTTACACAGTCTCAGGGATAGAGACCTGAGAACCA
AGGAAATGGGTTCTATTATTGGCACAGTCCCTGACTTTGGTGTGACATTGGCCAGTTGTT
TCCTCTCTCTGGGCTTCAGTTTCCCCTTCTGTAAATGGTAAATCTCCTGTTTCCCCTTTC
CTATAAGCCACAACTATTAATGAGTTAAATGAGAAAATTACTTTAAATTACATCTTACAA
AAAAGCTTGACATGATTTCTTAGTGGTTGCACATGAGCTATCTCTTTTCTCTTTCTTGTA
AATTATAAAGCAATTTGAACCATTAACTCTAAGCATCTAGGGCCAAACTGATGGAAAAAT
ACAACTTGTGAAGGTCGAAAGGTTATGAGAAAAGTCTGTGAGATGGAATCGACTTAGTAA
TTAAAAAGTTAATTAAAAAAAAAATCTATTGCCATCAAGTTGATTCCAACTCATAATGAC
CCTCTAGGACGGAGTAGAACTGCCCCCATATAGGTTTCCAAGGCTGTAATCTTTATAGAA
GCAGATAGATTGTCACTTCTTTCTCCTGCAGAGCAGTTGGTGGGTTCGAACTGCCGACCT
TTTGGTTAGCAGAGGGCTTTAACCACTGTGCCGCCAGGGCTCCTCATAAAGTTCATTGTT
ACCCAGTAAGAAAGACAGTGCAGCAGTCCCTCCACCATACTGTTGTCCACGTTGTCCTCA
GTGCGAAACTGGACTACCTTTGCCAGCCTTGTCCAGCCCAAACCAATGAGAGCCTTACTG
TGCTTTGCCCAGCTCGCTCTAAATCCTCGCCTGCTTTATTTGGTCTTTTGCCAATGAGCC
CCTTCAGGATGCAAAAAAAAAAAAAAAAAAAAAGTAGTTGGATTCTAAGTTCTGGGAAAC
TAAGAAAAGATTACTCTTCTTCATTGCTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTCTGGTTTCTGCCCTAGCAGTAAAGGTGCTGGAGGAGAGTCTACAGAAA
GCCCGCCACCCCAGTTCTGTGTGTGCTTTGCTCTTTGGGGAAGTTATCTACAAAATAAGG
GGCAGACAGAGGCACCTGGGAACGCTGAGAAGGCCTTGCCTAATTGCATTTGTCTATTGT
AAACGTCAGCAAATTAGCAGCGAAAGCGAGGCCCAGTTGTTAGGAATGTGGCCAGGAGAG
ATCATTTGGAGAAAATAGAGTTTTGTCCATCAGTGGGGTCTGTAAAATAAAACAAAAACC
AAACAGTCGTTCATGGTAGTTAATTAGAAATGTGCTCAAGGACCCAAATTTAATTGACTA
CCAGCATGAATGTCTATTATTTTTTATGCCGTAACAGTTTTATGTCCAGTATTCTATTTT
CTATCTACAAAATAAAAGTTCTTACACCTTAAAAATTAAAAAAAGCCGACGTTCCCTGGG
GCTAAAAGCAGGTGAGATGACTGAGGAAAGCTGTAATTTAAGAAAACCTCTTCTTTGGAA
GTGTGATGACATGCCTCATGTTTTAATATTCATCTCACTCCTCTTTAGATAAATACTGTT
TTTATCTGGGTGTCCCTTGACATACAGTGCGTGCAGTGTGCGAATGGGTGGGTAGACTCA
AATATGGAGAATCATAGTTTGCCACAAACAAAACTTTGAATCCAAAGGAGGACTTTAAAG
AAGATCACGTCACCAAAGACCACTTTAGGAGGACTTTGAGCTTGAACAAGCAACCTGATA
AAACTGGCCGTCTTATATGGTGGGCTTTCATCGTAAGCCAGGAGTGAATGTTCACTTACT
AATGAGGAGCTTTCGTGCATTCTGTTATATAATTACTGGATGAAGCAGTGCCTGCTGCCC
AATGGGAATGTCTGGGACAACAGCCCTTATTTAATATTTCCTGGCAGAGTCCTGAGAACA
CAGCACAAGTTCACTTGCCCAAATGCTTTTTTTGCCACTTTTCTGAGCCTCATGGGGATT
TTCCTGCCATTTCCCACAGGTTCACAGTGGATACAGCGAGTCCAATGGGATCAATGGTTC
GAATGATTTAAACTGTCCTCTGGTAATTTGCTGTCTAACTTTTCATTACTTGTTTTAAAT
AAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTAATTGACTACCA
GCCTTAATGGGGATTATTTTTTATGGGGGAACAGTTTTATGTCCAGTATTCTATTTTCTA
TCTACAAAATAAAAGTTCTTACACCTTAAAAATTAAAAAAAGCCGACGTTCCCTGGGGCT
AAAAGCAGGTGAGATGACTGAGGAAAGCTGTAATTTAAGAAAACCTCTTCTTTGGAAGTG
TGATGACATGCCTCATGTTTTAATATTCATCTCACTCCTCTTTAGATAAATACTGTTTCT
ATCTGGGTGTCCCTTGACATACAGTGCGTGCAGTGTGCGAATGGGTGGGTTGACTCAAAT
ATTTTTTAATTATAGTTTGCCACAAACAAAACTTTGAATCCAAAGGAGGACTTTAAAGAA
GATCACGTCACCAAAGACCACTTTAGGAGGACTTTGAGCTTGAACAAGCAACCTGATAAA
ACTGGCCGTCTTATATGGTGGGCTTTCATCGTAAGCCAGGAGTGAATGTTCACTTACTAA
TGAGGAGCTTTCGTGCATTCTGTTATATAATTACTGGATGAAGCAGTGCCTGCTGCCCAA
TGGGAATGTCTGGGACAACAGCCCTTATTTAATATTTCCTGGCAGAGTCCTGAGAACACA
GCACAAGTTCACTTGCCCAAATGCTTTTTTTGCCACTTTTCTGAGCCTCATGGGGATTTT
CCTGCCATTTCCCACAGGTTCACAGTGGATACAGCGAGTCCAATGGGATCAATGGTTCGA
ATGATTTAAACTGTCCTCTGGTAATTTGCTGTCTAACTTTTCATTACTTGTTTTAAATAA
GCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCGTTTGTCACTACCCAGGATTAGGTG
TCGATAGATGGGCGCTAAGACAGTAAAATGAGTAAGTTTTGGTCCCTTTGCATGCATAAT
CTAGAAAGCATATATGCTTTAAGAAACCTGCGTTGTGATATCAAGAGCCAATTGAAAAAA
GGTGTCGAGATGCAGAAAGGTAACGTAGTCTAGTGTTTAGGACATGGGCTCTGCAACCTG
CATCCTGGTTCTGTGACCTGTGTCTGTCTACCAGCTGTGTGATTCCAGGCAAAATCAGTC
ACCTCTCTGAGTCTGGGTGTCCTCACCTGCACAATGGAGATAATAAGACTTACAGCTTAA
GGTTGTCTGGAAATTTAATGACATCATATATATGAAGTAGTTAGCCCAGTGCCTGGTGCA
TCACAAGTGCTAAATTTGTTGGCTGAAGGTTGGCTCGTACTTTTAGGATGTTTTAGGGCT
GCCCATTGCAAAGCCACTTTCCTTTGAAGTGGTATCATATACATACCAAGATCCTGTGAA
AGCTGACAATAATTTGACAAGATAATTCCTGCTGGCAGATTAGGAAACCTCTTTGGACAG
GTCTCCTGACTGTGGCCCATAGTTGATAGAAATTTCAGATCCCTTAGGAAACTGTTGTTG
TTATTAGGTGCCATCGGGTTGGTTCCAACTCATGGTGATCCTGTGTATAGCAGAACGAAA
CATTGCCTGGTCCTGTGCCATCCTCACAATCTTTGCTATGTTTGAGCCCATGGTTGCAGC
CACTGTGTCAGTCCATCTCATTGAGGGTCTTCCTCTCTTTCGCTGACCCTCTGCTTTACC
AAGCATGGTGTCCTTCTCAGGGATTGGTTCCTCCTGATGACATGTCTAAAGTAAGCAGAA
CTAGAGGAGGTGTAATGCCCTTCATCTACTTTTGCTCAGTAGTTGTACCTCAGCTATTCA
GAGGCTCATTGATCTAAGTATTTCTCGGTATAGTAGTATGTGGGCTCTTGATCTTTTGCT
TGGGCTCCCTTGTATTCTGATTTTTTTTTCCATGTATCTGACTCATCTCTTCAATAAACA
TGTTTTTTCGTTAGGGGTCATCAAGTTCAGCTTTTGACTCATAGCGACCCCATAGGACGG
AGTAGAACTGCCCCCCTACCTCCCCCACCATGGGCCTTTTCTAGGTGTGATTCTTTACTG
GGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTATGAATGGGAATTTTATACTGGACGAGCCTAGGAGTCTCCGGTGC
CATGTTGTTTTTGTTGTGGAACTGCCCCATAGGGTTTGCTAGGCTGTAATCCTTATGGGA
GCAGATTGCAAGGTCTTTCTCTTGTAGAGCCGTTGGGTGGGTTCGAACTGCCAGCCTTTT
TGTTAGCAGTTAAGTGCTTATCCATTGCGCCACCAGGGCTCCTTTCTGGTACCATAACAT
GCACTAAACAGATTGGCAGTTCCTAGAAAGGCTAAATGAAGGGTTGCACCATCCACCCAG
TTCTTCGAACAGTCTATCATTTTCTCACGAGAGGACCACTTAAAAGAAAACACAAATGCT
CGCCATCAGTGGTGAAAACTCACCCAGCTGGAATCTTGCTTCTGATACCACCAGATGCAA
CAATCTGTCCTCTAACGAGAAGAAAGTACCAGCTCTGCTTTTTAGGTAGGGGAAGCAGAG
GAGGAATGAGGAAAGAAGGTCTGAAAACGAAAATTGGTGAAACGCAGTAAAAGCACAGAT
GAACGAACACAAAAGGGTATGTCTGGGTCTTGGTTCTCTAGTGCTGCTATAGCAAAAATA
CCACAAATGGGTGGCTTTAACAAGCAGACATTTCTTTTCTCACAGTTTAAGAGCCTAGAA
GCCGGAATTCAGGATGCCAGCTCTCGGGGAAGGCGTTCTCTCTCTGTTGGCTCCTGAGGA
AGGTCCTTGTCTCTTTTGAGCTTCTGCTCCTGGGCGATCTTCATGTGGCTTGGCATCTCT
CTTCCCCTATCTCTGCTTCCTTGCTTGCTTGTTTAATCTCTTTTGTATCTCAAAAGAGTA
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCCTTCAGGGCTTCG
AAAATGGTGGTATGAATACATTTCATAGTAGGGTGATATATTTGTAGAGTGTATATTATA
GTCTTTGGCTGGCTAGCTTTGGCTGGGTTGGAACCAGCAGTTAACGTTGTCAAGATTGTA
GGTGGGACCCGTGGGCTGGCTTTGACTTTTTCTGTGGCCCCAGACTGCCTTCATTTGTCT
TTGGTCACTGAAGAGCCAAATATTTATGAGTGTGGAGGGAACAGGGCAAATCCATCACCA
GTACAGGAAAGTCAACGCAAAGCACGCAGGTCAGTAATGTCACCTAAATATACGGAGAAT
GGTGTTTTCCCAAGATGCATTGAGAAAAGAAGCCTGGTAAGCCAGTCCAGATGGCGCCAC
AGATGGCTCCCACTTGCAGTTAAATGGCCTGACATGTGCCGTGTAAGGACCCAGCTCCAT
GTGTTGGATACATAATTGGTTGCTTTCTTTTTCACTTATTTATAATCCATCTCTAGTCTG
AAACAAATGAGTTTCAACTCCAGGGCAGTCAACGGAGATGACATGGAGTACACTCTTAGC
CTGGATTTTTTTTTCCTTTCTATGGTTATAAATACCTGCCCGCTATTGTACTTGGCATGC
TGTATGCAAATGGGGGGAGGAGCCCACAAGCTCATTAGGAAAGGGACAGAGGCTTGGAGC
AGAGAGAGGACAGCAGTGAGCTGGAGTTGATAACAGTGGCCTTGTCCAGAACAGTGCATG
GGAGCTTTCTTATCTCCCTTTGGCAGGAGGTGCTGCGGGCTTCCTGTGCGAAATCAGGAG
CGAACGCTGCTTTCCTCTTGTTGTTCGGCTTCCTCCCCCCTCAAGACGGTTCCCAGCACA
GTGATTATCTTTGCATCTTCAAACATGGCACAATCTACTTCCTTAGGAGCTTGATGTATT
CTTAAGGCTCAGGCAGGCTCCCCTCCCCCTACCTTTCTTTTCAAGTGTTCTTATATAGCC
AGGCTCCTAAATGACATTCTATTTTTATGGTTCCAGTGACAAAGAGGGAAAAAATAGCCC
CCCCAAATGTAAATGGTTAAAACTAGAATCTGTCCTTTTCATTCGGGGGGACTTTCAGGA
AACCTAGCTTATGGTTTTACCGTGAGGCCTGGTGCCATCAGCGACTGCCCTTGGAGTTAT
GGGTACGGGGTGTCAGAGGATGACAGCCCCAAGTGAGCTTGAACAGCAGACTGTATTTCC
CTGGGGAAACTTCCAGACTTGATTTACCTAACATAAAAAAAGCCAGTGCTTGTTTGCACT
TCCTGAAAACCAAGAATGTGGAATTGGAACTACGGCATAAAAAACTGTAAACTTTATGGG
AGCAGATCACCAGGCCTTTCTTCCGCAGAGCCATTGGGTGGGTTCAAACCTGCCAACCTT
TTGGAGAGCAGTCAAGTGCCTAACCATTGGGTGGGTTCGAACTGCCAACCTTTCGGATAG
CAGTCAAGTGCTTAACCATTCACGCCACCAGGGCATCTTGTTGGAAAAGATGTGAGGTCA
GATAAGAGTTCAAGGTACAGATGTAGATCTAGAAAAGGGAGAATATTGATAATGAAAAAT
TGGGCGAAGTGACTTTTCTACAGTGATTTATTATGCAAATGTTTCAAATAACAGGAAAAG
TGTATAATTTCGCTTGGCTTCTTTTTACTCTACTACCCAATAAGGGTTAAAAAATTTTTT
TTTTTACTTGATGATTATAAGGAGTAACTATTAGGAATGGCAGAAATTCCTTAAGAAATG
GTCAGTCCTCATTAATTCTTTCTTATTTTAAATCTTATAATCTAACTGTAAAAAAAAAAA
AAAAGACATTTGAAGAAATCTGATATATGGACTAAGTACAAACAGCACCATGGGATTACT
GCTAATTTTATTAGGTGTAATAATGGCATTGTGGTTTTGTTAGAAAATGTGCATTTTTTT
AGACACACACACTGAAGAATATAGGATTAAAATCACATGATGTTTGGAGTTTGCTTTGAG
ATATCTCACAAGAGAAAAGACATGAAATACGGGGTGGATGAAGCAAATAGGGCAATGTCT
GGAGAATTATAAAATCTGGGTGACGGGTATAAACCAAACCAAACCCATTGTCATCAAGTC
GATTCCGACTCATAGCAACCCTATAGGATAACGTAGAACTGCCCGATAGAGTTTCCAAGG
TGCACCTGGTGGATTCAAACTGCCGACCTTTTGGTTAGCAGCCATAGTTCTTAACCACTG
TGCCACCAGGGTTTCCAGGGTGATGTATAGAGGGGTTTATTACAGTATGTTCCCTACTCC
TGAGTACATGTGAAGATAATAAACAATTATAGCAACCCAAAGGAAAACTCTTTCTAGAAA
CAGCAACATACATGCCTGTCTGTATGTTTATAAATGCTTGTTGTCGTTGTTGTTGGGTGC
CATCAATTCCGACTCACAGCGACTCCATGTGACAGAGTAGAACTACCCCATAGGGTTTTT
CTAGGCTGTAATCTTTACCAAAGCAGACTGCCAAGTCTTTTCTCCCGTGCAGTGGCTGGT
GGGTTCAAACCACTGACCTTTCCATTAGCAGCCAAGCACTTAACTATGGTGCCACCAGGG
CTCCTTTTACAAATACTTTGGAGCGTGGATTACGTGCTAGGCTATGTGCTTAGCTATGAG
GTTGCAGAGTGAGTGAGTAGATGTGGCCCCTTCCTCCTGTAGCTGTCTGCCATGGGTGGG
GGTTCAGGAACGTTTAACAGTCATGCCCAAGGTGGCGAGTGCTCTGGGGAGGACACAACG
GGGCATTGAGCCCGGGAGCACCGCAGGGTGGGCCCTCACCCAGATCCAGCCCACTCAGAT
AGTTTAACATCTTGGAGTTCCTTCTCAGGGCCAGGACTACAGAGGGCACCAACAGAACGT
TACCCTGCTCTTCACAGTCCCTTCCATGTACATTTTCCTCACTAGCTTTAATCCTCTCCC
TCTCATGGCACAAAAGACATTGCTGCCCCTGGCTATTTAAGATCAACCACTCATTCTTTC
TGGAAACTGGGCTTTAAAATCCCTCCTGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGCAGGTTCCAGCCAGGGAACTTCT
GGGCACTTGTCACCCCTCACCTTCCAGTTTGCATGGAATGCTAACCTGCAGAGCCAACAC
AGACTTATCTGAAGCACTGAAAATATCTCTTGGTACAGTTGCATTGTGTCCCAATTAATC
TATATTTGAATCTGGAATTAAATAGTAGAAAATTGGATCATCTGGAGTGTCCATTCACCA
AGCACCCGCAGTGTGAGCTGCTGCAAGGCTCTGGGCAGTGTACTGCCTATGCGGCCAGGG
CAGGGAAATGCAAATCACAGGACCAGTTAGGGTCAGCTGCGCTGGCCTCCGTGAGTAGTT
CAGATGGTGAGTGCTGTGAGTGTTCACTGTGGGCAGAAGAAGCTTCTTAGAGAACATCAG
GCTTGGGGGAGAGGATGCTGGGGCGAGCGGTGCCCAAACAAGAAAAAAATCAGCTGCCGC
CAAGTCGATTCCAACTCATGGCACCTCCACGTGTGTCAGGGTAGAGCTGTGCTCCAGAGG
GTTTTCAGTGTCTGACCTTTCAAAGGAAATCACCAGGGTTTTCTTCTCAGGCAGCTCTGT
GTAGACTAAAGCCACCATTCCTTCAGTTAGTAGCCAAGCGCTCAACTGTTTGTACCACCC
AGGAACTCTTGGAGGGGGGGGTATCTTCCCATAAAACCCATTGCTGTCCAGTCGGTTCCA
ACTCACAGTGACTCCTTTAGGACTTAAGGGGTGACTGCTATGTCCAGGGAATGATCAAAA
ACTGTTTTTTGTTTTTTGAGTTTTGTATTCATGTAGAACCTAGAAAGAAGTCCTCATGGC
ACAACAGCTAAGGGCTCGGCTGCTAACTAAAAGGTTGGAGGTTTGAACCCACCCAATGAC
TCCACTCCACGGGAGAAAGATGTAGAGACCTGCTCCCGTACAGATGGACAGCCCAGGAAA
CCCTCTGGGGCAGTTCTACTCTGTCACGTGGGGTCACTATGAGTTGCAGTCGACTTGACG
GCATCTGACAACAGAACCCAGGACACATATAAAACATGATAAATGATCAGTACATATCCA
GTAATTTGAGTAGTAAACCATATGAAAACAGAAGCCTACTGATAATAAAATGTATTTGAA
AGAACATGTCAGCTTCCTGATATAAGTCAAAATCTCTCTTTACCGTTTATAAAATGGTGC
CCTATTGCCTAGTTCTAAGAGAGATTTCGTGAATTTTACAGGACAAAAAAGGACCTTAAG
GGTAAACAACTTCAGCTCCCTCATTTTACAATTAAACTATTAAAACCTGAGAAGTTAAAG
GGCTTGTTGCCATGTACACCCCTCCCCAACGTGAAATAAACTGAAATTAGGAAGCACTCC
ATGATGTCTGTTTCCATATTAGCCCTGGAAAAAAAATTATCTCTACAACTGAATATTCTG
ATTAAAAGCCAGCCTTTTATAGATGGGAAATGCTTATTTCCTCGAGGCTTCCATTCATTA
CCATAATTTTTTTTTTCTGTATTTGCATGGTACTTCCACTAGGAACTAATTGAAATCTAG
GTATTACATTTTCTAATGTTTAATAGTTGACATGTAGAACAGGAAGTATGCACTGAGAGA
CACCAATGTGGGCTTTTTTCGTATCAGGCAAATATGTGTTTGTTTAAGTTTTGAAAATAG
ATATAGGGAAAAATCTAAGGAAAAGAGTCTGATAAAAATTGTGACTTTGTTATCTGAGGA
CTTAGACAATGGTCTCCATCCACCTGTCAGCATTGGCAGGAGGCCTGGTGGTGCAGTGGG
TAAGCACAGATCAAACTCACCAGCAATTTCGTGGGAGAAAGATGGGGCAATCTGCTTCCC
TAAAGGTTACAGCCTTGAAAACCCTATGGGGGCAGTTCTACTCCATCCTATAGGGTTACT
ATGGGTCGAAAACTGACTCAGTGGCAACGGGTTTTATGGGTCACCACTGGCTGGGCGGTG
CTGAAAAGCACATTGTGATGACTTACTTTTTTTTTTAATTAGGTCTGACTTTTGTTCCAG
TAATGAAGAGTCCTTTATCCTGACTCCTGACAGCAATATGGGAAACAGAATTGAAAGCAT
CACTCAGCGCACGGCAATAATCGAAGGAAAGAATAAGGTATTGTTTATAAAAACATTGGG
ATAATTATCCTGAAAATACACTGTCAGCTCCCATCTTTGGATTTATTGGGACTAGAAATT
ACCAAATGCTTGAATAAAAATTCAGAAAGAAGAGAGCCAATAACTGAGATATCAGAGTAG
AACTGCTCCCGCAGGATTTTCTTGGCCGTATCTTTTCAGAAGCAGATCACTACGTCTTTC
TCCCACATAGTGGCTTGTGGGTTCTATCCATGGACATTTTGGTTAGCAGCCAAGCACTTA
ACCACTGTGCCACCAGGACTCCTTGAAGTAATGATATACTCGGTCCTAACGGAAGAGGTG
CAGCTGTCTTCTCAGACATCAGAAGGGTCCACTCCAGTGGTTCTCGCCCCTGGCTGCATA
TCAGAAGACTATGTTGTTGTCATTAGGTGCTGTCAAATCGATTCTGACTCATAGTAATCC
CATGTGACAGAGTGGAACTGCCTCATAGGATTTTCTAGGCTGTAATCCTTACAGCAGCAG
ATGACCAGGTCTTTCTCCTGAGGAGTTCTGGGTGGGTTCAAACGCCAACCTTTCGTTTAG
CAGCCGAGTGCTTAACCCTTGCACCACCAGAGCTCCTACCAGTTAGTACATCGGAATATC
TGGGCTAGGGCCCAGGTGATTGTAACACCTAAACAGGACTGAGAATCACTGACGTACATA
AGCCAGGATCCCAATAAGCAAAAGCTTGGCGTCTTAGGTAGCACAGACAGTTAAGCACGG
GGCTACTAAGAGAAAGATTGGTGGTTTGAGCCCACCCCAAGGTGTATGGCAAGAAAGGCC
CGGTGATCTGCTTCCAAAAGGTCACAGCCATGAAAGCCCTATGGAGCAGAGTTCTACACT
ACAATATGTGGGGTGGCCGTGGTCAGAACCGACTCAACAGCAACAGGTTAATTAATAAAA
GACTTAAGGCTAAAATTCACTGTGTCCGTTTCATAAAATATCTTGTTTTTCCCTCTGTCT
TTGTAAGGGTAAAGCCTGGCTAAGTTGGGGTGTACAAACACATGCTGAAACGCAGGATAT
CAAGATTCCTGACCTAATCAGGGTCTAGCAGGCTTCTTTTTTGCACGCTTGCACCGTTCA
TTCCCTAACCCCTCTCCCCCACTGAGCCTCGGGAATTGCTGACACACCTTGAACCAGCAA
ATCTCCCTGGATCTCAAACCAGTGACTTTTTTTTTCTATTGAATTAGTGAAGAATATACT
TAAAAAATCTGCTATTGCCAAAGCACAGGAATAGTGATATTTAATAAAAGAAAAAAATGT
ATTAAATAACCACTTGCCAAAATGTCTATTTCTGCATGCATGTTTTATTTGGAAAGAGCC
TCAGTGTCGCCAGCAGTTAAGTGCTTGGCTACTAACCGAAAGGTTGGCATTTTGAATCCA
CCCAATGGCTCCATTGGAAAAAGACTTGGCAGTCTGCTCCCGAAAAGAATACAGCCTAAG
AAACCCTATGGGGAAGTTCTACTCTGTAGCATGGGGTCGCCGTGAGTCAGTATCAACTCA
ACTGCACCCAACAACAACGTCTTATTTTGAGTAGAGGCTGTTAATACAGATCCCACCATC
TGCTTGAGTGAGGCTGTGCTTTGTCATCTATTCAGCTGTGTTCTCTGCATATGGAGATGA
CAAAGTGGATGGCATCATTCTCCCTGTAGGATTTAACAATAACAACAAATAACGTCTGTA
TTTTTCATTGTGTAAACCTTTTTGACATACACTCACGTCAGCACTCTTTGGCAGGCCAGA
GTGGTTATCTCCATTTTAAGGATATGAAAAACCACTAACCTAAAGCCACACAGCTTATAG
GTGGTCAATGAGGAACTCGAACCAGAGTCTTCCTCGTCCAAAGTCCACTGTTCTCAGTCT
CAGTTGAACCCACACAGAAGTTAGTAAAGCTGGTGCTGGCTTGCATGACACCAACATTCC
CTTGTGAAGGATTTAAGAGTGGCTTTTTTTTCACAGCTACAGCAAATAAGATCATTTACA
ATTCTTTTTCTCTAATGCAAATGAGCAGGCCTTTAAAAACAGTCCATGATGGTTAGCAAT
TAATGAGAGAGTATTTGAATGTAAACCTTAGAAAGGAGGAAATTCTGAAAACTTTAAAGT
TTAGTTTGGGTGATACTGTGTTAAAAAAAAAAAAAAAAAAGGAACTGCCTCAGAGTATGT
TAGCAGTAGACAGCAAGTTAGGAGCCCTGGTGGCACGACAGTTAAGCATTTGGCTACTAA
CCTAAAGGTTGATAGTTCGAACTCACTCAGTGGCTCCTTGGGAGAAGGACTGGTAATCTG
CTCCCGAAAAGATTGTTGTTGTTGTTGTAGTTAGGTGCCATCAAGTCGGTTCCAACTCAC
AGCAACCCTATGGACAGGTAGTCCCCGGGTTATGAACGAGATCTGTTCCTAACTCTGTCT
CTAAGTCGAATTTGTAGGTAAGTCAGAACAGGTGCATATAGTTCTTATTTAGCCTTACTT
TAATGCAAGAAAAGCCTCGAAGCCTTGCCACTGATTTAAAAGCTGCAAATGCAGCAAGTA
AAGGGGATTGTGGAGAAGAATTTGTTGCAAGTAGGGATTCATTCAGCCGTTTCAAAGTGA
GGGTAAGTTTACATAACATTAAAGGGTGAGTATGAGTAGTCCATAGATCAGATGTTCCTA
ACTCAGTGACTTACTGTACAACAGAACGAAACACGGCCTGGTCCTGTGCCATCCTCACAG
CCGTTGCTGTGTTTGAGCTCATTGTTTGTAGCAGCCACTGTGTCAATCCATTTTGTTGAG
GGTCTTCCTCTATGCTGGACGATTTACTTTACTAAGGCAAGATATCTTTTCCAGGGATGT
GTCCCTTCTGATAACCTGTCCAGCATAAGTGAAGACAAAGTCTTGCCATCCTTGCTTCTG
AGGTGCATTCTGGCTGTGCTCCTTCCAAGACAGATTACAGCCTAGGAAACCCTATGGGGT
AGTTCTACTTCATCACGTAGGGTCGCCATGAGCCGGCACCTAACAACAACAACAGACATG
TCATAAAGTCCCAGAAAATTTCAAGATCCCATTTTGGTTGTGTTAGTTCATTTTGCCTTT
TCCTGACTATAGCAGATGGATATCAAGATCAGAATTTCTGAGCTTCATTTCAGTGGTAAC
TTCTAGTCCTATTTTGGCATCCTATTCACAAAAAAAGGAGCCCTGGTGGCGCAGTCGTTG
TGTGCTTTGCTGCTAACCAAAAAGTCAGTGGTCTGAACTCACCAACTGCTCCGAGGGAGA
AAGATGTGGCAATCTGTGTCCATAAGGATTTATAGCCTTGAAAACCCTATGGGGCAGTTC
TAGTCTGTCCTATAGTGTTACTATGAGTCAGAATCGACTTGATGGCAATGAGTAGTCCAC
AAAAGTTATACAATAGAAAATAAAACTGAAAATGAGAAAGCTGGGTGAGGTTTCTGACTA
GCCTGGACTCTGAAGTAGCAACCTGGCACCACGTGGAATACCTGTAGAAGCAGTGGGAGT
GGAGTAGCAAAACCTGGTTGAGATAAAATAACTTCCCTGCTTCTCTCACGCAGCCTTGGA
ACAAATTTATTGCCTTGTAGTTTTGTACTTATGCAGAAGACTTTAAATATAGACCTGTGC
AACGGTTTCCACTTGTCTCATCCAGTCAGCACTTGGGCGACCTGAAATCAAGCTCGGCCA
CTTTCTGTGTCACCACATGCAAGTCAGTTAACGTCTCCGAACCTGATTTCTCTTCTCGAA
GAAATGGAGCTAATGATATTTGCCCTACCTAGTTTGCCTGTTGTTATAAAGATTAAATGA
AATCACATAATGAGGAAGCCCTCTACAGGTACAAGCTTTAAGAAGTGATTGTCATACGTA
TCCTAAGGCAATTCCCCAAATCAATTAATTGTTAGCAATGAGTTGACTAATTGTTAGCAG
TGAAGACTGATTCCCAGCAATTGTTTGCAGTGACAAAACTTTTTAAAAATTTTGTTGTTG
TTGAGAATATACACAACAAAACATATACCAATTCAATAGTTTCTACATGTACCATTCAGT
GACATTGATTACATTCTCTGAATTGTGCAACCATTCTCACCCTCCTTTTCCGAGCTGTTC
TTCCACCATTAACATAAACTCACTGCCCCCTGAGGTTCCTATCTAATCCTTCGAGTTGCC
GTTGTCAATTTGATTCCATATAAACCCTTTGCCATCGAGTCAATTCCAACTCGTAGCAAC
CCTATAGGTCAGAGTAGAACTGCCTTATAGAGTTTCCAAGGAGCACCAGGTGGATTTGAA
CTGCTGACCTTTTTTTTTTTTTTGGTTAGCAGCTGTAGCACTTAACCACTACGCCACCAG
GGTTTCCCTTGATTCCGTACAGATAGATCTTAAAGAGCATAATGCTCAAGGCAGACATTT
TCTCCTAGTTAAGTTAAATTATTGTTTGGTTTTAAGAAGACGTTGGGATGTTTTTGGTGT
AAGGCTTAAAGATATTTCAAGGCAATAATTTCAGGGGTTCATCCAGCCTTCATGGCTCCC
GAAAGTCTGGATTCCATGAAAATTTGAAATTCTGTTCTTCTTTTTCCTTCTTTTGATCAG
GGATTCCTGTAGCATCCTTGATCAAAATGGTCAGTAATGCTACCGGGCACCATCCAGTTC
TTCTGGATTCATGGCAAAGGTGGCAGTTGTTCATGGAGGCCATTAGCCACACAGTCCATA
TCCTCCTCCTGTTCCTGACTCTCCTTCTTCCTTTGATGCTCCAGGCAGAGACCAATTGTA
CCTTGGGCAGCTGCTTGCAAGCTTTTAAGATGCCAGGCACCACACAGCAAGCTAGGAGGT
AGAACAAAAGCACTGAACACATTCGTTATTAGGCCAATTAACTGAAATGTTCCATGAAAC
CCTGACTCTAAACCTCTAAACCAAGGAACCAAATCCCATGAAGTTTTTCGTTGTATATAA
GCAGCCTCAGCAGTTGCTCTTTTTTTTTTTTTTTTTTGTCATTTTTGGAAATATATCTAT
CACACAGCTTTTGCCAATCCAACTTTTTATAGGTATATAACTTATTGACAGCAATTCCAG
CAATTGGCTGTGCAACCCTAATCTTGATCAATGCACTTTTTTTCATCATCGTTAGCCCCC
ACTTTCCCCCCCTCCTGCCCCTGATAACCACTAATAAACTTTGGTCTCTTTTCTTGTGCG
GTGACAAAACTTTTAATACTCTTTCTAAAAAAAAAAAAATAATTTTTTTTTTTTAAACAA
CGTTGAAATGCGTATAGAGTGTATATCCTGTTAGCAGCTGTAAGTGTAGCATAGTAGACT
TTGAGTAAATTATTAATTTCATGGCCTGAATTTATGAGAACTCACTAGTTCTACTCTTAG
CGTCTATTTATGTGTCTTTGTATGTGTGACCAAAAAAGTTTCTCTTATGATGGTGACAAA
TGGAAGTTCTGCTATGTATGAACTGTTTGCACTGGTCTTTCCTTTAGAGTTAAAACTGCT
TGTATTTTCTGCAAATCTTCAGAAAGTGAAGTCCCAATTTAAACATCTATGAGCCTTTAA
TCTACGGATGACAACCCCAGTCATAGAGTTAGCAGGCCGGCAGCATCTTTCCATAGGCCA
TTGAGTCACCGTCCTGCTAGGACTCATAGTAGATTTCGGGGACCAGTTTTGTTTGTTTGT
TGTTGTTGTTTGTTTAACTCCCGAAAGGGTATGTTGTTGTTTGCCGTGGGGTCAGTTTCG
ACTCACAGTGATCCCACGTGACAGAACTGAACTGCCCATAGGTCTCCTAGGCTGTAATCT
TTTTAAATATTTTATTGTGCTTTAGATGGAAGTTTACACGGCAAATTAGATTCCCATTCA
ACAACTCATACACAGATTGTTGCCTGACATTGGTTATAGTCCCTGCAATGTGTCAGCACT
CTCATCATTTCCACCCCGCCTGCCCGTTTCCATCTATCCAGTTTCCCTGCCCCTCCTTGC
CTTCTCGTCTTTGCTTTTGGGTAAATGTTGACTGTTTGATCTAGTATAGTTGATAGTTTA
AAGGCGTACGTTCCTCCCGGGTGTTATTGTTTATTTTATAGGCCATTCTATTATTTGGCT
GAAAGGAGACCTCTGGGAGTAGCTTCAGTTCCAATTTGAAAGTGTATCTTAGGGTGCTAA
TTAGACTGTATCTTTACGGGAACAGATTGCCAGGTCTTTCTTCTGCAGAGCCTCTTGGTG
GGTTTGAACTGCCAAAGTTTCCATTGGCAGATTAACCGTTTTGCCACCAGGGCTCCTTTA
GGAAGGGTAGAGAGAGCAGTAAAATTCAGCTCCTTTGGTTTTGGCCTAGATTCGCGAAAA
GTGAGTCATCAGTTAGCGTTGTTACTAGCAAATGTGGAGTTTTTGTATTACTTTACATGG
AGTTGCCAGACTACTGGGTTTGTAGAAGTAGAGTAGGAAGTAGAAGGAGCTCTGTATTAG
GTAGTTACACACACTCACACACCCAGAGGAAATGCGTATTAGAGCATTAAATTCCGCGAG
GCCGGAGAACTGTGACAAGGTCAAAGCTTGACCTACGTTTCCACTGGAATTGTTTTGAGG
GCGCATGGAGAAATGTGTGTTCTGTAATGAGACAAAAAATCAACAGGAGCAGTAATACTT
TATCACAGAATTATAGCTGCAGTGCTTTAGTTCCCACGCGCCCCCCGCCCCCCATTTTTT
TCTAATCTCACACTCTATTTTCCCATTGATGGGCTCAAGTGCACCACCCTAGCTTAATTT
TAGATTCTTCTGTGATCTTTACACACCTACTTTTATTTCTCCCTGAAACACTGAAATATC
CCGATATTAAAATCACTCTTCCGTGAATAGATGCTTTAAAAACTCGTGCTGGAAATTCAG
CTGAGTTACCCATCCCCCTATCCATGCTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTAACTGAGTTACTAATGCTTAGTGAAAAGAAGAGAAGTGAGTAAAC
TTCAGACTTATAGTACCTGACCGTAGTTTTCACGAGGCTCCTGGGTCAGACGAAATAGCC
CAGAGAATGCAGTTTGAGGATCCATTTCTAATTTCTAGATCCTGAGATGCTGGCGGGGCA
AATGGAAGCACCTTCAATGCATGGTGTCCAGGCTAAAAAATGTGAATCTTTACAAATGTT
TAATTCCTTTAAAATGAATCCACTTCTACCTAAAATCAAAACAGAAAAACAGATTCCCTG
GACTGGTTGAGACTGGAGGACTCCCCGAGACTGTTGCCCTGGGATACTCTTCAAACCTTG
AACTAAAACTAACTCCTTGTAACTAGATAACAAATTGGCTCAAAAAATGAGTATCACCGG
TAAGTACTATGCTCCTTAAAAAAAAAAATGAAATCACCTATATGAGACCAAAGGGTCAAC
AATGACTTTAAAACAAAGCTGAAAAGGTAAGAGGGCAGGGCAACTAGATAAATGGAAACA
GAACAACCAGAACCAAAATAATGAGAATGTTCACACATTGTGAAAAATATAATTAATGTC
ACTGAACCACTTGTCTAGAAATTGTTGAATGGGAACATAAACTGAATATATTTTATATAT
TATTTAATATAAAATATTTTAATGAAATATTATTAAAAATTAATCTCTGCAAAATTAAAT
TTTGCTGGAAACCTCAATCAAAGGTTGCTTATTCCAAACTATTAAATCAAGCACAGAATT
CAGTTTTTTTAAGTTGCAGGTTGATGTGTTCACGGTCATGTGCCATGAGGCGCTCACTGT
GACTCCTGAGTGGACGTGGAAGAACTCTGTAGCTTGTTATCTTCTGGCTGATGTGAAAAC
TTTGATGTTCACATTTTATTTGAGGACTTCTGCTTTCTTTCTCTTCTTTCCTCTTTTATT
TCTTTTCAATTAGGGAAAATAAAAACCAATGCTGGAACTAAGACAGGCAGACGTCCTTGA
CAGTTTCTTTGGGTGTACCTTATAAAAGAAATGATTACAATTTCAAACACGTGTTACAAC
TCAAGTTCATGGCACTTCCTCTTTTAAAGTCTTAAGTTGGTATTTGGTGCTCCAACTATC
ACGCTATTTTGATTTTTTTTTCTTGAAACGAGAACATTTGATTATGAGCACTAGGGCACA
GGTTTGTCCCTTTAACTCAGAAGACTCATGCGTTGAGACCTACTATCCTTTGAGAAGCTG
CTAGAAGAGCCCAGCTAAACTGCACTGACTCGCAGTTCACACTTGAACTCCTTTCTCTGA
CTCTATAAAATGTATACTTTAATTTTCAGTTTTTTTTCACAAAAATATCTTCTAATTTAT
TTTAAAAAACGTATTATCTAGAAGAAGAGAAGCACTCTAGAAATCAGAGATAATTTTTCA
TAAAGCTGATTACAGGATATAAATTTCACTTGACTTTTAAAATTTATTCTCTCATAATAT
TTTCGTTCATCAATCGTATTTTCAAACCACATAACACTGTATCAGTTGAAAAACAGCTTG
CAGCTTGTGTAAAATACGATCAAAGAAACTAGCATTTCTATATAGAGTAACATTTAGCTG
ATGGGACTCATCTCTGCCAATTAAAACGGTATTCTCATGGAGAAAGCCAATTCAAAGAGT
AAACAGAACTTTAACAGTAGGTTTATGCTACCTAATTTAAAGTGTTTTAAGGCAAGAAGC
AGTTTAGCACAGGGATGAAGAACACAGGCACTGGAATAAGACAAACCTGGGCATAAATTC
TGCTCAGGTACATTTGAGACTCTGTGTACCTTTGGGCAAGTCACTTAACCTCTAAGAACC
TCAGTTGTCTCTCTGTAGGAGACATAATAGTACCCACTTCGTAGGGCTTTGGGGAGGACT
AGAGAGATAATGCCTGTGAAGTGCCACAAAGAAGAACCCAAGAACAAAGAAATGATGTAA
ACGCCCATCCATGCCGTTTTCTGCTTCAATTTTAATAGGGACTTTGTGGAGATGAGTTCT
GGGACAGGTCTTGACTATAGGTAAGGCATCAGATCTGGAAGGGGTTATTCCAGGCAAAAG
AAGAGAGTATTGCAGACGGCCTGGAGACTCTAACGCGTTCATATCTCTCCCTGGTTCTTC
ATGTGCCCTGGATTCATTTCACTTCCGGTAGCTCAGTTTCATTCTCTGTTTAAACAACAA
TTCTGACCTATCTCACTGTTTGTTGGTCTTGTAAAATGGCTATAGCCATTCCCAGCTTAC
CTGCACAGGTCTTAAACTTGGTGAATTGGCTTTTCACTGCCAGGAAACCCAGCTTTTGCT
TAACTTCTTGCTATCAGTTGATTTGAGTTCAGTGAAATAAAAAATCTTTAAACATTTATT
TTATTTTTGGTGAAGATACAGCAGAACATCCGCCCAGTCAACACTTTCTACATGTACAGT
TCAGTGATATTCATGACATTCTTCATGTTGCGGCACCATTCTCACTGTATTCTCTACTCA
TATTGTTCACTACCGTTGATTTAGACTTACTGCCCCTAAACTTCGCATCTATGCTTTAGA
GTTACTGTTGTCAATTTGATCTCATACAGACAATTCTTTAAAAGAGAGCATGGCTCAAGG
CACACAGAAGTCAAAATAACTTTAATAGAAACCCAAACACAACTTACGGATGCAAGTCGC
TGCTGCCCGTAATTTCAGACATCGTCAAGCCAAACAGAAGTGGGTTTTTCTTTTCTTTAC
TGAGCAGGCCCATTAGGATTTAAATATTTGAGAACTAATTTCATAAGCAAAGCAGTGCTT
AAGGTGAGAGGCGAGCAGTGAGGGAGGGAATGTGTAGTCTCTCTTTATGCTTCCTGGGTC
TGAACCTGAGGCAAGCTGCTTTGAAGCATTTGAACCCGAGTTCCTCAAAGTAATCAGTCT
TTTTTTTTTTTTTGGTGAAAGTATACACCGTTTCAACAATTTCTACATGTACGGTTCAGT
GACATTGGTTACACTCTTCAGGTTGTACGCCCATTCTTGCTATCCTTTTCCACATTATTC
CACCACCATTATGTTCAGTTCACAGCCCCTAAACTTCCCGTCTAACCTATGGTTTTGCCT
TTGCCAATTTGATCTCACATTGATAATTCTTTAAAAGAGCACAGTGCTCAGTGCAGACGT
ACTTTACTAATTAAAATCAGCTCTTTTTTTTTTTTCATTTAAAGAAGACTTCAGGGGATA
GTTTTGGTTAAAGGCTTAAAGATTATCTCAGGGCAATAGTTTTGGGGGTTTATCCAGTCT
CAATGGCTCCAGAAATTCTCCACTGAGAACCTGAAATTCTGTTCTGTATTTTCCCCCTTT
ACCAGGGTTCTTCTATGGAATCCCTGACCAAAGTATTCAGTAATAGCAGGCAGGCACCAT
CTAATTCTTCTGGTCTCAGGGCAAAGGAGGCAGTTGTTCATGGAGGCAACCAGACAGATA
CTCAATTTCCTCCTCCAGGAAATCAGTCTTATTTGATGATGTCTTTCCAGGTGGCATCAG
GGTAACAGTTCCTTTCACGTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGTTCTACTCTGTCCTGTAGGGTCGCTATGAATCTGAATTGACTCGATTGGC
ACTGGGCACTGGGGTTTTTGATCTGTAGATAAAACAAATACCTTAGTTTATTGGATAAGG
GAACATAAGTGGCTAGTACATTATTTGTTGTCGTTGTTGGGTACCGTCGAGTTGATTGCA
ACTCATAGCAGCCCCATTTGACAAAGTAGAACTGCTCCATAGGGTTTCCTAGGCTGTTGT
CTTTGTTGGAGCAGATTGCTAGATCTTTCTCCCATGGAGCTGGTGGGTGGGTTTGCACCA
CTGACCTTTGGTTAGCAGCTGGCACTTAACCACTGTGCAGCTGGGCTCCTTAGCACATTA
TTTAGCAACTCAGAAAGTGTTAGGATCCTTCCCAATAACCGAATGACTTGTCAAGTTTAT
GTTCATCACCTTGGAGAGTTCGTAGTCACATTTCAGCCTCCGCATTAGTTTCGCCTGTCA
GTCGCTCTGTCGTTATAGTTCAGCTAGGACCCTCCATTGGCCTGAAGGTGTCAGCTCAGC
CTCTATGGTTTCTTGACTTGACGGTGACCTGTGTTCTAGGAGACAATCTGTGACGATTTA
CAAGTAACTGGATTTTTTTTTTTTTTTTTTTCAATTTTAAGTATGAAAAACTTGCTAGAT
TTTTGTATTTTTTTCATATACAGTATTTGTTACTCTTTTTTTTTTTGTGCAAGGTTGGGT
TAAATTTAAGACCTCTTGATAATTTGTTTCATATTGCTAATTTTTCTTGTTAAATGAAGA
CAATAATGCAAGTCTTTGTAAACCATATAAGTTTTCCTTACTTCATTACTTTCTGAGAAA
GCAGAGTTTTGGAAAATGTCTTCAAGTTCATAAAAGCTTGAGCACTAATGTTTCCTTAGG
GGCTGACTTGTCAAACAGCAGTACTAAGATCTAGTGAAGCAGTGTTGTATTAACTTGTAA
CTTCTCTCTCCATTTTCTAGATTAGGAGTTAGCCGAGAACTGAGAAATAAGTAATTCTTC
AGTAACACACGTGGCAATCTCAGTGAACTTTTCTACCTCTGGTCTCCTTTTAGCACCATT
TGGAGCCGCATACCGCATTCTTTGAGCATGTGAAAGAAATAGCTCAGCCAGCCTCCCTCT
TTGTCCTTGCTCAACAGCAAATGGCATCCATGATCTCTCAGGTCACCCAAACAGAAGCAA
AAGCCTGGGGCCTCACCTGTTCCTCTCATTGACGTGGAACTGGGCACTTCATGTAATGTA
GGACGTGCAGTCCCGCATCTCAACTTTATGTCTATAATTGTTACGCCAGCAGCACGAGAT
AAATAAGCCTGAAACCCTCATACGAGTCGGATGTCATAGTCCCCGGTCTCCTGAGGACCT
GCTTTCCTGTTATTTTTCCATTCTTGCTGGGGCTCAGCAAGGCGAGAACCTTCTGGTAAC
CACCACCACTGCGTATGATCTTTGCTGAATGAATAGAGCAGTTGAATCCTTTCAACCCTG
AGAAGTAGCTTAAGGATGTTCGAATAGTTCTTTGTCCTCTTGCTAGCTCAAGTTTCATTT
CTTTTGCAGACTGCTAGCACCTTGATTGTGGCTGACTCTAGAATTTCTGGCATCTACAGT
TGCAAGGCTTCCAATAAAGTAGGGACTGTGGAAAGAAACATCAACTTTTATATCACAGGT
AAGCCACGCATCCTACACCCACATAAACAGCCTGGTGACCCCAGCCTCTCTTCAGTTTTG
TTTGCTTTCAGTTCACTTATGCTTGAGTGATTTTTTTATTTAAAAAAAAAAAAAAGATAC
TTAATAGGATTGTCAAACTTTGAGTACCTTCATCCTTTCTCTCAGGAATAGAATTCTACA
GCATCACTGGCTCTTGCAAAGAGTTATTTCCATGAATTCTCTTAGAGTTATTTGTGTGTG
CCTCCCTCCCAGGGTGGATTGTGAGTTTGGGATCATGTCATGTTCTTGACTGAACTCCCT
TCAGTCCTGAGCATGGTATCTGGTACATAGCAGTTGTTCACTAACAGTCAAGGAAATCAA
CTAAAATTCAGATGATAATGTGATTTTTTTTTTTTTTAACTAAAGCTAATTGTTTCACAA
CTTAAGTAATTTCAACTTTTGGGGAATGCGGCTCATCTGTGGAAACCTAAAGCTGGCATT
GTTAGCAATAATAAATGTGCTGTTTTCTGGTAGCATTTAAAAACTTGAGCTTTAACTGTG
ACAGTCTTTGCAAATCTTAAAAACTCCAAGGTACACAAGTGGCCCTCCCTATGTCCCTCC
ATGGGCACAGGAAGGAAGTAAGTAGCTCAAAGTATAAAAACAATTGCCTGGCTCCATACG
CCCCCAATTTCTGAGGAAACCTGGGCAACCTGCCAACTCTCTGGAAACTCTGCACTGCAT
GGGGCAGGCTGCAGCCGTTGCCTAGAATTCTCCAGAAAGAAATAGGAAAGTCTGGTTGTA
TGAGGCATGCTGGTTGTCAGATCACTGAGAGGCCCTCGGCACGTTAGCCCCGCCACAGAG
AAGCTGTGCCATGGGAGACACCCGTGAGCGGATTCTCAGAGAACGTCAGCACTGGGAGGG
GCATGAGAGGTTAGTCAGCCTGATAGCTCCCGCACGTTACAGATGAGGAAACAGGATTTT
GAAAGGTGAAGAGGGACATAGAGCCACTCTAGACCAACTCAGTCCCCTGACTGAGTGCCC
CACATCAGAGATACGTAAGGGAAATTATCTTGGCATCCACTCCACATAGTAAAATCCCTT
TATGTAAAGGAGGATTCAGGTAGAGATTTCAAATAGATTGGTTTTCTAGTCAATCTCAGA
TGATTTGGACTAAGTTAAGTAAGTCCAAAGGTTTGTGTAGTCCTTGTATTTAGTTGGAAA
TGAGTTAGCATCTAAATTGATAGCCACCGTACATCTAATTCAGAGCACACAACTCCTGTT
CTGTTCTGAAACGATATCCAGTAAGTTGGCGAAAGTTTAAAGAGCATTAATTATTAAGAA
GTGTAATTCACCTCTGTGTTGGACACTTGATATCACTGTAGCCCTGTCTTTCCAGGAAGA
CAGTTCTAGCAATGAAGAAACAAAGAAGAAACGTTAACTCATGTATATCCTGGCATCAAA
ATGTATGTGCAAAAAGTAATGTCATGGATATTATCCTTTCAATGTGTAATCAGTATTTTT
TAAAAAACACACTGCTTCCTTCACGCTTTAAATTTAAGTTAATTCAAATAAAATAAAATA
AATTCAGTTCTTCAGTAGCATTAGCCATATCTCAAGGGCTCAGTAGCCACTCATGCTGTG
AAGCTTTAAGCCTCTGAGGAGGAAGCAGGACTTGAGGTGGTCCTTCGCGGGGACAGAATT
TGAATGGGTGGAAAGAAAAGGACAGGCCTGCCCTGAGACTGTCAGAGCAAAGGCGAGAGT
ACCAAGGGAGGCCTACAAACTATATGCCTAACCACTTACAAGTTCTAAATTAAGCTAACA
AGCTGTTAAATATGTGCCAATTTCCTGTAAACAACTATACCTCCGTGATGACCTGAAACT
ACTACCCTACCCACTGCCGTTGAGTCGATTCCGACTCATAGCGACCCTATGGGACAGAGT
AGAACTGCCCCAGAGGGTTTCCAAGGCTGTAAGCTTTACAGAAGCTGACTGCCACATCTT
CCTTCCAAGGAGTGGCTGGTAGGTTCCAACCACTGACCTTTCAGTTACCAGCGGAGTGCT
GAACCACTGTGCCACCAGGGCTCCTCTAATGACCTGAAAAGCTGGGTACAAATTTAGAAC
TCTGGGACTCCTCAGAGTTCCACAGCAGCGTGGGACAGCACCTGGCAGTGCAGAAGGAGC
TGACCCCTGGCTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTC
CCCAGGTGGGATGTTCTCCCCAGACCACACACCTTTCACAAACAGTCTTCCCTCGGCCAC
TGCTGGGCCCTGAAATGTGCCACTGAGAAGCAGCCTCACCTCAGGAGGCCAGGCTTAGGG
ACAAGGAAAGAGACCTGGGCATACCTAGAGGCAGGCTTGGGATCATTGAACAGGGAATTC
TGGAATCCCAGATACCCTGACCACAATATGGAAGTGGAGGAGGCATAGGCTCTGGGTACC
CCACAGATTCTCCCTACTGTGGGGGAGGGGAACAGCCAGCCAGAGCCATTTAAAGGGCCA
GGACAGGGACCCCTCTTGCCTCAGTTTGAGGGAAGTACTGGACGCAGATGTGCTAAGAGT
GGAGGAACATTCATGATCAACTCCTTATTGTCCAGAGAGTCCCCAAGAGAAGTTAATTGA
CAGCCACAATGAATTACAACACCACATCTGGCCTGTCCCACTGAGGTTTTAGTTACTGCA
TCATATTTCTGCACATGATGCTGTTGTTGAAAGGCCCTAGCTGATAAAGTTGACCACCTG
CTGAATTCAGGCAGAAATCTCCTCCCATCTCACCATCACAGTCAGGGACGAGTTATCCAA
TAGGCAAGGTAAGCACGGTGCTTATCTTGCTTCCCAGATCATCTGTAGTGAGCAATTTCA
CTTTTTTGTTTTGCCACATCAAAGATTCTACTTTTAGGTATGGCTGGCATTTCTCTCTCC
CCCAACCTCAGAGCACCTTCCTATAGGATCAAAGCTTCTTTTCAATTAACAATCCCTGAC
AGGGGCGGATGACCCAGTAAGCAAGGTAAGCATGGGTTTACTTGTGCTTAGGTACCTACA
TGAAGTTGTTCACTACAGATGATCTAGTAAGTAAGGTAAGCACCGTGACTATTGGGTAAT
CTGTCCCTGACACAGTATACGTTGTATAAGCTGTAGAATGCTTGAAATTTCTAGATCTCA
AGGCTTGCCCATAGAAAGGAATGTGAGCATTCAATTTGAACATACCTACTTGGAGAAGCT
CACAACACTTTTCCTCTGGAAATTCGAGAGCTTTACTCTTAAAACTGAACTCAAGTTCAG
CCCATCAGGCCCCTGTCCCCTGGACGAGATGTTCTCTGAATTTAAGATTCTCTACTAGTT
CTGAGAAGTCCCGTTTTTGATTGCTGAGAGTCGGGATTTGGCTTATGTTCATGTTTTTAA
ACTAATTATTATCTTTGTTTTTTCTTCACTGAAATCTTTGTCCCAAGATGTGTTCTTCCT
AGAGTGGAGACTGAATACTCTCAGGAATGTGGTCCCTTACGTGTTTATTTTCTGAATGAG
GAATGCGGATCGGCTCAGTGTTTGTACTTGACTCAGTAGGGGGAGTGCTTTAAAAAGTGC
CTCTCTAAAATTCAACTGCCCTAAATCAAAAGGTCTCGATTTGGATCTTTATAAAAGCTC
ATTTCAGTCATGTTGCCCTTCCTTAAAACATAGTCATCACTTGGAATTGCCTTCCAAGGT
GGTGAAACCCGGTTGACATGGCCATCCCAATCCTCCACTGGTCCTACTAAACGCTGCCAT
TTGCTTGTACACAGCATCTACTTGAAAGACACAAACGTCCTACCAAACACTAGCTTTCTT
TTCAAAGAATATGATTTCCACACTCCAGTGGAAATACAGTGCTCACGGAAATAGTGTTCT
TATTTCCACCTGACAGATGAGATCTCTTTCATCCATTTGAATTTCTACACTTACGTCTTT
CATGAACTTAATCCACATGTGTGACCCAACATAGTCAAAATATCTGCCCTCCCAATACGC
ACTTCTGTAAGTAGGTTACTTTCACCTAGCCCTGGGCTGGCTATCCTTTTTGAGCCAGGG
TGGATTCTTTGCCATGGCACCTCATCAGATGCCAGGACTGTGCTATGGGCTAGCTGGTGA
TGGTGATGATCGTGCTGAATCGCCAACAGATACCTAAGTGTAGGAAGAGTTCTTGTTTTC
ACTTCGAGGGTTAGAAGGCAATTCTTTCTTGGGTCTGCTTTTGTACTCAGGCAAAAAAAA
AAAAAATCTACGTGAATTAGGGGAAAATCCTTCTGGATTCATTAAATCGCTTGGGACATT
TTATTTATCGTCTTTCATGGATCAGATGAGGCTACCAAGGGGGGCTATACTGAGAAATAG
AGAATCATTTCAAAAAGGCTGTCTGGTAAGATAAGTCAGGTTAGTACAGTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGAACAGCATTGCCATTATCTCCCTGATTT
CCCAATGTCACTAAATGCATTTATTTTGAGATTCCTGGTGGTGCTTGGCAAAGATAAATA
AAATCTTCCATCAGGAAACCTGTGAGCTATTTCCAGAGGAAGTTTCAAATCACTAAAGTA
AATAGAAACTCTTCGACATGATCTCGGTGGCGTTTCTTGGGCTCACTTGGGTTCTGACAA
CCAGAATGAGAACTCATAAATGGAAAGGCTGTGGTCTTTTAAGAAATGATTTGATTGCAA
CCAGGCATGATACTTCTGCTCTGGTGCCTGTGCAGAAGCTGCTAGCTGATGTCTTACTCC
TCATGCCTGAAAATGTCCCAAATAGAAAAAGATGCTGAAGTAGAGCAGCTATTTCCGAGA
CCTTATGATTAAGTGCTTCGTTGCTAACTGAAAGGTTGGGGGTTCGAACCCATCCAGCAG
CTCCATGGGAGAAAAGACCTAAGGCTCTGCTTCCATAAAGATGACAGCCTAGAAAACCCC
ATGGGGCACTTTTACTCTGTTACATGGGGCCTGCTCCAAGTGGAAATCGACTCAATGACA
TCTAACAACAACCACATTGTTGTGTTAAAGATGACTGTCAGCTGCTCCTGCATCTTCTGG
CACATTCTTAGATTTTCACCTTAAAAGCAGAAAAACCCCTACTGGTCTCTCTCTCCCGGC
CACTGAGAGCTTCATAAGCCACTGTTACCCACCGCTCCCAGGTTTCAAGTGAATACTTGG
CATTCCTTCAGACGTGACACTTTATAATAAAGCCAAAGGCCAGCAAAATCAGAAAAACAA
GCAAAGTGAGATTTAGGAAAAGAGTTGATGTGATATCTAATTTTGGACTATTGTCCCCTT
AAGGTTTAAAGGTTTCTTTATAGCTTTGTGTGCAAAGGATAATAATAATAATAATAGCAT
AACATAGTGCTTTTCATCTTCAAAGTACTTTGTAAAATGTTGGCCCAAATTCTTTGCGCA
AATCCAGATACGCCACCAGTAACTAGCAATAGGAAGGTTCTGAAAGCAGGCCTGTTCAGG
GCCAGTAACTGATGATTTTTTAAAACCCTCTGGTGAAGCGGTCCAGAGTAACAGACTGAG
GACCTCTCAGCCCAAAAGTTAAATGCTCCTGCAGAGTAGGAACACCGAGGAGGAGAACTA
GGAGGTGTTGCTAGAGGCCCTTTGGGAGGCGGAGATGAGGGTTAGCTGGGAAATGACGCT
GGAGAAAATGGTCTTCGATGACAGTCACTTTCAGAAAATGCTTAAAATGTTTTTGAGAAC
AGATTTGATTTATTATTTTTTTTAAGTTGCTTTCCACACACCCCCAGCCCACTGTAGAAT
CTGGCAACTCTTCCAGATTCCTTGTCTACATTTTCAGAAGAAATCTTTCCTGTTGTCTGT
CCCAGCAAGTAAACTGGCTCTTCCCTGGCCCACTGTAGCAGCAAAGACCAGTGGGAGTCA
TCTGAAACAGCAGTAGGAGGGGCTGGCCATCAATCAGATGGCAGGAAATTTAGAAAATCA
GTTGTGTTTTCACTGGAAAAGTTAAGAACTAAAGCAGGGTTGACTGGCATCATGAAGTCT
CCTAGCACTTCCATGGGACTTCTTATTCTCTTGCTCCCACTCATCAACCTATCCTGGATA
AGTTTGACTTAGGAAAGTATCTTTGGATTTTAACACAAACAACTCTTCACTGTTTTGCCC
ACTTGAAATGCCCATTTGCTAGGACGAGTACTGTTATGTGATAAAGAAATGGGAACCATG
GTTATCACCCCAAGTTAGGAAAAAAAAAAAAGAAATTCCACTTTGAAGAGTAACTTTGGG
CAATGAAGAAGAAGTACCATCCTGGTATCTATTCTATTTTGCATTTCCTGCCTCACTTCT
GAGGGAATGGATGTCGTTGGTCTCTGCCTGCTGTGTTTGATCAGCTTCCCCCAAATAAAA
AGACCAATGCTCATCCTTTTAATGGTGAGGCTGAGAGGATTTGTGTAGGAACAGCTCTTA
AGAGCCCAGAATAAGGGTCTCATGGTGAGACACTGGTTTTTTTCTGTGCACTGAAGCTCT
TGATTCTTGTTTTATAGATGTGCCGAATGGATTCCATGTTCACTTGGAAAAGATGCCCAC
GGAAGGAGAGGACCTGAAACTGTCTTGCACAGTTAACAAGTTCTTATACCGCAACATTAC
TTGGATTCTGCTGCGGACAGCGAATAACCGAACAATGCACCACAGCATTAGCAAGCAAAA
AATGGCGGCCGTCAAAGAGTACTCCGTGTCTCTGAATCTGGTCATCAAGAATGTTTCCCT
GGAAGACTCAGGCACCTATGCCTGCAGAGCCAGAAACGTATACACAGGGGAAGAAATTCT
TCAGAAGAAAGAAGTGATAATCAGAGGTGAGCACTGCAACAAAAAGGCTGTTTTCTCTCG
GATCTCCAAATTTAAAAGCGCAAGGAATGATTGTACCACACAAAGTAATGTAAAACATTA
AAGGATTCGTTCAAAAGTAACAGTTGTCTCATATCACCTTGATTTATTGTCACTGTTGCT
AACTTTCAGGCTTCGAGGACATGCTCCTCCCAAAATGAGTTTGGAGATAGGAGTAATAAT
GAGACCCCGAGGTCCCAACCTGTGGGCTCCCTGCTCAGACTGAGGGGTCTGCTCTCTGTG
ACCGACCTGGTGCGAGTTTGGGTTTGGAGGATCCCTGGGCTTCATTTCTGTGTCTGCTCT
TTGCTGTCTTCTCCTGCCTGGTAAACAACAACTGGGGACTGATCCTTTTCCTCCCGCTTT
GATGCCAACCTCTTTTTATTGTTACGTTTCAAAGTTGCACAAACTGAATAATTTCAACAG
ATTGCTGGTTTCTGCCAAAGATGGACACTGAATCAGTTCATTTTCCAGCTCAGGATGAAT
CCAGTTGAATTTCGAGACTGTCGGGACCTCTGCCTGGTTTTATATTGTACTGTTTCATCT
GCTCTTGATTTGTAAATAGCACCTGGATAGAAAGTTCTAATGCTTATTTATTTGAAAATG
GTTTTTGGTTTTTTTTTTACATTAAGCACGTTGATCTGAAACTGGAGCTTCTAAATTGGG
CCCCAGTGGGGCAAGATGTTGGTGTAACTCAGAAATGTCAAAGCTTTATCGCAATCTGAA
GTATAAAAGTCCAGCCAAATCAATGCCACCTCCCTCATCTCCTGCCATTCTGAGTAGCTA
GCAGAGGGGTCCAGTGAAGGGTTTCCTCCTCCCGGCCTCCGCCAGACTATGTGGTTGTTC
ACAGCACCCGAAACAAAGTGGGCCGTGCCTTGATTTTCAATATTTTTGCCCCTTGTCATT
CTCCTGAAGGACTTAATCATGTTAAAATGGTGACATTCGCAAACATACCACACTCAGTTT
ATCCAGGAAACTATTGTGACCAGGGGTTTAATGGATTCTTCCCAACGTAAATTCACAATA
TGTCCTCTTTCTCCATATGCAAAGGTTAAGAGGATTTTCCCCCCATGGGGAGTTAGAAAT
GGCGACAGTACAGAAGCGGAATCCAAAGCCATTTAAAAATGCACACCATGGAGAGAGATT
TGTTTGAAGCTTGCGTTTGAGGAGGAGGTGACTTTTTCACCAATTTCATACGCATTGTTA
CGTTGTTTGCATTTACGATCAACCATTACATGTGCCTTCCTTATAGAAAAACTATAGAAA
ACGAACTATAATGACCAAAATAGCCATGCCTGCAAAACAAAATGGCCAGGCAGTTCACTG
GGAGGTGACAAATAGGACAGCTTTTCAGGCTTGGGAACTCACCAGACTATTTCCTCCTTT
AAGTAACAGACTGTGTCCCACGGCTAAAACTTGTTTTTTCACGTGGGAATTGCTTTTTGT
CAAGTGTGAAAAAGTAAACAATAGCATTTCCCCAGAATGCCAGTTTTATGGAGCCCCAAA
TGCTCTGAAAACAATTAGTAACCTGGAAGTTGTCAACCCAGAGGAAAGAATAATCAATTG
TATCTTGAAATTTTACCTATAGCTCTTTGGCCTGGTGTCTTTGTTCATTATAAGTCAGCT
CTGTGTGTTCCTTCAGGAACACGGGCTTAGGGCCACAGAAGCTTGGAAGCCTTAGTTTTA
ACTTCAGCTAAAAAAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCACTTGGCTAAGTTTGAGAAATCAGCTATCTGCTTCCAT
CAAGCAACTTACGTTTTAAAATGTGGTTTCAATGTACCTTTCTTATTTCAAATGTCTAAA
TAAATAAAATACTGTGATGTATAAAGTCGAAATTGACAAAACAGGATTCCTTGGTTGATG
AATGTACAAAACTGGTCACTTAGGAAATGAGGCTTTTCACAGAGGAGAAATGGGTACAAA
GAAAGAACTATATAATACAGTGTGCTTCAGATGTGTCCATGTTTGCCTTATATTTAACTG
ACAGCACTGGGTTCTTCTACAGCCTTCTTGCTGCTTCAGCTGTCCGAAGTTTGTGTTGGA
CAGATAAGGTCTTTGGGAGTTCTTCATCACGTTATTGTTGAAATAAAAGGTCCTTTTCTA
AAACATTAGCGTTGTTCTCCAGTCAGGGAAGTCCATTGATGATGTTATCATTGGTAGCTG
TGAAAGAACCTGGATGTTGTGAGCCCTATAATCGGATTTCCTTTTTATAATAGGGCATAT
GGGCAATGACAGATCATTTCATCATATTTACTGTGTGGGAAACAGTAATTGTGCTAGGGG
AAGCTGTTAGAAGTCTAACCGAGTAGACTGGACCTGAGTTTTAAATGCGATTATCTCAAA
GTTGTCAAGCCACTGTAAGAGATAATGAATAGTAACATGATACTGTTCTTTATTGTCATG
TTTCATTGATATGTTTGTGGTCTCTGTGACGTAAAAATGTCAAAATTGTAATGATAAGGC
ATGTACAAGTTAACCATAAATTGAAAGTATCAACACATGGCTGCATTTTCAATGAGAAAA
CGCCGTTTGACAGAGTGAACAGGAGGCCAACACAGGAATATGTTCATGGTCCTGCCTCTT
GGGGCAAGATAGAACAGGAAAGATGTACTGGCGCAGGCGGAAGGAGAGTTGCTATCATTT
ATTCCACATAGTGTGCGAAGAAGGGTTTATAAGTCAGAGCACCTCTTTAACACTCTCCCT
GCCTTCAGATTCTCATTCTGTATAAAATGAAAGCAGACTAATAATAAGCTATGGAAATCT
GAATTTCATGAGAGATCTGTTTCCTAACAGATAGTAACCCCACCATGTTATAAAACTTCC
ACATGTTATAAAAGTTGTATGATTGTATTCTGTTTCACCTAGGATTTGTAAATTGCTTTA
GGGAATGCTAACCCTGATACCTACAGGGAGGAAAGGAGAAGGGTTTGGGGCTCAGCAGAC
CCCTGCAGGGGCCACGGAATCAAAAGCACTGAAATGTATCATCTCTGTAGCTCTGTATTC
ACTCCTAAATGGCTTTCACAGTTCTAGAACACTGAGCTGAGGAAATGAAAACTTGCCAGA
GAAAGCCTGGATAATTGAAACCAGTGATGTGTAGAACGTGTAAGTGACACAAAAACTCTT
TCGATTTCTGTTCCAGGCATTGCAACAAGGGTGGTGGGGGAGAGGGATGATTTGGGGCAG
TAGGAAAGACACTAGGAGTTGTTTTTATTCCTTTACCTTGGAAGCTTGGGCTACCAACCC
AGTACCCACCTAACTAGAATGTACACGTATCAGCAGGACTGACTTAATTACTTCGTTCAA
TAGAGACACTTGTACTCATTGGGGGCTTTGAGTGTGCTGCTGTTCCTATGTGGGATTTCA
ATGTTGTAATGTATTGCATCCTAATGTATTAAATTCATTTTGTTGTACTATATTGGTTGG
CATTTTATTAAAACAAATTGTATTGTATCATATGTGTATGTTTTAAGAGAAAATAATATA
AAATATAATATTTGTACTATTATATAGTGCAAAAACTACAATTCTGTGCTTTTGCCTCTT
GATTTCATTCTTTGGACTTGCATTTGGGAAGGGAAGGAAGGGGGGAAATAATCAATAAAG
CTTTCAAAGTTTAAGAAATTCTCCTGTTTGGTCTGCTGCCTTGCAATTAGGTTACTGACA
GTTGAGTAACACAAACACACCCTCACAAACACGTGAATGAAAATACAAAATTATATTAGC
CCACTCTTATGATGTTATATATATGTATGGAAATTCATTACAAGCCTGTCTACAAAGTCA
TGCTTTTCATTTATATCTCCTAAAATATTTAGCAAAATCCTTGGGCTTTAGAAAAGCTTA
TCCCCAGAAAAGGAAGGAAATGAGTTGGAAATTTGTAAATGTAGAATTTATTTCTTGATT
TGACTCTGTCCTGATAAATTTCAATTTATTGTCACAACTTACTAAAGAGGGAACAAAATG
TAAATCATAAAAGAGAAACTTAGGGAACAAAAAACCAATGAAAACTTACAGTTGGGTTTT
GCTCTTTTTCAACATATTTAAGATGTTGATTGCATATACAATAAAAGAATAAAACCGATG
AGTAATCACAATTCCATTTCTTTATTTACTAGATCAAGAAGCACCATACCTCCTGCGAAA
CCTCAGTGACCAAACAGTGGCCATCAGCAACTCCACCATTCTAGACTGTCACGCAAAAGG
TGTACCAGAGCCTCAGATCACCTGGTTTAAAAACAATCACAAAATACAACAAGAGCCTGG
TAAGAGATGTGTTTTTCCTTGAGTTTACCATTTCTCATCCTTTCTAATCCCCTTCTTCCC
CTAGCATTCCTGTTACCTCCTTCCAGTATATCTAGAATCATTTTCTGACAGAGTTGAAAA
CATGTGGGCTCTGGGTCATACTTACATCGACTTCCAATGAGGAATATTTGGGTGAATTCT
TATGCAGACCGTATCCCTACTCCATAGAAAGACCCTTACAGAATCTATTCAACTGGAATG
CTACTTTAAATAATGCATTCAGAAAAAAAAAATGATGAGAGCCACTTAACAAATGTTGCA
GTTCACCTTGACAACTGAGACAATGAGGAGTTCGTTTGTTTCAGGACTTGAGGTCCATCA
GAGCTTTCAACATCTGATATCTGTAATGTTCAGAGAAGTAGATTCATAATCTTTTTAATT
TTATCTATACCAATCTTAATTATTTGATAAAAATAAGAATATTTTAAATCATATTTGTCA
TATTGTTAAAAGAAAATTGAAACTAAACTAATGGCTATGGTTTCTTTCAACAAGAAATAT
TCTTAAACACAGCTCGGCTGAAACCCTTTTAGATGGCTCCTCCAACTTCAACTGAGTAGG
AATTCTAGTAACCATAAACACTGTCTATTGCCTTCCACATAATTCTATGGTTAAATTAAA
CTTATTTAGAATTTTGATTAATAATTCTTGTAATAGTCTATTTGCAGTATTCCATCCGTC
TAAATCAAATAAGTGGCAAGATGGAATGGCCCTTGAATGTTAGCTCACTTGTTAGAATGA
AACCTCCATTTGAATTTGATACACAGAATGGACTTGTGGTATAAGGCCCCCAAATGTTAA
GATATGGACAGGTGTCTTAGAAAGGCCTTACACTCAACAGGTGCCCCAGATGATCACAGT
GCATCATTTTTTCTCCATAAAGTAGCTCCTTCTCTTGAACTAACATCGTGTACTTAATTA
TCCAGACTAGAAGGTGGTGGTCTCCCCTTAACCCTCCTCAACTAATCAATCACCAGGTTG
AGCAGGTGACAACTACTAAATATTTCTCAGATCTGTCCCTTCCTCTGCTTCCTATTATCA
TTCTCTTGGTTGAGTTACTCACTGTCTGTCACGTGAACTTCTGCAGTAGCTTCCTAACTG
CTCTCCCCACCTCCCTTTTCTCTCTTTGCATCTCTTTTCCACACAGCAGTATAAATGCAG
CTATGAACACATTACTCCTCCTTCAAGCCTCCCACTGATTCTCCAACCCCCAGCATGAAG
TCGAAGCACCTGAGAGAGACGGCCCTTGGCAACTGGCCTCTCTCTATACACTACAACTGG
ATGCTCTTCATCCCCTGTCTTAAGCTTTATATTCTGGGGAGCCAAACTCTTGTAGATCCC
TGTACTCATTATGCTGCCTTTATCCTTCTGTACTTTTTATTCTTATGTCCCCTTTCACTG
CAGTACCTTCCCTTCCTCTAACGTCCAACCCATCTCTGAAGACCCAGATCAGGTGCACTC
TCGCCAGAAGGGCTTTCTCAACTCCCACAAAGAGAAGCTTCTCCATGCTTCTTATTACTT
ATGAATGCGTCATCTTCTCTCTGACTCTGTGTTTATAATCATCGATTCAGGTGTGTCTCC
CCTCCTTGAGGGCAGATAATGTATCTCATTTGTCTTATTTGTATCTTATTTGTCTTTAGT
ATTCTCATAACCTAGCATGGTGCTTGGCAATCAACTACCTCTGGAATGAATGAATGAATG
AATAGTATTCACAAGGTGTTATTCTGTAATTAGCAGGTTCATTTGGTAGCAGAAATACCT
GGACTTGAGGTAGGGTATATCACAGAATTTTTAAAGCTGGAGAGGACTTTTGGAATATCT
TTAGTCCAATTGGTAGAATAGAAAACTAAGGCCCAAAGAGGTAAAGTGGTTTGCCCAGGA
GGACTCACTACAAAGATGTGTATTTCCAAAGTGATTTTATAGAACACTAATCCCTTGAGG
TGTTTCACCAGAATAAAAAGATGAATGAATAAATGGTAAAGAAGTAATTCATTAATAGCT
TGTGAAACGAAGTATGCAGTATTCCCCCTTAGAGATTCACAGCATATCAAAGGCCCAAAG
AAGTCGTGTTCTAAGGAAACTTGGTAAACTGTGTTTATTAAGCTCTATTTTACCAAAACT
TACTTGATTACAAAGCACAGTTAATGAAATGTTAATGTAAGATGTTTGGTAGTTCTTTGA
AAGAAGCAAATTTGACTTCAGTTCAGTTCTCATATCTTGGATGTGGGGTAAAGAATCAGA
TTGAGCCAATTTTAAAAGCTCACGGCCACTCTGGGACTAGAGGATAGACAAGGCAAGAGA
ATGTGCCGAGGCAGATCAAACTCAAAAAGACTGTGAGGTGCAAGGGCAGATCAGGGTTTG
AGTCCCAACTTTGCTTTCATGGGCCATACAAGTATTTGGGCAACTCATTTACACTTAGTC
TCTGAGCCACTATTTCCTTATGTACAAAATTGGGATAATAGTCACCACACAGAGATGTTG
TTAGGTGCTATCAAGTTGATTCTGGCTCATGGCGACCCTGTGTATGTAGACTAGAACTGG
CCCATAGGATTTTTAAGGCTATAACCTTTCGGAAGCAGATCACCAGGTTTGTCTTTTGAG
GTGCCTCTCAACCTTTCAGCTAATATTGGAGCACCTAACCCTTTGTGCTACCCAGAGACT
TCTACATGGGATATAGTAAGATTTAAATGATAGAGCATAACTAAGCTGGTCATAGTCACT
GCTTAGTAAATGCTACCTTCTGACCCACCTCATTTAGATAGAAACTCGCCAGTGAGCTAT
CAGAGTTCATTGGACTAGTGTTAAAAAAGTTCCTGAATAAGTCAGCTCAAATGTCAGACA
ACTGTAAATCTAAGGAAGATAGCTTCCTCCCAGCCTTCTTTGATTTTCTGAGGGCCAAAA
GAATATCCAAAAAGAGTTTTATATAAATCCTTATACAAAATCTTTTCTAAATGTTGTTCT
AATACGCTATTGTTAGCATGTACGAGCATTTATTGAGCTCAACTAGGCTAAGTTGTTGGT
TGTTGGTATTTGGTCACTCCCTCTTCCCTTCATTCACTCTTTAAAATGACTATAGCCTTT
TGGAAATGGATTTCTTATGTGTATATCATGTTTACAAAGTTTCATATGCAGTATTCCTAT
TTGGGGCAGCAAACGCCGTAACTAAAGCAATATGCTCCATGACTATGACCCTTAATTTCA
CGTGTAGATATTCTTTAAAAATGCCGACTCTTTTGTGGGTCTTTCTTTATGAGCAAAGGT
TACAGGTAACCAAAGTGATAATCCTTGGCCCACCATCGCTCCAAAGCTAAAATGGAACTA
ATAGTCTACCCTGAGACCAGAAGAGCTAGATGGTGCTCAGCTACCAGGGCCACATTAGAT
GGATCCTTACAGAATTGGAGAAAAATGTGGAAAAGAACTCAAATTCTTAAAAGTCTAGAC
TTACTGGACCGATTGAGACTAGAGGACTCCCCAAGACTATTGCCTTGAGATACTCTTTAA
ACCTTAAACCAAAATTATCCCTTGAGGGCACCTTTTAGCTAAATAACAGAATGGCTCATA
AAATGAAGAATATCACCCATGAGTAATGAGCTTCTTTAAGAAAAATCATCTATAGGAGAC
CAAATGGTCAACTCTAAAGCAAAGATGACACGGTGAAGGGCAGGGAAACCAGAGTGCGGG
AAATGGTACACCTCAAACAGAATGAATGAAAATAATGACACACTGTGAAAAATGCAGCCA
ATATCACTGGACAATTTGGGTAGAAATTGCTAAATGAGAAACCTAGTTTGTTACGTAAAC
TTTCACCTTAGACACAATAAAATATTTTAAAAAAGAAGCTGAGGTGGAAGAACACCAAGA
TCATGCCCAGAAAACCCTTTGGAAAGCTAGACTGAGTTTAAAAGCCCTCAGAATAAACTG
TATATCCTTTAGAGACCTTCTAAATAAAACCTGGCAGCTGAAAGAATTTATATTCTTGAG
AATATTTTAGTGACCTTGGATCATTGCTAGGCTCCAGCCCATTGTCACTGTTCTTGTGAA
ATGACAACTTGCTCCATTCCAAAGAAAATAGAGAGGAAGCCATGCACACCGGAGAGCTCA
CACTCTGGACAAGTGGCTGTAAAATGCCTGTTGAAAGAACTTGCGGCAGTTGGGGCTTTT
TTCCTCCCTTCTTATTGTCTTTCTAGAAAAATCTTTCAGTGGGGCACAGCCATCCTACAG
AAGACATTCAATTTCAAGAAAGTGTTACAAAAGCTGGATAGTAAATTCTTGGGCCAAAGG
GCATCAAGCAGGAACAAAATGAACCCTAAACTTGCAGGTCCAGGGAAGCCAGTGCTCAGG
GGACTCGTGAGGCCATCTCAGCCAGGGCAGTTCAAGCAAAAAGCAAGCTGGTACCCTGAA
AACCACAGCCGCCAAGCATACCACACAGCACATGTTCCCAGTGCCTGCCATGCCCATTCG
GGACAGTGGTACCAATCTTCAAGGACATCCATGGAAAGACATCACCCTGCTCATTACAAT
TGACTTCCCACCATCTTTTGGTGCCCATTTTCTTCTCTTCTCCCCTTCATGCCTCTGGGC
CACAGGTCTGCTTTGATTCTTCCCTGGAAAGCTCTGTCTCTTCACTCTCTCAGTTCTTCC
TATCCCACCTGAATTCCTGCCTCCTCTGTGAATCCTCACACATTCCAGGACACAGGGATT
CTTTCTTTTTTCCGACATCTACTTATAGTTACGATTCGTGTCATACAGCGCATCATTTAA
TTCTTCTCTTGCTTTACGTGCACTTGTTTTTAAAACCTTTGAGGATAGATACATCTTAAT
ATATCTTCTTTATTAAAAAAAAAAAAAGATTTATTGAACATTTACCAAGTACCAAGGTCC
TGTGATAAGGAGCACTGGTGGTGCAATGGTTAAGTGCTTGGCTGCTAACCAAAAGTCAGC
AGCTGGAACCCACCCAGCGGCTGCGGGAGATCTGTTCCCATAAAGATTAGAGCCTAGAAA
ATCCTACGGGGAAGTTCGCTGTCCTGTGGAGTTGGTATGTGCGGGGTTGATATGAGTTGG
GATTGACCCCTCAGCACCTAACAGCAACAAGGCCCTGTGTTAAGTGTTTCACAAATATTT
AATTTTCACATATAGCAGATACATTTCACAGATCTGTCCTATTTAACAAACACTTATCAA
CACTGTTATTTGCCAGGTACTGTTCTAAGCACTTTCTATATTAATGTATTTATGCCTCAT
GACAATTCTATGAGGCTTCTTTTATTATCCCTATTTTACAGACTAAAGGATGAGGAATTT
GAGACCTAGAGAGGAAAAATAAGTTGCCCCAGGGCCTGGAGTTAGTGAGTAACAGACCAA
GGTTCAACCCAGAAGAGTGTGACTCTAGAGCCTAAACTCTGAACATTGAATACATGGGAC
TAAACATTCATTTACGTCATTTGCAAGAGAACAAATAGGCATATGACCTAATGGGCATAA
CAAACATATATATATATATATATTTTTTAATTTTATTTAGTTTGTTGTTGTTGCTATTGA
CAGTATACACAACAAAACATACACCAGTTCAACCATTTCTACATGCAGAATTCAGTGGCG
TTGATTACATTCTTCAAGTTGTGTACCCACCCTCACCGCCTTTTTCTGGGTTGTTCTTCT
CCCATTAACATAAGCTCATTGCCACTAAGTTTCCTGTCTAAGCTTTCGAGTTGCTCTTGT
CACTTCGATCCCTTATAGACAGTTCTTAAAAGAGCATAATGATCAAGGCAGACATTCTTT
ACTAGTTAAGCTAAACTATTGTTTGGTTTCAAGACGATTTCAGGGGGTATTTTTGGAAAA
AACATATATTTAAAACAATATCTTCTCACACCCAGCCCTTAAAGGTTAAGCTTCCTGAGG
ACTGTATTTAAAGCATATTTTTAAATCATAGTAAAAATCTAAAGCATATTTTTTAAGAAA
ATTAGCTGTGCCACGTGTAAAGTTAAAAAATACTTTGAACCTAAATCCAGTTACTTCTAA
GTTTCAAAATTTCCAGAATTCATGCTATATTAGGCCAACAGTCCTTTATATAGTCAATAA
ATCTTTGCAGGACACCTAGTTTGTGTCTGGCACTGTGCTAGATTCAGTGACTACAGCAGT
AAATGACAAAACAAAAATCTAAAGTCAGGAATACAACTTCGTCAGGCAGCAGCAGCCACC
TGTGTCCTGACATACGCAGTGTCATCGTGTCAGGTAGGCACTACCGCTAATGAGTCTGAA
CATGGAACAAGGTGAATTAATAAATAGGGCAAATGGAAAATGCCGTAGCTCAAACACAGG
ATTAAAATATCTTAAATGCATTGCTGTTGTTGTTAGGTGCCACCACGTCAGTTCTGACTC
ATATCTACCCCCAAGTGATAGAGCAGAACTGCCCTATAGAGTTTTCTAGGCTGTAATCTT
TACGGGAGCAGGTCTTTTTGCCCATGGAACGGCTCGTGACCTTTCAGTTAGCAGCCAAGT
GCTTAACCAAGTACACTCTTTGTGCTGTAATTTTTCTACTTGAATGTTGAACCTACAGTA
GGTTCTCAAACATTAATTGTTAGTTGAATACCCAGAATGAAAGAGATTAAGAATAAATGG
AAGAAAATATGCTGAGAGGTAATAAAAATAGTTATTAGCTGCCATTGAGTCAAAGCAGCC
ACGGACTCATGGGGTAACCCCATGCACGATGGAACAAAGTAGATTGCAAGGCCATTCTTC
CTACTGTTGTCTGGAGCTCCGTTGAAACTGTTCAGCATCATAGCAGCATGCAAGCTCTAC
TGACAGATGGGGTGGCTGCACATGAGGTGCACTAGCCAGGAATCAAACCTGGGTCTCCAT
ATGGAAGGCAAGAATTCTACCACTAATAAAGGTAGTTGTACTTTTGTTGTTGTGTGCCGT
TAAGTTGATTCTGACATATAGCAGCCCCATGTTTTTTTTTTTTTTTTTTATGTGACAGAG
TAGAACTGTCCCATAGGGCTTCCTAGGCTGTAATCTTTATGGGAGCAGAGTGCCAGGTCT
TTTCTCCATGGAGCCACTGAATGAATTCGAACCTCTGACCTTTCAGTTAGCAGCTGAGAG
CTTAACCATTGCCCCACCAGGGCTCCTTAGGAGGGAGTAGTGGGATGCAAAGTGCTGAAG
AGGAAGGTAATTTGAGACAGGTGAAGAAAAAATAGACAAGGTGAGGGAATAGAATGCAAC
CTGTGAGCCCCAGAACGCAACAGGACTGCCTTGTCTTTCCAGGTTTCACAAGTTTTCCAC
CTTTGACAGGGTGCAATCTTACCACTTTTGTATGGTGTGTTTTAGTGGGAACTATTTCAG
TTTTCCTTCTCTGACAGAATTCACTTTACACAGTTCTGGTTTTCACGGGTTTTATGGTAT
AATATAAAGGATAACAGTAGTGATAATAATAAAGAGAAATGTAGTGTGAAAGGGCTGATA
TCAAGAAAACACAAAAAGACTTCCCTGGGTTGGCACCCAGATGTGGCACAATGGTGATGA
AGTCATCTTTGAGAATGTGTGACTCACCTGAGTCTCTGTCCTACCTGTCTCGGCCACCTG
CCCAAGGGACCAGCAGCTCATCCAAAATGATCAAAACGTCACTGCTCTACCTTACTATCT
TCCAAGAGTTTCCAGTGAGCTCCTGAAATGTTTAAGGCTGTGACTGAGCGGAGCAGGCAG
GGCTGTGGGTGACCGCGGTGACAGTGGCATTGTGAGGACCGGGAGTCCAGTGACTGTGCA
AAGCTGCTAGGGCAGAAGGCCTCTCTAGTGGAAGCACAAACCCTCTCATCAGGGAGTCCG
CAGAGAAAACGAGGTTTCTGAAAGTCGTTTAAAGGCTGACAAATGTAATGAACCCTCTCT
GAAAATAGAGAAGAGACATTTTAGGTGAAGCCTGCCTGAACCAACCTTCATCAAACCAGT
ATTTGAACTAAACTTCTCTGACAACAAAACCCTTTCAGAATGTTTTAAAACAACAATAAA
TTAGAAAGAGTGGATTCTGCCTTCGGTAGAATAAGGCTGAACAGGAGAGAAACACTCCAT
CCCAGCGACTAATCTTCCTTCTTAAATGGGATCTTCTTGGTCACTGTTGTTGTTGGGTGC
TGTCAAGTCCGTTCTGACTCATAGTGACTCCATGTGACGGAAGAACTGCCCCAAAGGGTT
TGTCTTGGGAAGCCGCTGGGTTTGAACTGCCGACCTGCTGGTTAGCAGCCAAACTTAACC
GTTGCATCACCAGGGCTCCTTTCTTGGCCATTAGGACTAAGTATTTATCTGGTGACTCGA
AAGAGGCATCTTTTCTGTCACCAGTGTATCACTGACACCTGTAGGTGCCATCTGCAGATT
GAGGTGCCTGTCACCCTAGTACCTGGTAATATGGCTCCATTGTAAAGTGGTTTTAACAGA
TGCAGGAAAAATCTGAAGAAACAGCAAAGGACAGAGATGAATGAAGCTGTTAATACCCTG
GAGTGATAAACTGACCGCCTGTCATCTCCGGCGATTAGAATCAGCAGCTTTACTTGATTT
TTTAGTAATAACGGGATAAAAATTTAAAAAACAGCTGTTGTCAAGTTGATTCCGACCCAT
GGTGACACCATGTGTGTCAGAGTACAACTGGGCTCCGGAGCGTTTTCAGTGGCTGATTTT
TTGGAAGAAGACCACCAGGCTTTTCTTCTGAGGCATCTCTGGGTAGACGTAACAGCCGAG
CATGTTAACTGTTTGCACCACCAAGGGACATACAGTGAAATTCTCTTTGGCAGAACTTGA
GTCGTAACTGACTTCTCTTTCTCATGAAACCTACCTCTGCGGTGCATAATGAATTAAGAA
ATATTATTGCAGAAAAGAAATGTGTACAAAGAGCAGTGCACGTGAAGGTGGGCTGGCAGC
TGTCTTTATCACCTCCGTTGAGGCCAGGGTTGATGTGCTGATGGAATTGGCTAAGCAGCT
GTTTTCACCATTCCTTTCTCTTCAATATGTGTCTCTAAGATAAGGGAGCCTATGCAGCCA
GACCAAGAAGGACCCAGCTTTACCAGTGGATATACAATTACCTCGTTGCCCCTGCCCAAA
CCTCCAAACACATTCTCAAGGTTTATTTGTATCTCTGACAACAGTATAAACACGAGGGAT
TCTGTGAACATATGCAGAACCAAGGTTCAGTTCTTTTCCAAAAATAAACTTCCATTTAGA
AGGTGAGCAGAAATGCATGGAAACTTTGAAGTAAGGAGTACCGCAGGGAAAAAAGGAGCC
CTGGTGGTGCAAATGGTTGAGCGCTGCTAACCAAAAGGTTGGAGGTTCGAACCCACCCAG
CAGCTCTGAGGGAGAAAGACCTGCAATCTTCCTGTGTAAAGGTTATAGCCTAGAAAACTC
TATGGGGCAGTTCTACTGTGTCACATGGGGTCACTATGACTCAACAGCACCCAACAACAA
CTCGGGGACATGGCAGGGCAAACATTTCATAGGTTGGCGTTGCCAGAATTCAGAGCTATA
CCCCAACAGCTGACAGAGGTACCCAGACTTTAATGACAGCGCAAAAATGGTTAAAAAAAA
AAAAAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCCATGGCTGAGGTCAGCACTTGTTCTGTTGGAGGAC
AGTCAGTGCTTGAGGGACCAAACCAAAAAACCCAAACCAAACCTGTAGCTGCCGAGTTGA
TTCCGACTTATAGCGACCCTATGGGACAGAGTAGAACTGCCCCATAGAGTTTCCAAAGAG
CACCTGGTGGATTTGAACTGCTGACCTTTTGTTTAGGAGCTGTAGCACTTAACCACTATG
CCACCAGGGTTTCCGTGAGGGACCAGTGGCAGAGAAAAAGAAATGGGGTAGGAAGAAAAA
GAGAAAGAAAGAAATAGGGGCATATGGTGGGGGGTGTGGGGGGGCTCTACCAGCAGTCAC
CCCAGAGATCTCTCGGGGGCTGCACAAAGGCCCACGTCACTAACCCCAAACTGCTCTTAG
CATGGGGGAGGTTCTCAACCCCATTCTCAGAATGCCTGCTGGCACTGAAGACGGGTTGAA
CAACAAACGGAAAACTCATGCTTTCTCCCCTGTCTTTTGGCAAAGAAATTAGATGAGTTT
TCTATTTCACCTGTGCAGAATCTGAATGAGAAACCCCTTCGTTAGAAAGTTTAACCAGGA
CCTAAAGTGATACATAAGGAACTCTGGTGATGCAACAATTAAGTGCTCAGCTGCTAACCG
AAAAGTCACCAATTTGAACCCACCCAGCGGCTCTGCAGGAGAAAGATCTGACAATCTGCT
CTTGTAAAGACTAAAAAAAAAAAAAAACCCAAACCCATTGCCATTGAGTCGATTCCAACT
CATAGTGACCCCATAGCACAGAGTAGAACTGCCCCATAGGGTTTCCAAGGAGCGCCTAGT
GGATTCAAACTGCTGACCTGTTGTTTAGCAGCCATAGCACTTAATTGTTATTCCACCAGA
CCAAAAAACCAAACCAAACTCAGTGCCGTTGAGTTGATTCCGACTCACAGCGACCCTATA
GAACAGAGTAGAACTGCCCCACAGAGTTTCCAAGGAGCGCCTGGTGGATTCGAACTGCCA
ACCCTTTGGTTAGCAGCCGTAGCACTTAACCACTACGCCACCTGCCACCAGGGTTTCCCT
GTAAACATTATAGCCTAGGAACCTCTATGGGGCAGTAAGTTCTAATCTGTCACGAGTTGA
AAATTGACTTGATGGCATCCCACAACATAAAGTGATAAGTACACAGCATTGCATCTGGGG
TCATGACCATGCCCAATCCAGTTAAGGAAAACGTGCAAACAAATGTATTCTCAGATAGCC
TGAGCCAAGACAACCGGTCGCTTGTATGACTCGAAACTACTGCGGAAAAAGTCAAGTAAA
TATAAGAAAGTTCATTTTTCTCCCCTACATCCACGCGATAAATTTGATTTTTGCGTAATC
TCCTCTGCCAATGTCCCTTTAAACAATCAAGACTGCAGAGTAGTTTAAGAAGTCATCTCA
TTCAACCTCAGTCATAATTAAACTGACCATCGCTGAAAAACAAAATGAAACATGCACACC
AGACGGGAAGCCGGTCTTCTAATGGAATGGGTTTGGGTTTGTCCTTTATTATTTTAGTGC
AGAATTGCAAAATGTTGTCAAGTATAAATCTACTTTTCTTGCTCTAAAAATATCTCATCA
TTCTACACGTAGTCAATATTACAAAGTTGAAAATGTTTAAGTATTTGGATCTATATAGCT
TTCAAAGGAGTCCCTGGGTGGTACAAATGGTCAAGCACACAACTAATAGCTGAAAGGCGG
GCAGTTCAAACCCACGCAGAGGTGCCTCAGAAGAAGGGCCTGGCAATCTGTTTCCAAAGT
CCATGGCCTTGAAAACCCTCTGGAGCAGTTCTGCTCTGCACATGTGGGGTTGCCATGAGT
TGGAATCTGCTCAGTGGCAACTAACAACGACGACAGCTTTTAAACTTGGATTCAATGGCT
GTTCGCTGATGGGAAAAAGACCTACAATCTCATTTTTTAAGACCCAGGCTCTCTGGTGGA
GCAGTGCTGAAGTACTTGGCTGCTAACCGAAAGGTCTGCCGTTCAGACCCACCAGCCGCT
CTGTGGGAGAAAGATGTGACAGTCTGCTTCCGTAAGGATGACAGCCTTGGAAGCCCTCTG
GGGCAGTTCCTCTCTGTCCTATGAGTCGGAACCAACTCGATGGCAATGGGTTTGGTTATT
TTTTTTGTTTTAATTAAACAAGTAGTATGTGAATATATTTTGTAATTGTAAAAGATTCAT
GTAGCACAGAAATAGAGTAAGCTATAAGAACTTCCCTTTCACAGAATTAGGTTAACTATT
GATGTGTGTCTTGTCCATTATTTCCCATTTTTTACCTATACATGTGCATATATACAAATA
CAGGGCCTTTTTTTTTTTTTTTTTAACATAAATGGGATCCATTCATTCAACAGATAATCG
CTGAGAGCCAACTCTGTGTCAGGCAGATAATAGGTGCTGGGAAACACAGCACTCGGAGCC
CTGGTGGCACAGCAGTTAAGGCCTCGGCGCTAACCAAAATGTCGGCAGTTGGAATCCACC
AGGCACTCCTTGGAAAGCCTATGGGGCAGTTCTACTCTGTCCTGTAGTGTCACTGTGAGT
CGGAATCGACTCAACGGCCATGGGTTTTGGTTTTAATTTGGGAAATACTGCAGTGAAAAG
ACAGGGGCCTTGAGTTGACGTTCTAACAGAAAAATACAGACAGTAACTTCAACGAAAAAT
GAAACTATAAATAAATAAATAGATAGCAAAATGTCAGAGAGCAGTGACTGCCGTGATGAA
AGTAAAAGTAGGTGACTGGTGGCAGGGTCGTGTGGGAAGGCCAGCATCTCTCAGGTAAAA
TCTGAGGTGAGATCACAATGTGTGTATTATTTCATGCCTTGCTTTTCCACTTACTATGTC
TTGGTGGTCTTTCTAGGTCAATACATATTGTTCTACCTCACTCTCCTTAGTGGCCATACA
TAGTAATATGGTATTATTGCTATATGTAGTTATTTCCTCTGTTGATGGAAAAACACCTTC
TTGACTTTAACCTCTTCCGCAGTGCAGTACTACTTCACTGTCTTACAGTGGTCGTAGGAA
TGCCACTTCACTATACACAGAAAAGCAGCTTTGGGTGAATGGCTAGAGGCCGAGGTGTAA
ATGGATCCAACGTCACAGAGAGACTATGAGAAATCTCAACATACCACAAGAATTTATTGG
ACCGGGGTGTGTGTGTGTGTACATTTACAATTTATAGATACACGTAGTTGATAACCAGGG
TTTTATAGCCAATAACCACAGAGTTAGCACCATGTGGTGCATTTTTTAAATGCTTGGATC
ATCTTGAAATGCTTTATTGGAAAAACAGCAAAGTTCACAGTTGAAGGGCACAAAAGTGCC
TTTTTCATTTTCCAGTGTTTAGAAATATCTGTGTTTTTGGGCAGAGTTTCAAGGTGATCA
CTTCATCCATAGCCCTTTCACATCAGCCAGTTTACAATTTTCTTGAAAGCTTTTTGAAAC
TATTCTGTTATCATAACCCGATTTTGTAAGTTAAGCTAGTAAAGCAGTTGTCGGTCTCTC
AAATGAAAGGACCTGTGGTATGGTTTTCACTTGTTCAGTGGTTACTTGGAGAGGAATATT
ACACAGCTTTCTCATCATTGTCTTCCATCTTGGTTCCCCTNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
TGTGGAACTTTATCTCGTGGCTAAATGTGCAGATAGACCAACATGGACACAAATTCTGAT
CAACAACTCCATTAGCAACCAACATGACAGGTAATTCACGGTCTTGCATTGAGCCTCATC
ATCAGACTCCTGGGAGCACATTACAAATTTCTGTGAAAACAGCCCAGTATAAAGTTTTAC
TTGTCCTTTTGGGACTAATGTTTTAGCAAACTCATGAAATCACCTGAGTTTGACCTTCTA
AGCTCCACAAGCTTGAACTTTTTGAACCTTAAGATGACAAAATTCACTGACGTCTGGTTT
TTCAGACTCTAAGGAGAGCTAAGCCTGCTGCAGGCCTTCAGTCGGCACCGCCAAACTGAA
AGTTAACATCAACTCCTACCTTGGCTTCATGACAGTCAGCAGACAGTGCGACGCTCACTT
CTCTACCCACTGAATGCAGTCTTTCATTGTCTTGGCTTATTTGGTCATTTTCTCAGTTAC
TGAGGGCCTGCTGTCTGAAGACACAGCACTAGACACTGATGACTCAGGAGCTAACAGGGC
AAAGTCCCTGCTCTCCAGGAGCCCAAAGTGAAGTAAACAAATAAGAAAGTTCCAGAACAA
GGCATGCACAGGATGATACAGGAGTAACAGAGAAGAGACCCGAGAGCATAGGCAATGGCT
TCCAGAGCAGCTAATCCTTGTGTTGAATATGAAAGAACAAGTAAATGTTAACCAAGTGAC
CAGGTCAAGTCAACATGCTCAAAGTCACTGAGGCTTATCAGGCACTGCAAATCAATCAGT
ATGGTTGATACCAGGGATGGATTTAGGGATACAGCAGGGACAGAAGCTGAAAAGATAGGC
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNATTCCGACTCCTAGCGACCCTATAGGACAGAGTAGAACTGCCCCATAAAGTTTCCAAG
GAGCACCTGGTGGACTCAAACTGCCAGTCTTTGGGTTAGCAGCCATAGCTCTTAACCACT
ACGCCACCGGAAGACAACAGTGGGCCTGCCCAAATTCCCAGTTGGTTAGAGCTGAGTAGA
GGCTGCCACCTTAGATGGGAGATGGGCCTTCCATGCTCCACAGACACAGTCCCACTCCCT
CCCCCATTACCTCATACTCAACTCAATTATGAGATGTGCCTGGCCCCCGAAACTATCTGC
GTTTGCAAGTTCTGCCCTATGTCCTCTTGGTCCGATCTGTAAAGGGAATTAAATAATGAG
TTTCCATGGGAATTATTTTGTTTTTAGTGGTTGAAGAATCTGTATTCGGTGTCAGAGCTA
TTAAAATTACATAAACAAGCATGCGGAAATGGCTTAGGCCATCCCTCTAGAAGCAAGCAG
TACTAAAATTAAATTGTCTCAGTAACACAAAGTGATCACCTTTTCCTAAGGGGGTTCTAC
ATGCTAGTTCTAATGACTAACACCCAAGGAGGAAAAAGACAGCTCAGATAGAGGGATCCT
TCAAAGAAACCTAATACCATTTTTTCATAACGACAAGAGCTACAACATATCTAGGAAGAA
AACTAACTAAAGAAAAGGCAAGATCTTTATAGAGAAAAATCATAAAGCTATGAAATGACA
TAAAGGAAGACCTAAATAACTCAAAGATGCTTGATATTTTTGGATGGGAACATATATTAT
TAGGTTGAATCATATTAAATGGCCACTTTGTAGGTCAAAATATTGGCAATTCTCATGCTT
CAATCTAAAAATAAATATGACAAGTTCCCCAAAATTATTATATAAACTCAGTGATATTCC
AATCAAAATTCCAACAGTGCATTTTACAGAATATGGCCAGGTGAACCTGAACTTTATACT
GAAGTACAAAGGGCTAAGAATAGTCTAGACAATATTGAAGAAGGTGTTATTCCCTACCAG
ATATCAAGATGTGTTCTCAAGCAGTAGTAATTTAAACAGTGTGGTGCAGGTATAAATGAG
TAGGCCATTGGGAAAGAATGGAGATCCTAAAAACAGAACCACGTATATATGGTAACTTTG
TATCTGATAGAGTTGGCACCACAGCTCAGTGGGAAGAGAATATTCAATAAATGGTGCTGG
GACAATTGGCTATTTGTATGGTAAAAAATAGATCCTTACATCATGTTACACACATACATC
CCACAAAAAATCCAGATGGACTAAAGACCCGAATGTGAAAAAGTAAGATTCTAAATAAAT
CTTTTAAACAGATTTTCTTTTTTAGAAGAAAGTACATGAAGGGAATTCTTTATGTATAGA
ATTTTTTTTAACAAGTAACTAAAAGTAAAAACTTTAATGAAAAATATTGACAAACTTGAC
ATAAAAATTTGAAAAGCTTTCGTATTAAAAATTCACCATAAATAATGTTTAAAACCCATT
CGTAGAATGGGGGAAGATTCCCTACAAGTTTAACCAACAAAGGATTAGTATCCAAAACAT
GTAGAGAACACTAAAATTATTGAGAAAAAGACAAATAGGCCAATAGAAAAATGGGCAGAT
GACACTATCTTAGTTATCTATTGCTGCTATAGCAGAAATAGCACAAGTGGATGGCTTCAA
CAAACAGAAGTTGATTCTCTCACAGTCTAGGAGGCTTTAAGTCCAAATTTAGGGTGCCAG
TTCCAGGGGAAGGCTTTTCTGTCTCTGTTGACTCTGGGGGAAGGTCCTTGTTGTCAGTCT
TCCCTGGTCCTAGGAGCTTCTCAGCAAAGGGACCCAGANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNACAAAACATGCATGAGAATAAGACACACGACCTTCATGATGGTACC
TATAGAGAGAGACAGAGAAGGAAGAGATGAAGTACCTATAAACTGTATTTCCTATGAAAA
AGAGCCATCTAAAGCAAATAGGCAAAATGTTGACATCTGGTAAGCTTAATGGTGGGCATG
TGGGTTATATTTTTTCATCATTTTTCAAATGTTTGAAATTGATCACATAGAAAAAAATTT
TAAATTAAACTAGAAATAGAGCCCTTTTTAAAAGAGGAGCTTCTTGGTAAAACAGATCCT
ATAGTATCAGCTAAAGCGAGTGTCAACGGGCTAAGGCATCACAGAAACTAAAACCCACTG
CCGTTGAGTTGATCCCGACTCATGGTGACCCCACAGGATAGAGTACTACTACCCCTTAGA
GTTTCCAAGGCTGTAATCTTCACTGAAGCAGATTGCCAGGTCTTTCTCCTTTGGAGCAGC
TGGTGAGTTCAAATCATCAGCCTTCTGCCTTCTGGTTAGCAACAGAGAGCTTACCTACTG
CATCACCAGGGAAACTCGGAAGAACGATTATGAATTAAGTATAGGCAGACGCGGGATGGG
AAAAAATAAGGGTAATAACTGGCCTATTTTTTCAAGAAGGGAAACAAATAGGAAGAGTAG
AGAATGAAGAAGGGCCTGATGAGGATTCTGAGTGGCCTATCTGGTGGTAAGGCATTAATG
TCCTTATGCCAGCTCTCACAGTGCCATGTGAAGGGAAATCAGGAAGAGCTTTGCCTGCTG
ATTTGGGGCACCCTCTAACTTGCCCTTCCCCAATCTCCTCTCCTCCCTCTTCCGCGTGAT
GGAAAGAGGGAACTTGCCGGATGGTGACATTAGCTCATCAGCATCCTTGGTACTATCTTC
TCACCTTCCACAAATATACATTTGTCTCCTGGGATGAAATCCAAGTCCTTTGACTTTATT
TGTTCATGGTGTTATCCTTAAATTGGGATTTGAGTGATAGAAAACTGGTTGAGGTTCAGG
TCTGCTGCAATGGAGAAGAGCGTGGTGAGCAGCCACTCAGCATCCACTAGCCCGCCATAC
CTTTACTTTCTGTGACTGGCACGCACAACCTATCTTATGTTTTCTGAAGCGATTCTACTG
AAATTATCTTCATTATTCCTCATAGCAATACCATGAAATAGGCTGACTAATTATTGTCAT
TTTACAGATTGGGAAAGAGCCCCAACGAGATTAGATGAGTTAGCCAAGTTTACAAAGTAA
AGCTCTCATCTGAGCTTAAAATATGGGAACCATCTTTTCCTCATCTGCCTCTCTTCCCGT
ATCCAATAAAGCACCAATTCCTGTAGGTCGTTTCTGCCAAAGTGGCCGTTTCCACGTCTT
CCTTTCCACTTCCTTTCCCACCATAATAGTTTGGGGCCTCGTCATGCCTTGCCTGAATTA
CAACCGTGAGCTGGACTTCCAGATGTCACTTTTTCCTCACTCCAGTCCATCCTGCATTCT
CCTTGTAGACTAAACATCGCTTTCATTATGTCACTTCCCTGCTCAAAAATCTTCATGACC
CTCTATTTCCTTCTACATTGAATGGAAACCCCTTGACCAGGACTTCAAAGCTCTCCTTAG
GTGAATGCGCTTCTCTCAGTCAACTACTCAAAAAGATGCTTTGGAAATAAAAATGGCCAG
CAAACACATTAAAGAATGTTCAAAGAATATAAATTTCATCTCTCAAATCAGCAGGATTTT
TTTGTTTAGATGATACTATTCAGTATTGGCAGGGAGTGATAAAATGGTCTCTTATCCACT
GTTGGTAGAAGTATAAATTCCAATCTTTTTGGAAGGCAATTTGGTAATATGAAATTGACT
CCACGGCACCCACCACCACCAACAACACTCCTGTTGTAGGCCAGCTTGACCAAGGGGTTC
CACTCCCTCGCACTTCGGAACTCTGTTCCTGGATGTGTCCTTTGTCTCCTGCATCATTGA
TTTCTCTCTATATACTGGATTAGCATGTAAAAATGCTGCAAATTTCACATCTCAAGAAAG
AATTCATTCCTCAACCTCGTGTTGCTCTCCAGCTATCTCCTTGAAAAGGAGCCACTAGAT
GTTCCCTGAGACCATGGTCCCTGCAGCTCTCCGCCCAGCAATTCGGTCCTTCAGGGAGTT
TGAATGTGTCTATGGAGGTACCATGGCCTTACCTTGTACAGGTTGTGCTGGCTTCCCCGG
TATTGTGTACTGTCTTAACCCTTCACCAAAGTTACCACTTATCTGTTACCTATTGAGTGT
TTTTTCATCCCCACCCTTCCCCTCCCTCCTAAGCATCCAAGATTGTTTTTTTTTGTGTGT
AAACCTTTTCATGAAGTTTTATAGTAGTGGTCTCATACAATATTTGTCCTTTTGTGATTC
ACTTATTTCACTCAACATAATGCCCTCCAGATTCACCCATGTGGTGAGATGCTTCGCAGA
TTCATCATTATTCTTTATCGCTGTGCACTACTGCATTGTGTATGTACCACAGTTTGTTTA
TCCATTCATCTGTTGATAGGCATCTAGGTTGTTTCCATCTTTTTGCTGTTGTGAACAATG
CTACAATGAACATGGGTATGCATATGTCTATTAGTGTGATGACTCTTATTTCTCTATGGT
ATATCCCTAGGAGTGGGGATTGCTGGGTCATATGGTATTTATATTTCTAGCTTTCTAAGG
AAGCGCCATATTGTTTTCCAAAACAATTGTAATCATTTTACATTCCCACCAGCAGTTGCA
TAAGACTTCCAATCTCCCCCACAGCCCTCTCCAGCATTTGTTATATTTCTATTATTTTTG
ATTCTATGACAGTAATGGCTGAGGGAGAGAATGGTTATCTCACTGAGGTTTTGGATTTGC
ACTTATCATGTAATGGGCTAGTGATTGAGAGCATTTCCTCATGTGTCTGTTAGCCGCTTG
AATGTCTTCTTTGGTGAAGTGTCTAGAACAGAATTCTTGATTTTTTTTCTTCCAACCTGC
TCCCCAACAAATGTTCCCCATCTCAGGAAAGGTACCACCGTTCTCCCAGTTGTTCAAACT
ATTAATCTTGAAGTCAACCTTTTATGACTGTTTCTCACATACCATACTGTAATCATAAGA
AAGCCCAATTGGTTCTACCTTCAAAAAAATCTGGAAGCCAATATTCTTACCATGTTCAAC
ATGACACCCTAATTCAAGCATCCGTAACTTTGACTGGATAGTTTCCATAGCCAACTAGTT
CTCCCTCTTTCCTTCTTGCCCCCATACAGTCCTAAAACCCTGCAATGGCTTTGCCTTGCA
CTTAGAATAAAATCCAACATCTTTACCATGGCTATGAAGTCATACATTGTTTGGACCTTG
CCGAGGTCTCATCTCTTCTGCTTGCTTACTGTGCTCTAGCCAAAAGGAATGGCTTTTCAC
TGTTCCTTAACCAAGCTCACTCCTGTCCCCAGGGACTTTATATTTGTTACTCTCTATGCC
TAAAGCAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTATGAAGCAGTTCTACCCTGT
CTTATAGGGTTGCCATAAGTTGGAATTGACTCCATGGCAATGGATTTGGTTGCCTAAAGT
CCCCTTATTTAGATGCTCAAATGGCCCACACCTTCCCATCTCTCAGGTCTCTGTTCAAAT
GCCCCCTCCTCAGAAAACCTTCCCTGAGCACCCTACCTGAGGTAGTCTTTTCATCATCCC
CCTTAGCCCATGATCTCCTTAATCTGGTTTCTTCATAGACTTTAACTCTAGCTGGAATTG
CATTATTTATTTATCTCTCTCCAAAACTAGAATTTAAGCCCTAAAATTTGCCTTGCTTAT
TATTGTATCACCAGCACCTAGCATAGTATCTAGTACATGGTAGGTGCTCAGTAAGTATTT
GTTATATGGAATGAACAAACTGTGTTTTTAAAAGGCCACTTTTAAAAAACTAGAAGAATG
TTAGATCAATGTTCACTGCAGCACTATTCACAATGGCCAAGGTGTGGAAACCAAAATGTC
CATCAACAGAAGAATGGATAAACCAAATGTGTTACATACACACGATAGTCTATTACCCGT
CCATAAAGAAAAACGAAGTCCTTATGCATGCCACAACGTGGAGGAACCTTGACAGTAAAT
CAGGTGCAGAAGGACAAATACTGTATGATCTCACTTACATGAAATAAGCACATATATAGA
GACCAAAGCTTATTAGTGGTTACCAGGGGTGGGAGGGAGAGGGAAAGAGGGAGTTTTTGC
TTAGGGGGCATTGAGTTCATTTTAATGGTGGTAGAAACATTTGGAAAAAGATAGCTATAA
TGGCTGCACAAAATGAGGAATGTAATCAAAGTCGCTGAATTCTACATATAGAAATTGTTG
AGTCGGCAAATGGTTTGTTGTGTAGGCTTTCACCACAGTAAAAATAAATACATAAAACTA
GAAGGAAAAACATCTGGGAGGTGAGATTGTAGGTTTTATTTATTTATTTTCACATTTCCC
TTTTATGTTTTTGGATGTTTCTCAGATTTTCTATATGAAGTCTATCTTTTGTCATCAGGG
GAAAGACAAGCTATTTAAACCAACAGAAGATAGCTTGTGGTCTAGTCAGGCCAGTTTTAT
CACAATTCCAGAACAAGCACTCAGTGTCTGTTCCTGTCAACTTCATGCCTTTTGTCTTAC
GTGAATGCCTTCCTTTCTCACTTCGTCTCTGAAAAGCAGTCCTTCAGGGCTCAGCTCAAG
GTCTGTTTCCTTCTGTGGTACTCCTGTCCTTACTGATCTCCCTGGTATCCCAAGCTTTAC
ACTTAGCTGGGTATGCTGAGCTACATTTATTCTCGTTAATTAAATCTTTTCTGATTGCTG
GTGCGTATGAGTGTGTGTGTGTGTGTGTGTGTTTGTGTATGTCTGAGAAAGAAAGATAAT
GTATATTATGTGTTTGGTCTGTGTGAATTTTTCCTCCTCGGAAGATATGTCTTAACCTGC
TTCCCAAAGTCTCTTAACAGACCAGATGACAGTGAGTACTCAATAAATACTTGTAGATAG
TACCATGTTGAAGCTACTAGATCTTGAAATTGGAGTCTGAAAACTTAAACGGTACTTCTT
CCATTATGCCATGCTCTGTGATAATACTTTAGTTTTCATTTATTAAGCATTTACTTACTA
CCTGCCAGTCACTTGCTATTCATTTTCTGTTTTCCCAGTAGGAACCGCTTTCATGTTCAT
CTTAAGATTGAGGAAACTGAAACTTAGACAGGTTATATAACTTACTTAAAGTGACAGGGC
TCGAAGTAGCAAGGCCTGGGTTAAAACAGAGCAGGTGCCCAGAGCCCAAGCTCCTTACCA
GTAGGCCGTCTGGCCTCATCGGGATACACAATGAAGGAAACGCGATTTCCTTTGACTTCT
ATGCCCCAAATGCGCTTTTGGTCTGACTGCATGCTTTCAGTCAAGTTATTTAACCTCACC
AAATCTCAGTTTCCTCGTTTGTAAAATGGAGACAATAATACCTAAGAGGGCAATTGTAAA
TGTTAAGATGTAAATGTTTTCACTGTATGCTGTCAAGTTAATTTTCCACTCATAGTGACC
TCATATGACAGAGTAGAGCTGCACCATATAGTTTTCTAGGCTGCAGTCATTACTGGAGCA
GATTGCTAGGTCTTTCTCCCATGGAGTGGCTGGTAGGTTCGAACTGCCGACCTTCCTGGT
AGCAACAGAGTGTTTAACCATTGCACAACCAGGGCTCCTTAAAATACGGATAGTGCCTCA
CATAGTTCCTAGATATTGCGGGCACTCAGTAAATGGCAGTTGCTGTTATTAGATATTCTG
TCTTCTTGGTATGGGAGCCCTGGTGGCTTGGTGGTTAAACTCTCAGCTGCTAACTGAAAG
ATTGGTGGTTTGAACCCACCAACCACTGTGCAGGAGAAAAGACCTGGTGATCTGCTTGCA
TGAAAATTACAGCCTTGAAAACCCTATGGGGCAGTTCTACTCTGTCCTGTAGGGTTCCTG
TGGGTTGGAATGGACTTGAGGCCAATGGGTAGTACTTTCTTGATAGTTACTGTTTACACT
GGGCTGTGGCAGCACCATCTCATTTCTTCCTACACAGCAAGTGGCCTTGGCCAGACCTCC
ATCTCCAAATCTGGGTGTCACAACTCTGAGGTGTTGAAGGTACTGTTAAAATGCCTGGAC
CAAGAAAAAACAAATAAGCATTCCTGAACCATATTAACCAGGGCTTGGATTTCCTTGTCT
GAATGCATGATGGGAAGAGGGTTGTGTTACAGGAGTAGCTGTTTTTGTTTGTCATACAGG
CCCCCTAATCTAAACATCTCTCACCCCTCAGGAATTATTTTAGGACCAGGAAGCAGCACG
CTGTTTATTGAAAGAGTCACAGAAAAGGATGAAGGCGTCTATCACTGCAAAGCCACCAAC
CAGAAGGGTTCCGTGGAAAGTTCAGCATACCTCACTGTTCAAGGTAAACAGTTGCTTTGA
GAAAGCAACCAGAAACTGCTCAGACATCTATTTCCCTGTTTGTTTAATTTTCCACCTCCC
AGTCTGCTGCCTATCGCTCCAGTCTGTTCCTTTCCTTCACCTCCCTCTTCCCTCTCCCTG
GCCGCGTTGAGGAGGGACTGTCTGGTTCTGTCTGGCAAGGCTGACAGTGAGGAGCCAGGA
TCCCCAGGTGGTGGCACCCCCTGAGAATGACTGGAGAGGGGCCACACCTGTGAGAAAGAG
GTTCAAGGAGGAGGGAGATGGGTGAAGGTAAGGGAAAAAAACCCACGCTTGAACTTGTTT
GTTCCCTTTCCTGTTCCAATTCCCAGGAGTTGAACATATGCTGCTCTTCAGAACGTTTTC
CTAAGCTGGTTTTTAATATGAAGTAGGCTGCAAAATATTAGAGAAGCAATACACAATGAA
CAGACCACAGTGAAGAGAAATACTCCGCACGCTTCTTCTTCTCTGAGTCCCAGAGGGTTT
GTTGAGCAGCAAAATACAAAGAAGCCCTCTCTGACTCTGGGTTATTGCCATGTGGCTTCC
ATTTAGAAAATAGCCTAGACCTCAATTTTAATTCTCCAAGGCCAAGAACCACCCAAAACA
TAAAGTTTACAGCATTATAAAATATCACATTGGCACCTCTTAGATGTAAACATCTATGGC
ATGCTGAGGTTTTCCGATGGAACCTCTTAAGTAGCCTTTTTCCAAATGCTCACTAGTCAA
CATCAGAATATGCGTGTGTTTGCCGGGGAGGAGCTGGGGAAAGGGCACTACCCTTCAGTT
CTTTTGCCCTGGAAACTTACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCATGCTTTTACAAGGACGAAAATCTGAAACTGCCCAACCACAAATCCGTACTTTCAGAA
GCAGTGAGAGAGAGTAAACCCTTTGCTGTTGAGTTGATTCTGACTCATAGTGACTCTCTA
AAATAAAGTAGAACTGCCCCATAGAGTTTCCAAAGCTGTAAACTTCACGGAAGCAGATTG
CCACATCTTTCTCCTTCAGAGTGGCTGGTAGGTTCAAATCACCTTTTGTTTAGCAGCTGA
GTGCTTAACCACAGTGCCACCAGGTCTCCTTAGTGGGAGAGGACAGCATTCTCAAAATGC
TTTTAGTAATGGTCCTGTTTGTATCCCAAGTCATCCATGTTTTAAAATATTCTTTCAACA
CTGCTGCTGAACAGTTTATTAAGTGTGCATCTCTGTTTAACATTTCTTTCCTCAAACAGT
TAGTAAAACAGTCTTTTAACAAAGACTCCAGATGTGGCCCTCAGGGAGTGGCTGCCTCAG
GTCAAGGAGGACCTAGATCTGATAGAGGCGTGGCAGCAGCGAGCAAGGGGATCTGCAGTC
CAGAAGGAGGTTCCCCTCATATCCTCACAGCCTTATTATTAACCCCAGAGAGGGCTGAAA
TGACCAGCCTACACCCAGGTAAAGGAGCTGTGGTGGAGCAGCGGTTAAGTGCGCAGTTGT
TAACCAAAATGTGGGCAGTTTGAACCCACCAGCCTCTCTGAGGGAGAAAGATGTAGCAAT
CTGCGTCTGTAGAGATTACAGCCTTGGAAATCCCATGGGACGGTTCTACTCTATCCTATA
AGGTCACTATGAGTTGGAATCAACTCAACGGCAATGTTTGTTTGTTTTTTATAACCATGT
AATTGCAGACCTGGGATGAAAACTGGGCTCACGCCCGCCGCTCCCCCACCCCCACCTCCC
ATCAAATGGCAGCCTTCCTGGCCATGTGTCTGTCCCCATCTTCACTAGTAAGAATATGGG
TCAGCAGTGGCTGGGGGACCTGAGTGCTCGGGAGAAGCCCTTGCCTATGGTCTTGTTCTT
ATGTTCTTCACAGTCCTGGGCAAGTAAATAAGTTGCTGAGTTAATAACCAGTCAAACATG
GCTCTTCTCTCTCTTTGTCCTAAACAGTCTGTCAATAGTAATTTCTTTATTCTGACATTA
AATGGTGATCTTCTAATGAGGCAAAGCCAATAAACATTTACCAAGTGCTCTGGGATGTAA
CAATGAGTAATCAGCAGTGATCAGTATTTCATTAAAGGTACATTGTACACGCTGTGGGAG
CACAGAGGAAAAAATGATGGCGTGACAAGAGCTCAGGTATAGAGAAATGACACAAGAAGA
AAGTGAGTTTCACAGGATGCACAGTGTTGCCCAACCTGGAGAACAAGTTGAGAAGGAAGG
CTGTCCAGACAAAGGGGAAAAGGTGTGTGAGGGCAAAGAGGCTAGGAGAAGCACAGCGCT
TTCAGGAAACTACAAGTAGTTCAGTGCAGCTGGAGTATTGGAGGCCCGTAAGTCAGGGAG
AAGAGATGAAGCTGGAGAAGGAGCCAGGAGCCTCATGTCCCCAGATGAGAATAGTAGGCA
ACTGGAAGCCACTGAAGCATTTTAAGCAAGGAAATAACATGAAGATAGTAAGACACGTGG
TACAATGATTAAGCGCTCGGCTGCTAACGAAAAGGTTGGTAGTTCAAATCCACCCAGCTG
CTCCACAGGAGAAAGGACCTGGCAATCTCCTCCCATAGAGATTATAGCCTAGGAAACCCT
ATGGGGAAGTTCTACTCTGTCATATGGGGTGACTGAGTTGGAATCCACTCGACAGCACCC
AACACCAACAATGAGAGATATGGAAGTTAGGCCATGATCCCTAACGTTGGTGTGCTTTGG
GAACCTAGTTGGAAGATTGAGGTGTACATGAAACAATGAGAACCAGTTCCACAAACATTT
TGTGCTTTTCCTAAGTGTCAAATAGAAGCATTCATTTATGTAGAAGACCACACAGTGCTA
TGACTGAGGCAAAAATGGACATGGAGTATGACTTGATCTCTAAAGCAGGACTTATAGGAT
GTTAGGTCAGCCAAGTGACGGGGACAGGACAGTCTACATTAATATCCCCCTTGGCAATAA
CCAAGTCTAACTCGTTCTAAATTGTTCCTACTGGGTAGTCCATTAAACTTTCTGATGAAT
TGGTCCTTCTGACTCAAGGCCTCTTTTTCCTCATGTGGCATAAACCTTCAATATTACTTA
GAGAAATGTTCTAATGTAGAAGGTGGCTGCAGACACTTTGCAGCTATGGCTCTTTATTTT
TACCTATTACGGCCCCTAGCAGCCATGCTTTTGAGTTCTTGTGCCTGCTCATTGTAGCTT
TTCCACTTTTCCCTTGCTCTCTTTCATATATATATATATATATGTATATATATATATATG
TATTTTTTTATGCTCTCAGAATGACAGCTGGACCCAACCTTTCTGCTTTAAAATTGTGGT
TAGCAGAAAAAACAGTCTGACCTGCCAGAATCAAACCACATCTGAAATATTGTGCTCACT
GATAAGAGAAGAGTAAATAAATCCCCAGGATAATGATAGAATAAACACTGCTAGGAAGTG
AGGGTGTTTAGTCAAAAGAGAGACAACTTGGAGTGACAGGATTGTTTTCCTGAACCAACT
AAGAAGGAGGCATTTAACTCGTTTTTTGATACGTCGGAAAAGATAACAGGAAAGGAAGAT
TGTGGTGAGGTTTCAGGAAAGCAGGTGTCAGCTCCATTGAAGAATATAATTTTGCATCAA
GAGAATTTCTGGAAGTTGGTGTTGTGTGGATCTTGGGAAAGCCTGCATGCTTGGGTTAGA
TGCAGCGTCTTGAATTTACATACTTTGGGCTCATTGAATAAAAATGTGATCCCTGGATGC
TGCTCAGAACAGTTGCCTGCAGGCACGCCCAGTAGTTTTATAGCTGAAGTTGGGTTCTTG
CTCTCGTGTCTAAACCATCTCTCTTATCACTGCAGTGGCTGGTTTCCCATTCTATGCCTA
TGGACACGTCGCACTGACTGATCTTGTCAAGATGAGTTTAGGAAATGAAACCAGGCAATC
AAGTTGTGTCTGTGGCTATGTTTAACAGATTTGAAAAGAGGTTCATGAATTAGCCAGGAA
GGAAGCTGTCTGCTCTTTTTATTTCCTTTGAAAAAGAACTCTTATACTCATAGATAAAAC
AATGTGTTATTTTTGTATCTGCAAAGGATGAATGGACTGTGGAGTCAAAGGAGCTTCTTT
AAATAATCACAGGTCTTGTTTGGTTTGGACCCGGCGCATCAGTCCACGTGGCGCTCTCGA
GGGGAAAGTCTAATATTAAAGACAACAACAACAACAACACAACTGTTACCAACCAAAATT
AAGTTTGGAAAATAACATAGCACTTGCTGGGCAGAACTCAGTGGGGCTGTTGCAATGTAA
TTGTGCCACATCTGTCATCTAAGAACTTATGTAAGCTATACTTTATCGTCATTATTGCAA
ATAATGCAGCCCTCAAGGTGCGGTGGTTAAGCACTCGGCTGCTAACCAAAAGGTTGGCAG
TTCAAATCCACCAGCCACTCCAAAGGAGGAAGATGTGGACGTCTGCTCCTGTAAAGATCA
CGGCCTTGGAAACCCTATGGGGCACTTCTACTCTGTCCTGTATATAAGGTCGCTGGTGTG
AGTCGGAATCGACTCGACGGCAAAGGGTTTTATTGCAAATAATAACCACAATATATACAA
ACACATTCTGCTAACACAAATTTAGGCTTTACTATAACTCAGTCAATTTATAATTAGTTA
TTTCACAGGAGAAAAACACCTGGAAAAAAAATGTGTCATTTTAAACATTTTTTGAGAAGC
GTGATGGATACAAACATCTCAGGAGGCTCAGTAGGGCAGCCTGAGGGTCATGCAGCCACA
ATACTTTGGATGGCATTTTCGGTGTGATTGGCAAGTGTTGAGCCTCAATAATTGTATATT
TTAACACTATTTGAGGAAAGGACTCATATGGTAGGAAGTATATTCTGTTTCCTCTAATAG
AATTCCAAGACTCGAGGATAGGAAAAGTTCAAACAAAATTGTCTTGGGTGTTCAGCCACC
CCCTTTTTTATTGCCCTTGTCAACTTTTGTTTTCTCTTTTTCTGACCCTCTTCTGGTCCT
GGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNAATATATCAAGGACTGATGATGCACCTCCCGTAAGTGCGGGCAATTTAGAAGGG
AGTCCCAAGGAGAGAAGGGTGCTCACAACAGGGACGTGAACTCGCTGTTCATGAATTTCA
CGCAGGAGGGCTGGAGGAGAGGCATATGCGTGCCTTTTCCCTTCGAATCTAACCAAGGAT
ATAAGGTTAGCCTTGGTGGAGAATTCAGATAATGGCGATGGAATTCAACTAGGGGGATTT
GGGATCTTTGAAGATAGTTCTTGGGGTAAAATAAGTCACACTCAAAAAATATTCATCTTA
ATTCCTTCCGTGGAAATTAAGCTGTCATAAAAGTGCATAAGGAATTAAAGAAGTGGATGT
TAGCTTGCTTCTGTGGAGACCTTGGCCGTGTGATTATAATAGCTTGTTTGGTGAGCAGGC
GGTGCACGCTGTAAACATGTTATGTGCATTATCCTAGTTAACTTGTGCAATGAGAAGGTA
TGGTTACTTACAATTGAGAACCCTCTTCATCATCATGCTCTGCTGCAGGCAAGTTGAGAG
GCAGTAGGGCAGGATGGTTAATCATGGTTTCACTTCTCCGATGCACCAATTGCTAGCTGG
AGCCAGATGCTGGTATTCAAGTCCCAGCTCCACCGCTCATTAGCTGTGTAATCTTGACTA
TGTTACTTGCTTTCCTGGTGCTTCCGTTTTCCCATGTTAATAATGAAGTATTAATAATGT
TAATATGATGTTAATAATGGTATACCAACCTTGCTAAAATAAAAATGTGTGACAGAACTG
ATGTTCTGACAGAATGACAGTTTTAAGTATCTTTGCCTAAAATTACTTTTGAAAAATGTA
CTTCAACAACAACAACAAAATACTTCAAATTTAATTTGAATATGGTATTTTCATACATCA
CCATCCTTAAAAGTAGTTCCAAGTAGGGGTTCGTAGACTTCTAAAAAGCTTCTGAAGTAG
TAACGAAGGTCTACAGGCCCATTTTAATATTTCGGTTAGCCTTAGAGAAGTCACATAATA
AGGTTAACTGGATTACTGGTTACTGGGTTTTGGCTAGAAGGGAGATGGCACTGCTTGCTT
TATTAGCTCATGTTGATTAGGGAACCCTGACAGTCAAGTGTAGGCATATGTGTTTAATTT
TACTTTATTTTCATCCATATGTAAGTATTTACTGAGACCTTTTCTGGGCCAGTGATGGAA
ACACAAAATGAACAAGAAACACACCCTTCTGTTCAGGTCTTCAGAGTTTAGTGGGAACTA
AATCCACATAAACAGACAGTTATCTCAAATTATGACAGATCACATGCAAAAGAATGAAGC
TGGACCCACACCTCACACCATAAACAAACATTAAGTCAAAATGGATCAATGACCTCAACG
TAGGAACTAAAACATAAAACTCTTAGAAGAAAATATAGGGGTAATTCTTTGGGACTTTGC
TTTCCACAACGAATCCTTAGATACTACACCAAAAACATGAGCAACAAAAGAATAGATAAA
CTGAATTCCATCGAACTAAAAAACTTGGTGTTAAAGGACTTTATCAAGAAAGTGAAGAGA
CAACCTATGGAATAGGACAAAATATTTGGTAACTATATATATCTGATGGGGATCCCTGGT
GGTGCAGTGGGTTAAAGCACTCAGCTACTAACCTAAAGGTTGACAGATCAAACCAACCAG
CCTCTCAACGGGAGAAAGATATGACAGTCTGCTTCTGTAAAGATTTACAGCCTTGTAACC
CCATGGGGTCAGTTCTACTCTGTCCCATAGGGCCACTGTGAGTCAGAATCAATTCGACAG
CAAATGGAAAATTTTTTTTATGTATATATCTGATAACGGCTTAATATCCCTACATATATA
AAGAACTCCTACAACTCAACCACGACAACAATNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGCTGGGCTGTTTCATGAAATGA
GGTCATCAGCTGTCACCAGCAAGTTGAAGCTGGCTCTAATCAGGCCAGGGTGTGGATGCC
TGACCTCTGAGAAAATACCCAAGGGCTGTCTAAGAAGAGATGCTGCTGACTTCAGTCACT
CTACCCAGCTGAAGCTTGTCCTAATGGTTGCTTTTCAAATAGTGATAGAGATTGAGGTGT
CAACTGAGATGGATAGAGAAGGAACTGGACTGCAGGTCTAACTGCCTGCATGAACTACTG
CCTCCTTAGCCATGAGACTAGAAAAAATTGATGGTGCCTGGCTACCATTACTGAACATTT
TGATCACGGAATCAATAGATGAATCCTGATCAAAAGGGAAAAAAAATCAACTTCTTACAG
AATCCAGACTTATTGGACCCATTGAGACGACAAGAGCCTTGTGCTCTTTTAAAGAATAAT
CTACATGAGATCAAATTGTCTAAAGCACAGATGAGAAGTTTAGGGGGTAGTGAGTCTAAG
TCAGTGGTGGGGAAACAATATCGTAGAGGCAGGGAGAATGGTGATGCAACGTGCAGAATG
TAACCAATCTTGTTGAATTGTACATGTAGAAACCAATGAATGGGTGCATGTTCTGCTGTG
TATATTCTCACCAAAATTATAATTCGAAAAATTTTAATGAGATAGATGGAGCATAGCTAG
CACATTGTGCACTCTAAAATTCCATTTTTAGTTTTCAGTGAGCTGTAGAATAGCAGAATA
TTAAGTACCTCTTTCCCTCCTTGTAAATTTCATCTTGAAGATGTTTTTTAAACGTGTGTT
TTGATTCCTTAAGTGTGTAAGTTTTTGCACACAAACACATTGGGTTCTACTGAAAGGAAT
GTTGCCTGAGTAAGGCCTGTGGAATTAGACTTTGGGGGTCAGCTTCCTGCCCGTGGAATG
CAGTGGGAAAGTTCCCACAATCAGAGGGGGCCTCTCTCAGGGCTTTCCGTGAGGGAAGCA
TCTGCAGAGGTTTTATGCAGACAGTGTCGTGTCTCAAGATACTATCAGCATCTCCAATCG
TCAAAAGCCACTGTGCCCTTCAACAAGTCCCAATCAAATTCCACAAAGCATATTTGCAGC
ATAAGCAAGTATGTGTGTGTGTGTGTGTACAGCAAGGCAGCATTAGACCTCACAGTGTGG
AGGAGAAAATCCAAATTCCAAGTATTAAGCTTATAGTATTTCCATCACAACAAGGTTTAC
TGAAAGTAAAGGCCATCATACTTTGAAACTTCTTCAACAAAGTTGTTTTTAATCAATCTC
ATGAGGTTCCAGGAATCTCCACCATAATCTGACAGAGCAGCAAATGAAGACGAATCCATC
CATTCACCCATTCAACAACTATTTTAAGGATGTCTATGATGTGCCAGGCACTCTCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAA
TTGGTAGATTAAGTAACTACAAGTATTTTGGTATGACTGGAGGAAGTACAACCCCAGTGG
CATGGTGGTTAAGCATTTGACTGCAAACCAAAAAAGTTGACAGTTCAGATCCACCAGTTC
CCCCATGGAAACCCTCTGGGCCAGTTCTACTCTTTCCTATAGGGCCACTATGAGTTGGAA
TTGACTCAACAGCAATGGTATGGGAGCAAATGGGGGGACAGCTGGAAACTTAGTTGCAGA
GGGAGTAAGGTTAGGCACAAAGGACTGGGTTTTTATCCTGAGAGTGATGGGCAGCGGGGG
AGGGGGGTGGAGGTGGGCAATGGTAGAATGTAGGCAGAGGAGTGATACAATTCAATTTGT
GATTTGGCAAGATGACTCTGGCAGTAGTGTGGAGAAGAGGTTGGAGAGAGCCAAGACTAG
TTAGGAACAGCCTCCTAACCAGGGGAGAACTGATGAGACCTTCATCATGGCAGTGACACA
CGGGTAGGAGAGGAGGTGACAATTTCATGAGCCATTTGGAAGTAGAACGTGCAGGACCCT
GTGAGGGACTGTATGAGGAGAAAATGTTAGTTTCCCCTCTGAGCTAAAGGATACTTGGTG
ACAGGGACTGTGGCCTACAGGAAGTGATTGATAAGTATTTGGTGGATGAATGGAGAAGGG
AGAAGGGTGAGGAAGCACATCTTTTGAAGCTTAATGGTTAAGTATGTTGAGTCAACTTAA
AAAGAAAACAAACAACAACAAAAAACTCGTTGCCGTCTGGTCAATTCTCACAGCCACCGC
GTGTGTTATACAGTAGAACTGCACCATAGGGTTTTCTTGTCTGTAATCTTTACAGAAGCA
GGTTGTCTGGCCTTTCCTCCACAGCACTGCTGGATGGGTTTGAACCACCAGCGTTTAGGT
TAGCAGCTGATCGCAAACCACTTGTGCCACCCAGGACCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
GACCATTCAGTTTCAACCAAATGACACAAAGCAGATGTTGCCAGTATTGTTTTAAATTGG
ATATCAGTGTTTTCAAAGTTTGTCCCTGTTGGTGACTTTAAGATCTCTTTATTTCTTAGT
CTTCTTCTGAAATAAAGACTGACTACTTATCCATTATAATGGATCCAGATGAAGTTCTCC
TGGATGAACAGTGTGAACGGCTCTCTTATGACGCTAGCAAGTGGGAGTTTGGCCGAGAGA
GACTTAAACTGGGTAATGTATTTGTTCAACAGATTCACAAGCCTATACTGAGCACCTACT
ATGTGCAAATCACTGAGCTTTGAGGGATGCTAAAGTAAACTAAATGTTAAACTAGTTTAA
GTGCTGGGGTACCAACCGAAAAGGTTAGCACCCACCAGTAGCTCCACAGAAGGAAATATC
TGACAATGTGCTCCCATAAAGATTACAGCCTAGGAAGTCTGGGGTCTTAAACACTAGTAA
GCAGCCATCTAAGATGCATCAATTGGTCTCAACCCACCTGGAGCAAAGGAGAGTGAAGAA
CACTAAAGACACAAGGTAATTATGAGCTCAAGAGGCAGAAAGAGCCACATAAAGCAGAGA
CTACATTAGCCTGAGACCAGAAGAACTAGATGGTGCTCGGCTACAACTGAAGATTGCCCT
GACAGGGAACACAACAGAGAACTCTCTGAGGGAGTGGGAGAGCAGTGAGATGCAGACCCC
AAATTCTTGTAAAAAGACCAGACTTAATGGTCAGACTGAGACTGGGAAGGACCCCAGAGG
TCATAGTCTCCAGACTTCTGTTAGCCTCAAGACAGGGAACCATTTCCCAAAGGCAGCTCT
TCAGACAGGGATTGGGACTGGGACAATGGGGATAGAAGATGCTACTGGGAAGAAATGAGC
CTCCTGGATCAAGTAGACACATGAGACTATGTTGGCATNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTTATAACTTTCAC
TTAAAGCACAATAAAAATTTTTTTAAAATTGATTATAGCCTAGGAAACCCTAAGAGGCAG
TTCTGCTCTGTCCTATAGGGTCTCTATGAGTCGGAAATAACTTGGAAGGCACACAATGAA
AGCCAAGTAAACTAGATCGTGGGTTCAATCTCCTAGCTGCTCACAAACTAGCAAGGGAGG
TGGACATGGAGGTAAATGTTTCTAATGGAATGCTGACACGACAGTACAAGAGGACAAGGG
AGACCTGTTCATTCACTCAGCAGTTACGGGACACCTTCTCTGAGCAGACACCAGTGTAAG
CCCTGGGAATACAAAGATGTTTGTGTCCCTTTTCTCAAAGGGCTTGGTCTGGTGAAAGAG
ACAGTAGATAAGGGAAGGGGAAGGAAAGGGATTAGTGCCAAAAGAAAAAAAAGGGAGGCT
TATAAATCCAGGCTCTGTTCTAGAATGAAATCACCGAGGGGTTAGCTCTACAGAACATGT
CTGTGACCCAGAATATGATTCAGGGTGGTGGAAAAGTGAGATCATACATTTGATGAAAGA
GTTAGTGCTATTCAAGGCTGTGGATCAAAAAATACCTCTGTAGAGTCTGGTTGCCTCCTC
TGCTCATGAGACCAGAAAAACTGGATGATGCTCAGCTACCATTACTGAATGTTTTGACTA
AAGATTCTATAGGAGAATCCTGACCAAAAGGGGGGAAATAAGGAGTAGACTTTCAGTTTT
CATCTCAATGGAATCCAAACTTTTTGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTGAAGAATGTA
ACCAACGTCACTGAATTGTACATGTACAAATTGCTGAAATGGTATGTCTTTGGCTGTGTA
TACTTTCACCAAAAAAAATAATGATAATAAACAAAAATTCCCTTCTGTGCAAACACACAA
ATGACATACTCTGAGTTTCCCTGGGTGGGTGTTCAAATGCCCAGACAAAGAAGAAAATCC
CAGGGGGCCTTTTAAGTTCCACTTTCGAAAATAAGGATTGTTGTTTTTTTCCAGGTAACA
TAGATGCTATAAACACCAGGCAAATGTGCTTTCCCTCAGGTTACCCCAGTTCCTCCAGCT
CAGACGTCACAATGCAAATTTATCTCCAGCCCCTGGTGCTACAAAACAATTGGAGCCTCA
GTTACTCCTGCCCAAAATATTTGCACTGTGGCTTCTGAAAGTTTTCCACTCCTGAATGTG
TATGCCAGAGTCATTAGTAGTCGGAACTAGGAAAACAGATTGTGCTGTCCGTACTCCTGG
CATTGTTACCCCTGGTGTGAAAAGCCTGTGACACCAAATTCAATGTCATCCCCTTGTCCC
CTGTCCCCTGTCTACCCACACGTGCACAAATTACATCGGGGTGGAAGGTGTTGAGAGCGC
AAAGAGGGAAGATTGGCTTTTCTTGCTTCTCTCTCAGGTTTTGAAATGATTTGGCTTACA
TCGCTTCCTACATAAGAAAGAACTGGCCCCAAGAGTATGTTCTGTTTGGATTGTGGAAGA
ATATTGGAAATCGGTAAAAAGCCGGAGAGACTGGCAAAAGTCAGCACTGGCTGCTGACGG
GGAAAAATTCAACTAAATTTAGAGTAGTGAAGGGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGGCCACATTGCTTTCCAGAGCTATTAGTCACAATCAAACATGCTTC
TCCCAGTATAGGACACATAAGCTTTCCATCCCATCTCCTCATTCCTTGCCCTAGTGTCAC
TATGATCCATATCACATAGAGAGAGATTGCTAACCCTTACATTAGAACTTCCTTGGGGCT
CCGTGAGGTTAGAGAATTCCATTTTGGGAGGTTCTCCTTGTTGAAAATCTTTCTTATCAT
TCTTTTCCTTCCCGGAGTTGCAGATGCTATGATTTGGCCCATGTCTACTTGAGGTCTTTG
ATGGGTGAGAGAAAGTATATCAAGTCTGCTAACTTTGTCTTTCAATTCAGGGTGTGGATG
CAAGGGCTAAGACATGCTCTTCTAACATGGGAGCAAGGAGGCCCAAGAACTTCTGTTGCT
GTTGTTTTTTTAAACCAAATAAGTGACAGAAAGTAATTTCAAATGATATCTGACAAGTGA
AAGTAGCCAAGATTACGCATGGATCGGTGGGGAGAATGATGTAAGAATTACAGTGGGATT
GTAAACATAGAGAAATACACAGACCAAGCTGCATTTGATTTCAGCAGGATCTACTTTCTT
GGTTGCTATTAGCAGCCCTGAGGAAGGAAGTCAGAATTTATAGTGTCTGATAGATGAATA
CAGTTGGAGTGTGGGTCAAAGGTGTTGCTACCACTGAAATTCCTGAAACCCAGGAACAAA
AGAAGCCTGTTTTGTTAGAGATTCTTCACGAACCCTGGGAGAGAATTACACTCCTATAAA
TTTATCATAGAAGATGGGGGAAGGTCTGACATTGCATCTCTCTATTGAAAAACATAATTT
AAAGTCAGAATTACCTAATTTGGGAAACAATCAAGGGAGTCTAGAATTTGGCAAGTGGCT
GGTACCTGGGCTGGTGCTGCCTCTTGGAAGAACAGCCATGCACTCCCCACAGAGTATCCC
AGGGATCCTGGCCAGTCAAGAACATTCTTGGAGGAGATTCCAATATCCTTGCATTGCATG
ACAATGACCTAACCCATTTCGGAGCTAGTAACTGGCATTAGAGGCAACACCAAAGAGGAT
TTTCAGGGAAAAGGAAAATCAGGCAAGGTCAGGTCCAGTGGTGACAGGGCTCCCCTAAAA
CTGGAATCGTGGGTCTGCGGAAGGATTCCAACAGCATCAGGTGATTAAAGAGCCCATAGT
AGCTTACTGTGTTTTATGGGGCTGCATTAAGCTTCCAAGAGAGTAAGTGCAAAGACTGAA
GGAAGCCAAGTAGAAACAGTTTATTCACACTGATAGAAGCAAAGTCCCCCAAACACTTGT
TAAAACAGAGTTTGTCGTGATGGCTAAGAAGGGAATGCATGCTGGGGGCTGATGTTTGGA
CCGGTAAAGGATCCTTCCTGCCCCAAGCAAGCAAGAGTCTTAGTAGGGTATGCAGAGGGG
GCCCAAGATAGAGATTATTGTCATATTTCTCAGGCTCTGGACACTTTTGTACCAGATGGA
AGAAGGCACTGTAGAAGAAAAACACTGTTCTTTTACCCTAAAAAAAAAAAAAAGCAAGGA
ATAAACCTCCAACCAAAATGCACCGAGTTTTTACAAATGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCAGAGAAGAAAACATGTCCTTTCC
CAGTGTTCGCCTCTTAATGCAGAGTGTGCCCCTGTGAACCACATGCAAAGACACAGCAAT
AGAAAGACTACTATGATTATGTTGGTAATTTAACCATCCTCATGTTCGAACTCGATTCCT
GGGGTGGTTGTTAGTGGAAGATACTAAACACGGACAGGATGAAGACATCTTTGTTACTGA
GTCCTACAAACTCATTGCCATCAAGTCAATTCCGACTCATAGCAACCCATAGGACAGAGT
ACAACTGTCCCATAGGGTTTCCAAGACTGTAATTTTTAAGACAGCAGACTGTCACATCTT
TCTCCCATGAAGCAGCTGGTGTGTTTGAACTGCTGACCTTTCAGTTAGAGCCTAGCGCTT
TAACCACTGTACCACCAGGGCTCCCTTGTTACTGAGTAGTTGCATATAATTGAATATACC
GTGGGCTGCCAAAAGAACAAACAAATCTGCCTTGGAAGAAGTACAGCCAGAATGCTCCTT
AGAAGCAAGGATGGCGAGACTATGTCTCACATACTTTGGACATGTTGTCAGGAGGAATCA
ATCCCTGGAGAAGGACATCATGCTTGGTAAAGTAGAGGGTCAGCGAAAAAGAGGAAGACG
CTCAACAAGATGGACTAATACAGTGGCTGCAACAATGGGCTCTAGCATAACGATTGTGAG
GAAGGCACAGGACCAGGCACTGTTTCTTTCTGTTGTACATAAGGTCACTATGAAAAGGAA
CTGACTCAACAGCACCTAACAACAACAACAAAGTTGCGTATAAAAGTATAAAAGTTCTAA
TATGATGAAGAAGCAGGAAAGCTTTGTTACAAACTTTTACAAGAAACTTTAAAAAACCAA
CTATATCCTTTGTGAGGGAGAGATTGGAATATGAGGAAGGAAGGAAGGAAGGAAGTTGGG
TTAATTAACGAAAGGCCCAGTCTGAGAAAAAGGACTTGGTTGGGAGAGGAGGGGTTTTGT
TAAATTAACACTCTAACTGCTGAGATTTACTTTTGATCAGTGGCGTGTTTCATTTCGTTC
GATTTTTTCCCCCAGAAGAGCCAAAAAAGAATGACTTCTTTGGCTCACTCCTCCTTTTGT
CACATGCTCGAGGTACACTGTTTCTCTGGTTCTATTTAACTTCCTGTTTCTTGATGGTGC
AACAGGAAGTCCCCTGATCTAAAAGGTATGCCAGGGGGTGTGCTGAACCAACAGTTTCAC
TCTCATGGTCTCAATTGCATGGGCCCTTCTAGGTACCTATGACTGCATGAGACATTCTTT
GGACAGCCCATAAGTTCCCAAATGCTGCTCTTCAGTCTATACTAGTATATGGGGGACTTT
ATATATGCCTTGGCTAGTACTGGGGAGACTAGGACATGGTTCTTGCCCCTCTGAGTCAAG
TTGTCTCATTCAAGGGTGGGGAAAGAAACTTGTTAATAGTCATTATAGCAGAATATAATG
AACCATGGTTTCAAGGTACCATGAAAGAAACCCTGCTTGGTTATTCCATTTGGCAACCAC
CTCTCCATGGTTGAAATAAATCACTGCCGGTGTTTGATAGTCTGAAAATAATGATGTGAA
GAGATGTTAGAAAGACTGGGCATATTTTGCCTGGCAAGGAAGGAAATCACTTAGTGATCA
CTTTTAAGCTATGAAGCATTATTATAAACAATAGTAGTAACCACCGTTTTTTATTTCTCA
CTCTTTGCTGGAGACAGATCAGAAGAAATGACCTTCAGTAGCAAGAGAAGGGGCGTAATT
AAACGCAGTCTTGGTAATAATGGTATTCAACAATGGAAGAGGCCAGATAGGCATTGGTGG
AGAACTTTATAAAAAGAATACTGGCCATCTACCTCTACTAAATGCTTTCAGAAGAGCATT
CGGGAGAGCTCGCCATGAAGGATATGAGGGCCTCATAAACATAGCCAAGTTGAAAGGAAG
AGACCCTAGAAATATGCCCCTGACTTTGAATCTTTTTGGGTCAGTTCATTAGAAATTCCA
TTCAAAGCTATGTGTCCCACATACATACACACAGGAAAAGGCATTTATTTCTTGGAAGAG
ACTTAAACTCACCCTACTGGCTTGGAATATAAACCAATGTCTTCTTCTCATTGTAGGCAA
ATCACTTGGACGAGGGGCTTTTGGGAAAGTGGTCCAAGCATCTGCATTTGGCATTAAGAA
ATCACCAACTTGCCGGACGGTGGCTGTAAAAATGCTGAAAGGTGTGTATGCCGTAGTTGG
CTTTCAAATGATCCATCACCTTTTTGCATTCCCTATTTTCTAAATATTCGTGCAGATCGG
ATATGGCCTAGGAACAGATAGAAGCTATTGCTGCTCTAGCCGCGTAATTTTCTTCTACTG
CTGGAAGCCCCTTTTGCTTCAGGAGGTTTGAATTAGGGCAGCACAGCTCAGAATAAACCT
TGTAAATGGAACAATCTAGCACGGTCCTATGAGAAATGATCTTTGTCACCTCAAAGGTAT
TTCTCCTTTGTCATCTTAGAGTCTAAACTCCCCGTGATTTAAGCCTGTTATAACCACAGG
TTTGAAATTTTGGAATAATCTACTGTGATGTTGTATTGGGAGCTTAGGGGCACATGACAA
ATCTCAAAGTCTTCGCTTGGGCTTGACCTAACTATATAAAGTAAAGCTAGAACAACTAAG
TTGATCAGAACTCTAAACTATAATATACTGTCAAGCCCCAAACATTTCCTCTTCAGAAAT
TATAAAAACCCAATGACCTTCCTAGTGTTTGAAGATACTACCACTCTGAAATGCCCATAT
GTCCTATAAAGTGTAGAAATTACTTCATTTCCTCGTATTTGTTGGAATTTTCATATTATC
TCAACTCATTTTAACATTCCAAAACCAAAAAAGAAGCAGGGCAACGAAGCCCAAAGGGCA
GTTTTTTAGCTCTTCAAAGTCTCTAAGATATGGCCAGGGATTTTGAGGTCTGGAAAACTG
TGAGTCCAGCTAAGCAGGTTCTCAGCACAGGCTCCTGGAAAATGTACTGTTTCCACAGGA
AGACTTCAAAGTTCTTAATCTCCTTCCAGAACTGACACTGTCCTTGCAAAAACCCCATGT
AATGCTATTTTCCACCCCAAAAGGCTGTCTTGACCAAGGGAAGGCTCTGATAAAACTCTA
CAAAGAACTTGACGGTTCTCTGAAAGTAGCCAGGAAAGGAGTTTTCCGTCCACAAGTCAG
GACTTCTGCTTTGGTGGATTACCCACACGATGACAGACATATCTGTGGGAATACTTTCAT
TCCAGTACCTTCCCCCTCTGTAACCAAATTCTGAAGAGAAGAGGTATCAACATGTCTTCC
ATGTAAGAAAGCACCAGGCTGGGTACTTTAATATATCAGGTTGAACCACATGAAATGGCC
ATTTTTCTTATTTTCTCTCAACATCCTTGTGAGCTAGAGATTATTACCCCCAATTTGCAG
ATGAGGAAACATGGTCCAGAAAAGTTAGATAGCCGCTGCAAGGCCACACAACCCTGAAGT
GCAAAAGTAAGGGTTGGATGCCAGTCTTCCCGCTTTGAGTCCAGTGCTCATNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGCTGCGTTTTCTTATGTAAA
CCGTACGAGCATAAATACTGAGTACTGATGAGTTGAGAGAGATGAAAAATTTTTTTGACA
ACCTGGGGAATCTATGCTGTGCAGAAATAATATGTTTAATACCTTCGTAAATGTGGGTCT
TCCTTTTTTTTTGAGCCACCAGCATAGACTGGAAAAGATTGCCAAATCGCCCACTATGTA
AAATTCCTACAAAACCATTTTCATTCAGCTTTCTTGCTTAAATTGGCAGGCCATCTGTTT
CGGGGAGAGATAGAAAAAGGTAGGAGAGTCAGAATGTCAAACAAAGGTCATGAGTCAGAA
GCTCTTTCAAAGTGCCCTGGAGCAAAAACCTTAACTTTTTTGGCCTCACACTCCTGTCTG
AAATGAGAAGAGTAATCACGTTGCTTATTTATCCAACAAATACTTGTTGAACATTCATTG
TGAGGCAATCCCGATCCCACTGGAGAACTTCTGGAGTTTATCTGGTAATTATTAAAAAAG
ATTTGTGCTTATGAAATACCACATTGGTGCTTACCACAGTGTTAAATGCACATACCTTTG
ACCCACTTCCAGGACTCTGTCCGACAGAAATAACTTGCACGTGTGCACAAAGACTGAGCA
CAGGTTGTCTCTTTCAGCATTACTTGTAATAGCAGAAAATTGTAGACAATCTAAAAGTCA
GGGACACCATTCATCAATTTAAAAGAATGAAAAAAGCCTCTGACACACTGAAAAGGGGGA
AAGGAGCAAGTTTTTAAAAAAAAAAAAAAAGTGTGCAAAGAAACACATATTTAATACATA
AATATATATATTGTATATATATTATTTATCACATATATGTGATCTCATTTATGTAAACAA
AAAAAATGGACCTTTGGGTATGTATATTCATAAATTCACAGGAAAAGGTCTGAAACAACA
GTGGTTAACTCTAAGAAGTTAAGTGGGTAAGGTAGCTTTTACTTTGTACTGTCTATACAA
CATATTGTTGGCATATTTTGCAGCGAGATTATATTGATTATATTTTATAGTTTTTTTTTT
CCTTTTTTAATAATATTTTTTGTGTTGAAGGTGGAAGTTTCCACAGCAGATTAGGTTCCC
ATTGAAAAATTTCTGCACAAATTATTCTGTGATATTGGTTATATTCTTCACAGTGTGTCA
TCGTTCTCATTCATTTGGTTCTGGTGGTAGTCTAAAAATAATTTTAAATTTTTAGAAAGA
CTTAGAAATTAACTGATAAGAACAAACTTCAGACTCTGCCGATTCTTATTCATGGTGCTT
ATCTCTGAGAAGGAGTTGAAGTCAGATGCCTACGGATCCTCACAACCCAAGATAACCCTC
AGACTCCAGGGAGAAAAAAAAGAGTATAGGGAGAAAATGGCACACTGCAAAGATGGTCAC
AGAAATGACCACTCAGCCGGGGCAGGCCCCTCGTACTCCTTCTCCGTGACTCCCTGGACA
GGGGAGAGCGAGAAAGAGAGGGGAAGTGTGGGGCACCCCCTGCCTGGAAGTTCTTGCTGC
GCCTGCTTCTGACAGAAGGGAAGCCTCTGGAAGGCGCTTTCATAAGGTGCCCAGCTCTGA
GTCAGCACATTACTGAACAGGACTAGGCCCACTAAGAGGAAACGTCCAGTGACTAACCCC
ACCACTGCTCTGAGCCTTACTGTAATCAAAAGGATGTTGGCTTAGGAGGGTGGGAGTAAT
GAAAACAGTCTGGAGACTTGGCCTTTCTGCAGAATGTGGGGAAGTTAACGAAGCAACTGG
CTGAGCCCTGACAAACAAGGAGGGCAGGAATGCCGCCTCCGGCGGAAGGAGCCCCATTGT
CCTGCCGCCCTGATTCTTCCTTGCTTCTCACACAGAGGGGGCCACGGCCAGCGAGTACAA
AGCTCTGATGACTGAGCTCAAGATCTTGACCCACATTGGCCACCATCTGAACGTGGTCAA
CCTGCTGGGAGCCTGCACCAAGCAAGGAGGTAAATGAGAAAGGGAGGCCTGCTCCATCTC
CCCATGTACACGCTGGGAGCAGAGTTCTCTGACACACAGCTCCATCTCTTCACCTCTGCT
CCTCCTTATCTCCAGGAGAATGGCCTCTCAATAGCTCCAGAGGAAATAGTTTGTCCACTA
ATGGAGAAATGCTCCCACTCTAGAAATGTCTTCCCTGTACAGTTTCAATTTCTGAAGAGA
AAGACTTTGTTCTAGACCTCTTTCCACAGGCTCTAAACCAAGTGTGGTGGGTGAGGGAGG
GACATTTTTCTCTCAGGACAACTTTGAGGGAGTGTGACCAGAGCTGAGCCTAGAAGGTTG
GGCATTCTTCGCAGCCTCACCCAGAGGAATGAGTCACCACTGGGAGGATCCCAGGGGAGG
AGATGTGGGGACAACCAGAAGAGCCCTTCCCTTCATATCCACCATGCACACAGGCTTTAC
CCACTGGGGCAAGTGGCAGGGACAGGGCGGTGCCTTATGTTCGAGGGCACCGGCATATTC
TTGCAGATCTTTCTTTCCTCCGCTATAGCCAACTTAGTGCTTGGCTCTAGGTTTGTGATC
ATTGTTTGCTCCAGAAAAAAAAAGTGCAAAGGACCTGTGCCTGCAAATGTTTTCCTAGCT
CTCAGTAAAGGTAATAGGGATGAAGGGTAATCGGGGAAGGCCTACCTGCCAGGAGTGGCC
GTGGGGAGAGAGAAGTGAAAGGCTAGGGAGGCGGCCAGAAATAGAGCCATAGGGACCTAG
ACACGGCCCAACCTGCTTCTCCGTTATTCTTTGAGGATCGACAAGTGTAAGCTCTTTCTC
AAGTTCTCTGCCTTGACAGCCTCATTCTGTTTGCCTCAGTTTTGCATCTGTAAAACTGAT
GAGGGCTAATCAGACAACTCACCTCTGTCTGTGCCTCAGAGCTCCAGGTAGGGGTGTCTG
AGATTAATAAATCCTCTTCCCTGTGGTAGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTACAAG
CCCTAGCTTTGCTTTTCCCCTCCTCTAAGTCTTTCTCTCCTCGTCGTTCTACTCCTTTCT
TTCTCTGCTCTCTGCCCCCCTCTGTCCCTACACATGTTGTTTTCTATTTCTTTTGTGTTT
TTTAATCTCTTCTCAAGTTAAACTGAAAAAGCCGTCCTATTCATGAGCCTCTCATCCCTA
AGTTGCATCCCTAGGTCCCCCTAATATATCATAAAGACAGTTGGCTTGAGCTTTCTCAGC
CTGGCAAATGGCTGACTGGCTTGGTGGGGCTGAGCACGTGCTGTTTTGGCTGCAGGGCCT
CTGATGGTGATCGTTGAATACTGCAAGTATGGAAATCTGTCCAACTACCTCAAGAGCAAA
CGGGACTTGTTCTTTCTAAACAAGGTAAGGACCACAAGGGTTGGAGTTTTTTAAGGCCAC
CAATGAGTTTCTCTTTAGGCTGTTGCCCCATAGAGCAAGAGAAACCCACATTTTTCCATT
AATGAATAGGCTTAAAACTCAGTATCTGCTTTTTCCTCCTTTTTCCTTCCAAACATACTC
TTTTGTGGACAGCACAAAGAATCATTTGATCTCAGTGTATGCAGTGACAGGAGATGTTAA
AATTTATTAACCATCTATCTCAACACCTATCGAATCATCTTGATAATTTTATTTCTCCTT
GCCTCTCTCTCTCTCATTCTGTGTGTGTGTGTATACACACACATATATGTATGTTTATGT
ACACGCATATATACATGTATGTATATGTGCACATAAACACATGTACATGCATATATACAT
ACGTACAATTCCCTGTTTCTTGAAGGGAGGTGATAACATACATAATTTAGAGAAATTAAG
ACTCAGTCAGCTGAGTGACTTGTGCACTCAACGATAGGCCAGTGATGGGACCAGAGCTGG
AAATAATTTTCTTTCCTTCCCACTGCCTTTCTCTTACTTCCTCACACCCTCACCACCCAT
CTCACTCCTGTACACACTTTTTACTAGCTTTATCCACTAAAATAAAGCTGTGTAATAAAA
GGAACTCATGGGTCCAAGATCTGAAGGCAAATAAGACTTAGATCATTGAGTGGAGGAGAA
AAAATTTCATAACATTTTGCCAGGGCAGCCTCGGCACCGATGCTGTGTCCTTCTGTGAGC
TGGAGAAGTCTAGGAGACACCAGTTCAACACTATTAACTGGTACTCAGCAGTGCTGGTGA
TGAGGCTGTGTACATAATGGTTAAGCTCTGAGACTCCAGAATCAGACTCTTCTGGTTTTA
AATCCTGACTCTAACAAACAACAAACAAATCAAACCCATTGCTGTAGAGTCGATTCTGAC
TCATAGCAACCCTACAGTAGGACAGAATAGAACTGCCTCGTAGGGGTTCCCAGGAGCAGC
TGGTGGATTCAAACTACTGGTCTTTGGGTTAGCAGCCAAACACTTAACCACTGCGCACTA
GGGTTCCAAATCCTGTCTTCACTACTCATGAAATCTGGGACCCTGAACAAACTACTCAAA
CTCTCTAAGCTTCCGTTTCCTCATTGACTAAATGGAACTCATAATAGACTCACCTCATTG
GATGGCTGGGAGAAGCCAATGTTCTCAGTGAAGCGCTCAGTAAATGTTAATCCTCATTAT
CATCATTAGTGACCCACAGAGATAGATAGAAAGGTTGGGTGAGTCCACTGATGGATAAAG
GGTCCAACATCCAAGAGTGATGGCCAACTGCCATGTGAACAACAGTCCTCATGTGGCACA
CAGGTAAGAACCACTGAACAGCTGACCTTTTCTCATGTCTCAAACTGATCTGGCCAGAGA
CATAGATATTTGACAAGACTGGCAACATGTAAGCGGGAATGTATTTGCCCCAGTTTTAAA
CCATGCCCTCTAATAATTAGAATCTTGAAGCTGAAGGGATCTTTGTGATCAGCTAGTTCA
CACTCTCATCTGATAGATGTGCCCAGAGAAGTCAAGTGACTGGCTTAAGGACACACACCT
ACCAAGAAGTAAAGTCAAGGAGAGAAAGAACCCAGCTCAGTTGCCTTCCCATTCAACGGT
TTCTATGCACCACCCTGGAAAAGGTGAAAAAAACATAAGATAAAGTGTAAAGTGGCACCG
TGGGGGCTGAGGTCATTCAAATTCCCTCCAGCTTTGAAACCCTGGACTGGCTTCAGAAAG
AACTAAGCCAGCAGAACACCCCAGGGACCCAGGCAGGATGGAACGTTGGGGCTCCAGCGT
CCTTTGTTTTGAAGACCGTGCTTCCTTCTCTGGCTATATTTAATGACTCGCCTCCCTGTG
CAGCTTGGTGGAGCTTAGTGTTTTCATGGAGAACCCACAGCTGTATTTCAGACAGAGGTG
AAGGAAACGCAAAACCAAAAGGCAAAGTAGAAATGAGAGGTTTTAATGTCTAAATAAATT
CACCAGAATCTTAAATATTAAATATTATTTGTAATAAATTCACTGTATTCTGCCAGAGTC
CTGGAAGCTCAAAAAATTAACTTTTATTTAACAGAGATGGTTACTGATAAGCAAAGCTGA
ATATACCGTCGGTTAGGGGGCCAAAAGGGGGGTGAGGGAACCTGAGCTAAGTCCTTGGAG
ATGTGACCCTGGCTGTGATTTCTGGGAGGCAAGAGAAGAGGGGAGATTTCACAGAGCTAG
AAACTTTCCTGCCTCACCCTCTTGCCAGCACCCTTTCCCTGCTGCCTTCTGTGCCACGAA
GTTCTTGTGAAAAGTAAAATTCCAGCCCCCAGCTAAGCAGTATCAAATCTAACTGCCTCA
GGGAGACACAATAACCCATAGCTCTATTCTTTACCTCCTCTCGTGTGCATCACCCGAGGT
GGTGGTGGGTGTTTGCTCCAAGTCCTGCTGCACAGGAAGGTCTCTATTCAAGGACCAGGA
ACCTCACACCCTCCATGTGCTCAGAGTATGTCAGGATGTCCCTCCTGAAGCTCCCTCCCT
CTGTCCTCTGCTTGCTCCCACGGTGCCCTCTAGTGGAAGGATCACTCTTGCTTCCTCTGG
CGTTTCTAGGAAAAGCCAAGGAAAGATGGGGAGCCTGCTAATCCTCACACGCCACACGCT
GCAGGTGAACCAAGAGGCACCGCTTGTCTCCGTTATCCAGTGGTGCTATAACAGAAATAC
CACAAGTGGATGGATGGCTTTAACAAACGGAAATTTATTTCCTCATGGTTTAGGAGGCTA
CAAGTCCGAATTCAGGGTGCTGGCTCTACGCGAAGGTTTTCTCTCTCTCATCTCTGGGGG
AAGGTCCTTGTCACTTCAACTTCTGTTTCCTGATCCCATGGAGATCTTCATATGGCTTGG
CATGTATCTTCTCCATCTTGGTTTGCTTAACCTGCACCTTTTATATCTTGTGAGAGATTG
ACTCAAGACACACCCGACACTAATCCTGCCTCATTAACATAGCAAAGAAAACACATTCCC
AAATGGGCTTTTGACCACAGGCATAGAAGCTAGGCTTTACAACACATATTTTGTGAGGGG
ACACAATTCAATCCATAATACCACTGAACTCCAATACCCCTCAGCCCTTATTTCTGTATT
GCCATGTAGCAGAATCAAGGCTAGGCACACAGTACAGTTGGGAAATCCCTCAGAAGTACC
AAGTAGTGTCGTAGTTATTAGATGAATTACTAAAGACAGAACTTTTCAGTGAGGAAAATG
AAATCAGAAAAGTAAGCGAGTTGCTCAAGTTGTATGGTTGATGGCAGANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCTTTAGATGAAGGCTTA
CAGAGCAAATTAGTTTCTCATTAAATAATTAATATAGATATGGTTTTGTGGCATTGATTG
CCAACCCCGTGATATGTCAACGGTCTCCCCTCCTTGACCTTGGGTTCCCCATTTCCATTC
GTCTAGCTTTCCTGCCCCCTCCTGGCTTCTTGTCCTTGCCCCTGGGTTGCTGTGCCCATT
AAGTTTCGTATACAGCTACATGTATTATTGCTTGTTTTATGGGCCTGTCTAATCGTTGGC
TGAAGGGTGAACCTCAGAAGTGACTTCAGTACTGAGTCATACTCTCAGGGTTTCCCTGGT
CTCTGTCAGACCAGTAAGTCTGGTCTTTTTTGGGGAGTTAGAATTTTGTTCTACATTTTT
CTCCACCTCTGTCCAGGACCCTCTGTTGTGATCCCGGTCAGAGTAGTTGGTGGTGGTAGA
TCTGTGTTTCAAATGGGAGGTGGAAAAAGAAATGTTCACATTCACTGCTTCCCCAAGGAA
ACCAGAGAAATTGGTAACCTACAGCTTTCTCATATTACCCTAATAGTGGTCACGAAGTGA
AGCCCAAGCATGCTGAGAACGCTTTTGGTAACATTTTGCTAACTCCCCATAGAATACTTG
TTCTTTTTGAACACTTTTTTGTGTTTTAAGTGAAAGTTTACCCAGTAGATTAGCTTCCCA
TTGAGCAGTCCATACACACAGTGTTCAGTGACAGTGGTTGCTGTCCCTAGAATGTGTCAG
CACTCTCCCCGGTTCCCCCCTGCCTTCTCCGTTTCCGTCTGTCCAGTTTCCCTGCCCCTC
CCTGCCTTCTCATCTTTGTTTTTGGGCAAATGTTGCCTGTTTGGTCTCGTATAATTGATT
GTCCTAAGGAGCACATTCCTCACCTGTGTTATTGCTTATTTTAAAGACCAATCTATTATT
TGGCTGAAAGGTGACCTCCAAGAGTGGCTTCAGTTTCTGTTAAAAGAGTGTCTTAGGGCA
ATAGTCTCCAGGGTTCCTTCAGCCTTTTCTTCAGTTACTTCCTTCCTGGTCTTTTGTATG
AATATGACTTTTGTTCTACGTTTTCAAACCGGGACCTTCTATTGTGTCCTGGTCAGAGTA
GTCAGTAGTGGGTAGCCGGGCACCATCTAGTTCTTCTGGCCTCAGGCTAGAGGGAGCCAT
GGTTCATGTGGCCATTAGTCCTGTGGACTAATTGTTCCCCTGAGTCTTTGGTTTCCTTTA
CTCTCCTTTGCTCCAGGTAGGAGGATTCCAATTGTTGTGTCTTAGGTGGTCACTCACAAG
CTTTTAAGACCCCACAAGCTGTTCATCAAACTAGGATGTAGAACATTGTCGTTATGAGCT
ATGGTATGCCAGTTGAGCTAGGTGACCCCTGAGACTCTGGTCCTGAGCTTTCAAACCCAG
TAACTAAGTCCCACAAGGTGTTTCATTCAATACTTTTCCTATGTCCCACACTGAATAAGG
TGAAAAAAACATAAAAAGTAAAAAGTGGTGCCCTGGGGCTGAGAGCAGTGCAAATTTGCA
ACATTCATGCTATCATTTGTTAACGTTCATGCCCTCCTTCCCAAGCTGGTGCGTGGTGTG
GAAAAGTGGTTAAGGGTGCAGACTTTGGAGTCAGTCAAACCTGGGTTCAAGCTTGGCCGT
TTACTGGCTGTGTCACCTTGACTACTTGACTTCTTTTCACGTAAAAACAAGAACTACTTC
ACACAGTTGTTGGAAAGATTAAGTGAGAAAAACCTACCTCACGTTCTCACACGAGTCAGC
TCTCAGTAAATAACCATCCCATAACAAACAAACCCATTGCCGTCGAGTCGATTCCAACTC
ATAGTTGACCCTATAGGACAGAGTAGAACTGCCCCATAGAGTTTCCAAGGAGTGCCTGGC
GGATTCGAACTGCCGACCTTTTGGTTAGCAGATGTAGCTGTTAACCACTACGCCACCAGG
GTTTCCAGTAAATACCACCTGCTATTAATACTTCCTTCACCGACCTAAGTCCTTGTTGAG
AAGCCCAGTCAGAAGCAGAATACACCCCACAACCCTAGAAATAGCCAGGTGTCTGCTAAC
CCATTGCCCTTTTTGTGGAATGACACTCTCCTAACTCAGGCCGTTGCCAGCTTGAGGGAC
CAATTTCCCCACTGCTCTCCTTGAGCGCCCATTTACCTGCATCCCTCTTGGTCTGTTTAA
AGGACGCGGCACTACACGTGGAGTCTAAGAATGAAAAACTGGAGCCGGACCTGGAACAAG
ACACGAAACCAAGACTAGACAGTGTCACCAGCAGTGAGAGCTTCGCCAGCTCTGGGTTTC
AGGAAGATAAAAGCCTGAGTGATGTTGAGGAAGAGGAGGGTAGGTATTCGTTCCTTCCTG
TCCTACAATCGGAGATATTTTTACAACCTGCTGTGCATCTCTGACATTTTTTTCATATTT
ATCACCCTAATAAACATCCGTGGGAGACTTGCCGGGTAATGTCCTGGGGAGATAAGATTT
GAACTAAGATTATTTAAAGAGTTACTAATTTTGACAGGGAACTGTATAATTGCCTCCCTC
AGGCTTTTTTGCCTTAACGGATTATCCTCCCACCCCATCCCCTGTGTTTGGGTAGAATGG
GCTGGAGGCCCGGAAAAAAATCTCTGGTGTTCATATTGAAACCCGAACGCTCTCGAAAAT
GAACTCTGGTCTACTTGTTGGTTTGTTCTATGTTTTGCTAACATTGTTCCAATAAACTGG
GATTTGTTGGACTAGCAAGAGCCATTGCAAAACAGTTACGGTTTTAATACTTTCCAGATT
CTGACGGCTTCTACAAGCAGCCCATCACTATGGAAGATCTGATTTCTTACAGTTTTCAAG
TAGCCAGAGGCATGGAGTTTTTGTCTTCCAGAAAGGTCAGCCTTGCTTTTTACTGCGTTT
TCTTCTTTGTCAGGCCAGGGCACGTGGATATTCGCATGGACAAACACACACCTTTGCTAT
GGATCCACTTTTCCTGGTATTTGCTGATAGCCATGTTCTTAAGTGTAGAGCAGACATGAC
AACAAATGCCTTCATTCTGTCAGATTGCCAAAGCAGCCTTGCTATTAGGAGTTTTCAGAG
TGATGAGTCTTGGGTACCAGTGGGTGGAATTGAGTTCTAGGGGTAAACCTCACTGGGTTT
AGGACCAGACGAATTTGGCAGCCATTCTTCACGTTGCCTCCTCTGGCATATGCTCCAAAT
TGGCCAGACTCTGAGAACATGGTACTTGACGGGAGAGCTTCTATCCGTACATCCACATGG
AGCCCTCCCGTGAATTTGCAGCCGGATAGAGTGCTGATCCCAGTGCTTAGTACAAAAGCC
TGCAGGGAGTTTGTGCTCCTTCAGAAACCTCGCCTGGTCAGCTTGGTGGGTCAGGAGGCT
GGAACTCAGAACAGTAGCCCCTGCCAGATTCGGGGCACCTCTGGACTTTGGGGCCTCAGG
AGCCCTCTGTTTGTACAAAAGCATTTTACGTTTGTGGTGGCTGTATGTACACACAGGGTA
GCTTCCTTCACACCGTGTGAAATGGATCCTGGAATTAAGGATAATGGCACTGAGAAGGCA
CAGGAAATTAGTTGGCTGGATTAAGGAAGTGCGTTGATTATGCAACTGTTTTATTACAGT
GCATTCATCGGGACCTGGCGGCGCGCAATATCCTTTTATCTGAGAACAATGTGGTGAAGA
TCTGCGACTTTGGCCTTGCCCGGGATATTTATAAGAACCCCGATTATGTGAGAAAAGGAG
ATGTAAGTCGGTTGGATGTTTGCTTGACTCATTTATACCCTCTCATTTTTAAACCACAGA
CTGAGGCCCTTGGTAAATATTTACACTTCCCCGGCAGTAGGCCCTAAAAACCATTATGTG
CTTTCTGTGTAGACAAGCAATCCAGACGGGCTGTGCACCCAACAACCCTGTGTAAGGTAC
AGAGAGGCCGTGGTTTCCTGGTTCTGTTCCTCCCATAATTCCTGGGGGTACCTGTCCCTG
GGCTGCACTGCCTAAAGACTCGCTCCTCTAAGAAGTATTCAGTGGGACCCCAGGAGGCCG
GATCATTTACCTCTCCCTGGCTCCTAGGGGAGTTCCCTGAACTTCCGGAGAGAACAGCCT
GGACTCTTCCCCTTGAATAAACCCAGATGATTGATTCAGCAGGTGTATATGTCTCAGGAA
AGGGTGGGGATCTCACGGGGGAGGAAGTCGTTTACTTCCCACGTCTGCCTCCATGCCTGG
CGTGTCCTGCTGGCGCACATGGGCTTCTCTCCCCGCTTGTTTTTGGACATAGTGTTAATT
TTCACTTTTGTGGTGACCTCTTGTGTCCTTTCTTATCTGGCCTGTACCCGGAGGCCTTAA
GCTTATGTCTGGGTGCCACAGATTACCTGCAGGAGTGGTTCTCAAACCCGAGCGTGCATC
AGAATCACCTGGACCCCAGCCCCAGAGTTTCTGCCACAGTATGTCTTGGGTGGGACCCGA
GAATTTGGATTTCTGAGAAGTTTCTAGGTGATGCTGGGACAGCTGGTCCCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGTTCCACCTTCGCTGTCAGTTCCCATCCATCTATCGTGGCCAGACCTTA
CTCACTGGGGTTTCTCCTATCTGAAAGTAAAGGCAGATTTGTCTGCACACTTGAAGTCAG
CCGTCCATTCTCCTAGATAACTGCCTCTCGGTCACCGTCCCTCTTCCCAGTGCCTTTGCC
ACTTCCCCACTCACTGACTGTTGAAGTCTTATCTTTCTGCCGAGGCATGCCCTTCAAAAT
TCCTCCTTCTTAAGAAAAGCTCTTGGAAATCATGGATTTTCAGGATGTTTTCTAATTCAG
GTCAGTCTTTTCCAGGCCCTAAGTGGCCCCGTAGAAGGAGTTCTGGTAGCACAGTGGTTA
AAGCACTCGGGTGCTAACCAGAAGGTCGGCAGTTCGAACCCACCAGCTGCTCCACGGGAG
AAAGATGTGGCAGTCTGCTTCTGTAAAGATTACAGCCTTGGAAACCCTATGGGGCAGTTC
TGCTCTGTCCTACTCAATCGACTCAATGGCGCTAGGCTTGGTCTTGGCTTTGGAAGTGCC
CTTGCAGAGGGCAAGCTTTTGTTGGGAGAAGAATTTCTTGCAGACTTGGGGAGTTAGGAT
GTGCTGGACACAAGAGGCTCTGACTAGCCTTCCTAGGGATCGGTCGAGCACATGGCTACC
TCTTGTAGCATAATGCTGCATGCTACACGTTTTCCCAGTGTTGGGAAACTGAAGCTGCTC
TGGAAATGATGTATGGTTCAGGCCTAATCTGAGCAGCGACCCCATGGGCACTTGGGTTGA
ACGTGCCTTGTTTCCATGCCCTCCATGCTCAAGGCCCCTTTGCCCTTTCCTAGACTCGGC
TTCCTCTGAAATGGATGGCTCCAGAATCTATCTTTGACAAAATCTACAGCACCAAGAGCG
ACGTGTGGTCTTATGGAGTACTGCTGTGGGAGATCTTCTCTTTAGGTAAGTGCGGGGGAA
CAAAGAGACCCGATAGCCCAGAACCAGATGTCTGCATCTTCCACCAGGTGTCCTCTGGAG
CAGCACTTAGAATGACTGAACACCCTGAAGGAGGCGTGGGCCCACTTAGAATCTCAGATG
AGGAAGGGTGTCTGTGTGCACCCTGTGCCCTAAAGATAGCTTGTATGAACACGAGCGGGG
TCAGACCAGCCAGCCTGGGTCTCTTTCTGTATACTTTGCCCCCTTCTAATTCCTCAAACT
TCCAGATTTCCTGTGCCCTTCCCTCTTTCTACCCCGCGTCTCCCTGCCCCTCCGAGTTGT
TTCTCGGGAAAGGCCCTGACAGTGCAGTTGAACAGTAGGGAAGGTTCAGGAAGCAGGAGG
CCATTCCAGTGCCTCTGATATTAACAATTCTCATCGCGAGCCCAGGACACTGGTCGTATT
TATTCCTTTTCCAGCAACATGCAGTATGGGTGGCTAGAAGCCTTGCCCAAGGCCCCATGA
GCACAGATGTGCACAGAGCCCACATCTGTATGCAGACGCATATCGATGCTCCCAGGCGTC
CCAACTCGCGTTCCAGCCAAGAGTCTGTTGGGCTTTGCCAAAAATTTGCCTTTCACAGCA
AATAAAACTCACCCAGTAACATCTCCAGCTTCCTGTAATGTGTGAAAATCATTCCCCTGC
TTTCGATGACAGGCACCTGTTGCTTCCAGTCTTTGAAAGCAGCTTGGCGGCCGCAGTGGC
CCCACAGTGACACGGTGCCAGCGCTGCTCACCTCGCAGCTGCTTCCTACCAGCAGTGGTC
ACTGTAAAGTGCAGACAAACGCTGATGTAGCCTGCGCGGGAGGTTTAGAGCAGAGCAGAT
GGGGAGGCCTTGCCCAGACCCAGCCACCTCTGGGGTATCCCTCCCTCTCTCCAGTCAAGA
ATCCCCCAAAAGGAACAATCGCAGAGGATCTTAGACAGTAAAGCTGCCAGGGGCAAATTC
CAGAGCCCCTCTGGCACCCTCAAGTCCTTAACTTCCTGCCCACAGGTAGCCCCTACCCCA
CACCATTGCCCTAATCTTGGAGCCCAGGGCGGGGGGTGGGGGGCCCTTTTCTCTCAGACC
CATCATAACTCCTCATCCTCTAGTGCCATGAGAAGTTTGCAAGAAAGGGACTACTTACCA
TCGTTCCCACTGAGGTGTGAATGATCCACAATAGCCTCTGCTAAGTCTGTTGGCTTTCAC
AAAGAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTAAAAACGAGTTCCTCTGACAGTATCCCCTGATCTTCAGAGATGTCTCTGC
TGAGCCCCTGTGAGCCCAGCTGTAGTGAGAAGTGTTTTCCAGAAGCAGGACACAGTGTCC
TCGAGCCTTCCCCGCTCTTTCCTCTCCTGACCATGACATGACTTTGCAGCACCTCTAGCT
GAGAACGAGAAGTTAGAACCTCAGCTCTATGTTAGAAATCCAGACCACACTATAAGACTC
TGACCTCACTCAAAAAGAAGGAGCCAAATGGGTGAAGCAGCCTCAGGGATGAAGGGCTGG
AAGTGCTACTGACCTAGTCTCCATCCACACTGATGACTGACAAGGGGCTTGGCTTGGACT
GCAGGGAAGAGGTGTAGGAGAGAAAGGGGAATTTCCCAACTAGTAATCATTCTCCACAGA
GCCTACATGGAAAAACACAACTCCTTTAGTATCCTTTAGGGATAGGATTAAGGACCCCTA
GTGATGTAAATGGAGCCCTCATGGCACAGTGGTTAAGAGCTTGGCCGCTAACCAAAAGGT
CAGTAATTCGAATCCACCAGCTGTTCCTTGGAAACCCTATGGAGCAGTTCTACTCTGTCC
TGTAGAGTCACTATGAGTCAGAAGTGACTCAACAGCAACAGGTTTAGGTTTGTTTGTTTG
TTTTAGTGGTGTAAACAGTTAAGCACTTGGCTGCTAACTGAAAGGTTGGTGGTTCAAATC
CACCCAGTGGCTCCATGAGAGAAAGAGCTGGAAATCTGCTCCTGTAAAAATTAGAGCCTA
GAAAACTCTATGGGGCAGTTCTACCCTGTCACANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGGAGAAGACCTGGCAGTCTGCTCCCATAAAGATTACAGCC
TAGGTAACCCTATGGGGCAGTTCTCCTCCGTCACATGGGGTTGCTATGAGTCAAAATTGG
CTCAACAGCACCAGCAACAACAGGGAGAGCTATCGGGAGCTTCCTGGACCAGATGACTCC
TTGAGGTGCCTTCCTGCTGAACTGTCCAGTGAATCTAGGACGATGACAGGCTCCACGAGA
AGGCTCCCTCCACTGTGCAAAGAGTTACTTGCCTCTCTTGGGTCTTCTTTTTCCTGAGGC
TTTTGTGGATGTTTTGCACTTTGAGGCCCGGGCAGGAATGTGATGACGCTGGCAGTTTCG
CTGAGCTGCTGACAAGGACTTGGGCCTCCTGAGGCAGCACCACCTTTCCTGAACTGGCAG
CCCGCCGTCCCATCCCACCCACACAATGGGGTCCTGTCAGAGCCGTAGGATGGCCTTTGG
GGAGGAGTCAGAGAGAATGAAGGAAGTGGGGGCTTGGCCAAAGTGCAAGGTTGCAGTCTC
TTTCCTTCATCTTGGGACAACGCTCGGGAGACGCAGGACGAGGAGCTGGACCAGGCGGAC
GGAGAGCTCAGTCCTGTGGAGGCAGGGCTGGGCGCAGCCTGAGTGGGGAGAAGGAGGGGG
CTTGTTCTGGTCAGTCTTGCATGGTGTCCTTATGAAGAAAGTGCCAGGGACGTGGGGCAA
GGTCCTTTATGAGAGCTGGTGACAAAGCCAGATTACTCCCCAGGACATTGGGGCTGCAGA
GGGGTTGTTAATCACTTGATTCCTTTTACTTGCTGAGAGGGGCAGACTCCAGGAGACCTG
GTTCAAAGAGTAATTACTTTGCACTTTATGGGTTTCTAAGTGTATTCTAAGTGCTACAGC
TCCTAACCAAAGGGTCGGCAGTTCGAATCCACCAGGCGCTTCTTGGAAACTCTATGGGGC
AGTTCTACTCTGTCTACTCCTATAGGGTTGCTATGAGTCGGAATCGACTCGATGACACTG
GGTTTGGGTAATTGTATTCCAGGAGCCCTGGTGGTGCAGAGGTTAAGCACTAGGCTGCTA
ACTGAAAAGTCAGCGGTTGGAAACCACCAGCTGCTCCGTGTGAGAAAGCTGTGGCAGTCT
GCTTCCATAAAGATTACAACTTCGGAAACCCTATGGGGCAGTTCTACTCTGTCCTTCAGG
GTCGCTATTGAGTTGGGATTGACTGGACGGAAAGGATTTGTGTTTTTTAGTTGAAGTTCC
CAACAACCTTGAGAAGCAGGCAAGACAGATATTAAAGTCTGAATTTGATAAGTAATGATA
CTGAGATTCTGTGTGTTGTTGTTAGGAGCCATGAGTCGATTTTTAGCACATAGTGACCAC
GTGTGGCAGAGTCGAACTGCCCCACAGGGTTTTCTAGGCCAGATCGCCAGGACTTCTGCC
AAGCTGCTGGGTGAGTTTGAACCGATGACTTTCAGGTAGCAGCATAGCGCTGAACCATTT
GCATCACCAGGCCTTCTAGTGAGGTAGAGATAGGCAACCTTCACTACAGCGAATGTGCCT
TGGTGCGAGGGACCTCTGGCTTCTGTCTAGTGATTTCCCCTCCACCAGCTAAGAGGCTGA
GGAGACTGGTTTAGAACCCGTCTCTCTGGGTGATCTCCCTAGACCACAGGGTCTGTTCAG
TGATGCATGTACCCCATAGTCCTCTGTAAAATGTCCGCTCAGGCTTTGAAGCAAATATTT
CCTTTCTCTTTTCATATTATCTGGAAATTACAAGAGTAAATTCTTAATTACTGACGGGAA
TAATAATAGTAATTGCTAATAGTTGTTTTGTGCTCGAGTGTCAGACACTGCGAAACCCAG
AAAAACAAGGCAGTTCTGTCAAGTTCCGGCTCTCACAGGTTTCACTGTATTAATTTACCT
CACAACAGCCTATGAAGTAGGTACTATGATTTCCATTTTAAAGAAATGAGAAAACCCAGG
CACAGAGCACCTAAGTGATTTGCCCACAACCACATCGTTAGTAAATTATGAAAACTCAGT
CCGAGTATAGAGTCCACAAAGCCATTCTACATTCCTGCAGGGTGTTTCCATTCCTTACCC
AGGTTCTGGTCCCAAATAACTCTAGGGATACAAAGTCCCATCAGCTTTGAACTAAAAACT
TCCTTTGACTTTGTCAAACCTTCAGGTCTAGACATACACCACACCCAGGTAGCCCCTGTA
CCGGAAGAGGCTTCTTCTAGAGAGAAGGATAAGTCCTCAATTATGGGGAGGTGTTTATTT
GCAGATTTAAAAAAAAAAAAAAAATGAGCAGCTTTGTGACATGTTTGCTGAGAAAGCCAG
AATTCAGACCTTCAGCCCTTCCCTCCAGCACTGGAAAGCAGATGGAGGAATTTCCTTCTT
GTTTGTTCCTACAGTAGGAAGGTCTGGGTGAGGATGGAGTACAGCTTCTCAGAATTGGGA
AGCTCTTGATCTGAACTTGGCCTGAAGTGGTGTGTACTTGGGAACTTGGGTGATAGCTTT
GGAGAGGAAGCTCTTCCCACAGGACCTTCGCCACCAGCTTATTTCAAGAAGGGCTGTTGG
GCGGGGCACCACTGCTGTCTCTTTACTTTATAAACCTGTTTACTTAATGATGTAAAACTG
TGTAACACTGAGTCGTTGGTTCCTGGCCCAAAGCCTGTTTAGTCAGATGTCTTTCAATAA
GGGAATGAGCAATGCTTTGATTTTTTTTTCCCCCCTTTTCCTTTGGTATTTGTTGAGATG
AGTTGCACTGAATTTAAGGCAAAAGGAGTGCAAGCTAGAGATCAGAACCCAAGAATCAAA
AATAAAAAAACACCAAGTAGTTGTAGGTGGCCCCTCTTGCTAGTTTCAGCAGACAGGAAC
CAGGGAGAGCCCTGTTCACAAAGCACCCACCCCTCCTCCTGCCTCAAAACAGCTGCCTGC
TAAGCGGTGAAAGGGTGATGCTGACCAGGATCACCCCAGGCCTCTGCTTGGTGGGATGCT
CTCTGCTCTCAGGGCCACCTTTTGTTGCCGGGCTTAGTGGGCCACGCCTTTCTTTCTTTG
GCTACTTTCTGTAGATTATATTTAATGTTTTTATTCTGTCAGCCTCCAAGAATCTATTTA
TTGCTGGAGATAAAGGAGCCTTGGAGGATTAGACTTGAGTGCTGTTGTGAGCTGCCATGG
AGTCAGACTCATGGCTACCCCGTGCACCACAGAAGGAGATGCTCCCCGGTCCTGCACCGG
CCCCATGATTGGGTGCAGACTGGATCATTGTGATCTGTAGGGTTTTCATTGTCTGATCTT
TGGAAGTAGATTACCAGGCCTTTCTTCAGTTCAGCATCATAGTAACACGCAAGCCTCCGT
TGAACCCTGGTCCCTTGCATGCAAGGCGAGAATTCTACTATTGAAATAGTACTATTTGAG
TATACCCATGTACCCATTGCTGTCGATTCTGACTCATAGCGACCCTATAGGACAGAGCAG
AAATGTCATAGGGTTTCCTAGGCTGTAATCTTTACAGAAGCAGACTGCCATCTTTCTCCC
ATGGAGCAGCTGGTGGGTTTGGCTAGCAGCTGAGTGCTTAACCACTGTGCCACCAAGGCT
CCTTACTTGAGTGTAAGTAAGGTGGAAATAGGCCAACCTCCACCACAGCCAACGTGCCTC
ACTGTGAGAGACCTCAGACTTTTGTCTAGTGACCACCTGCATCTGTGATATACATTTTTA
TACCTATCTCAGTCCATTAGTAAAATGTATATATTTACCTTAAAACGAGTTCCATATAGA
ATTGTGCAGACATCTGGCTGCTAGGAGGTCAGCCCCAACTGCCCGTGGGTCCGGTCCTGG
CACCACTCAGAGGCAGCGCCTGGAGCCTACACGCTGAGGCGCTGCTGGGCAGAAACAGTT
AGGAACCTTGCACAGCTCTGGCTCCCTGTCCTGTGTTTCCCAGGCAGCAGGGACAACAGC
CCAGAGTTAGAGAATTAGAGTCTCTTCTCTCCTCCTCCTTCCCAGTGTCCCTAGTTTCTG
TCAGGTGACTCCCATACAGTGGCTCCCCTCCCCCACATCACTTTCCAAAGGGCTCACACA
GCTCTTGGAACCAGCTGACCCTGGAGTGAAATAAAAAGGCACAGCGGATGAGCAGAGGTG
TGGCAGGGAACCAGGCATCGCCTTCTGAGAGGAGCCTTGAACCAGAGTTTTCAGAAAAGG
CAGGGGAATCAGAGATTGAGGCATGTGATCTTTGAGCTCATCAATCAAACACTTAGGATC
TCTGCCTGCTGGATACCTGTCAGAAAGTGCAAGCTGAATTCCATGGCCAGCTGTTAGGAA
AAGCGTGCTTTTGAAGAGCAGTGTGCTGGGAGGGTTGTCTGAAGGCCTTGGGTGCCCTGG
GTGATGGCAGTGGTGGTTGTGCCCCATCAAGTCGATTCCAACTCATAGCGACCCTGGAGG
ACCAAGTAGAACTGCCCCATAGTTTCCCAGGCTGTCATCTTTAGGGCAGCAGACTGCCAG
GTCTTTTCTCTCCCAGAGCGGCTGGTGGGTTCAAATCAATGACCTTTCTGTTAGCAGCCA
AGCACTTTAACCCTTTTGCCACCAGAGCTTCTTTTCTCCTGGGTACCTAGAACGTTATCC
TTGGATTAAACCAGAACCTCAGGACACACACTGGGCCCACATTGTTTTGCCTGTCAGAAC
TGTTTTTACTGAATGGTATATTCCGCTGTTAAAGCGTTGGCCAACATTGAAAGGCAGCGT
CTAACGCAACTCCATGAAGCCGTTCCTGGATGGGAGGAGACATAGAGGAGAGCCTCACTT
CAGATTTTAGTTTTAGGAGTAGCCATGTTTCTTCTGAGTAACCGGTTTGTTTTTAACTTC
TGAGTTATGTGCATTGTGTAATTGATTACTCCTTCTTTTCGCCACCTGCCTAGAAGCTCA
GAACCTGCCCTCATCAAAGTACTCAGAATCATGATATAAATTTTGTATGTTAAGTTTGCC
TGTAGCTTCACCCTTCTTATCTTTCCATTACCTGCCTCCTGATATTCTTCCTTTCTCTTT
TTTAACCTCCCTGTACTCTTACTGTCTTTATCAGCCACCTCGTATACTTTGAAACAAAAA
TAGGGATGTAAATAGATTAAGCGACTGGCTGCTAATTGAAAGATCGGTGGTGGTTTGAAC
CCCCCAGCCGCTCCATGGGAGAGAGATGTGGCAGTCTGCTTCCATTAAGATTACAGCCTT
GGAAACTCTTTGGGGCAATTCTAATCTGTCACATGGGGTCACTGAGTCAAAATTGTCTTG
ACGGCACCCAACAATGTGGACTTACATGGGTCACAAACACAGTGTGCCTTCCCACCCGTC
TCCACTGCTAAGCTCAGTAATGGAATGTGAAGACTTGAAAACCCTACGTGCTTATAAAGA
GCCCCAAGCCAACCTCTGTTACAACCCAAGAATTGAATAAGTACTGGAAACTACTCACCC
ATTGATATCTGTGGCTATGCTGACTTTGTAAACTTTAAGGGTACTGCCTTGCTTTTGAAA
GTGAGGAGAGGGTGGGGAGTAGGACTTCAAATCAACAATCTAGACATGAACAAATCACTT
TGTTTGGTTAACATTAGAACTCAGGCCTTCCACTCTTGCAGAGACCGAAGGCACTCCAAG
AGCCTTGGGTGGAGATGGACTCTGGAGTATGGGTCTATTACTCTCCCTTTATGACAGATG
TTTTCCATGGCCGGCAGGGCCTGGGCCAAACAACCTTTTATGTGTTGGTGCTGCACACCG
AGACCTAAAATCAAGGCAAATATCATAGCCTACAAAAACCATAATCATAATTTGTATAAC
AATACCCAGTCACGTTGTAGGGCTATCTATAGAATGATCTTGGCTCTCCAGCTCTTTCTC
TTGTGCTTCTTCTCAACAGCTATCAGCTCATGTTGGACTGCTGGCACAAAGACCCAAAAG
AAAGGCCAAGATTTGCAGAACTTGTGGAAAAACTAGGCGATCTGCTTCAAGCAAATGTAC
AACAGGTAAAGCTAAATTTGTCTAAAGTATGAGAAGGCCAATGCCTTTTTAAGTCAGGGA
GGTGTTTTGTTCATTTTTTGTGATTTTTATTTTGTTTTATCATTAGAATAGCTGAGATCA
GCAGTAAAAAAATACATGTATATGTGTGGATGCAGAGGTAGTATCCCTTAACATGTCCCA
GACACAACCAAGACGGTGTACATGACATAAAGATGGCATAATGCTTCACAGAAGTGGGTT
GGTGTGAAATTTTGTGCCCTGAGACCTTCATCTTTGATGTTTTAGGATGGGAAGGACTAT
ATCCCACTCAATACCATCCTGACAGGAAGTAGTGGGTTTACATACTCTACTCCTGCCTTC
TCTGAGGACTTCTTCAAGGAAGACATTTCTGCTCCCAAGTTTAATTCAGGAAGCTCTGAT
GATGTCAGGTAAGATTTCTTTCCCTGATGTTCTGTTGTAAAGTTTTCAAACATACAAAAA
ATTAAAAGAATTTTATAATACTCATATGCTCAACTCCTAAATTCAACCATTGTTAACATT
TTGCCTTATTTTGTCTGTGTGTGTATGTGTATTTTTTCTTTTTGCTGAACGATTTGAAAG
AGGGTCTCAGACATTATGACACTTTATCCCTCCTTTGGAATACAACTTCTAAGAAGGACC
TTCTCCTGTATAACCACACAGAAATTATCATATAGTAGTATAAAAAAAAAAAAAATTTTT
ATTAGAATCTCATCTAATATGCAAATTATCATAATTTCCCCCAAATGTCTTTCATACCTT
TTTTTAAAAAAAGTAGGATCCATTCAAGATTAACACCTTGAGTTTGGTTCTTATGTTTCT
CGAGTCTATTTCACTCTGAACAATCCCCCCATTTTTTTCTATAACATTGATTTTTCTTGA
CCAACCGAACAAACAAACAAAAAAACTTTTTTGGCTTATTTCCCCTTACTTAACAAACTA
GCATATCTCACATTACTGCAGAGGTAACTGGAGAAAGGGCATGAGAATAAACACGAGTGC
TCGTGTTGGGCCAGGTTTCTGTATCTCATACATTGAGTAATAGCAGTTACATGTATGTTA
AACATTTGGTGTGGTTCTGGCAATGTGCTAGGCTCTTTGCATACATAGCTCCTTTAACGC
TCAGATCAGCCCCATGAAATAGATATTACTATGCCTGCTGAACAAGTAGGATATTCAGGT
TTTGAGGAAGGTAGCTTGCCAAAATTATGTGGCTATAAAGTGGCAGAATAGAGTTTCTTA
GCCAAATGTTCTCACACTCCCTCCTGTACCCAGTCCAGTCAGGAACCCCTTCAGATTGTC
TTGTGAGCATTCTTGCATCTTGAGCTACAGCAAGCACAGCCAGCTTTGATCTCAGTTTCG
CCAAATTTGGTAGGTGGCCAGGGAGGGCATGGTGAAGAGCTACGGTAGCCTGAAAATATT
GATCAGCATCTATGAAGGCTTAGAAGCAATGTGTGGCCAGTGCAGACTTGTGCTAATGGG
TTATATGTCAGTACACTGTTCACACTGACCTGTAATCCATTACCACAAGTCTGGGCTGGC
CACCAGATATCTTCAACTCCTTAGTAGATGCCTATCAATACTAACCCAAGATGCTAAAGC
AGATGAGTCATTCATTTTTTATGGATGAGAAAACTGGTTGGGATGAAATAAATTAGTAGA
GTGTGATTGGGCCAGAGATGAGGGCTGGGGGTGTCAAAGTAATGTGGGTCCTGCTCAGCT
TTGGACCACTAGTATACTTGCCTAAGAAATTGGGCCTTGCAGAGGGTGGCAGAGGACCTC
AACCATTGACTCTACAGTGGATATTGCTGATGGTCCTTCCTAATACATCATCAACAGAAG
GTCAGTAGGTATTTGTAGGGAAATCACACAAGTGCTACCCATTCCTCCCAACCCGTAATC
ACAGAACAGAATATATAAGACAGGCCCTAGTACTCAACTATGCCATTAAATCAGGCTGAC
AGGTTATTTCATTTGTCACTTCATATCCTGTTAGAAAGTAGGCAGCTATAAATGATAAAA
GTCATATCACTTCTCGGGGCATCATTTCTCTTCCTTGTAACATAGGGTGTTTAGACCAAA
TGATGCCCCAGGTCTCTACCAGCCTTGCTTTTCTAAGTCCACAAGCCTTTGACCACTACA
GAGTCTTCCAAAGATCCCTCTGGGCTTGACATCATGGTAGAAAGTGGCATTACCATTAGG
ATTCCCAGAGGACCACCACAAGAGAATTTCAGTCTCAGAAGGAGTTAGGTGATTCCTGCT
GGTGTTTTGGTTTATCTTAACCCAGGATACAGAGTCCCAGGTCTCCTGACTCATCAAAGC
TGGACAAAGCATTCTCCTGCCCTGATTATTCTTTCTACTTCTTCATAGATATGTAAATGC
TTTCAAATTCATGAGCCTGGAAAGAATCAAAACCTTTGAAGAACTTTCACCGCATGGCAT
CTCCATGCTTAATGTAAGTAATGAAGCTAAGCTGCTCACCGCACACTGCAGAACCTTCTG
CCAGACTTCATCCAAACACACACTCCAGACTTCAGGTGGCTCTAGTCAACAGGGGTTAGA
GGTGGCTGAAATGACACTAGGGGGACTGACAGTGCGGCTTAACTGTGCAGAGCCAATTCG
AAAGTAGAATTCCACGGGTGGAAGACCCAGAGTTCCCTCCAGGGTCCAACCTCCAGGGTC
TAACTCATTGTCTGGTAGTAATTCTGTCCCTTAGGAAACGTCATTATCTTGGCAGTCACT
GTTGCATCAATGCAACATTGCTTTCAGAGTAGTACAGAGTAACTCCAAACTACGTGACCT
GCTGGGCCTTGGCGATTATAACAGAGAGCTGTCTCTTAAGAGCAGCCTGGAGATTTTGGA
ATCATTCTACTTATGTCTTATGCTCCCTCCCCTTAAGGTTCTGGAAGCAGACCAGCCATA
CTCCTAGCCAGCCACACCAGGAGAAGCAATCCAGTAGATCCTAGCAAACAAGAGGTCTCA
CCTAGCTCTGTCCTTCCAGGCCCTGGGACATGTGGTCAAGAGAACAGGGGGAGTATGGGG
GACTAGCAAGAGTGCGTCTCTGGTCTTGTAGACCCTGGTTCTCCAAGTGTGAGCTCTGTG
GTCATTACCAAGGCTTTTAAAATGCCATTTCTGATTTACTGTGGACTTGACTATAAAAAA
AAAAAACTTCCCACTAGGTTCTACCTTGATGGCATTCAACCGTTTGGGAACATTGCCATT
GCCTAGATCAGCGCCAGTAGAAATATAATTTATGCCACGTATTATTTTCTATAAGCTTTA
TTGTCTAGACTCAATAAAATAGGGAAAAAAAAGTGTGGTCTCTGGACAAGCACTGCTGCC
ATGATCTAGGAGCTTTCAGAAACGCAGGCTCCCAGGCCCCGCCCCAGGCCTCCTGAACCG
GTTCGACAAGATCCGCAGGAGATTCGCGTGCACACTAAGGTTTGAGAAGCACTGGCGACC
ACTGCGTCCCATTAAGGGCCTGAAAAACCAACTGAGGTGTGAAGGTGATCACTGCAGAGT
GCAGCCTGAGCCAAAGCAGAACCACCCTCAAAACCACTGCAACCTTCTCAGAAACAGCAG
AGAAAGAGGAAAAGAGGCTTTAAAAATATTTTAATAACATTACAAATAAGGTGCAAAACA
CAAAGGTAAAGGAGATGGAAATTTGGTTTTGCTGTTTGGTAAGGAGCCCTGGTGCACAGT
GGTTAAAGCACTCGTCTGCTAACTGAAGGGTCCGCGGGGTTCAAACCCACCAGCTGCTCT
GCTGGAGGAAGTGCGGACAGTTTGCTTCCGCCAAGGAATACTGAAAAAGTGGCCCGTTTC
CCTCCACCTTAACCCTTTCCATCCTAATGCGGTGATGAAACATGATAGTTGCCTTCTTTG
CTTAGGCTTGTGTGGTGATACTAAGGACAGGAGCACAGCCCAGGAGGAACCCAGAGGGTG
GTAGGGACAGTGTGGAATCCATTTACCACAACACGCTGTCTGAACAAAGTGATGGGAAGT
CTGCATAAAACTCGATGCTAAAGATGAATCAATGAGGAAAACGAATTGCTGGAAACCATG
ACCACGGAGGACCTGAAAAGTCTATGGGAATCTTTCAAAGAAAAAAAAAATCAAATGATG
TCTTTTAATTTCTTAGAATTTTTGCACATCATGGCCCTAAATAACTCAGCATACCAATAG
GCAATCTTCATCTGCCAAAGTTAGCTTTAATATCTTCATGCAATAATTTGTGTAACAGTG
TACTATGGAAAATGCTAGCCTGTTACCTGTAATTTTCTTTCTTATTTAAGCTAAGGAAAG
TTAGTTTTCTTTCCCCTCAGGAACCAAAAAGCCAAAGCCATTGCCATCAAGTTGATTCAG
ATGTATAAAACACAGTACAATTGCCTCATAGGGTTTTCAAGAAGCAACAGGTAGATTCAA
ACTGCTGACCTTTTGGTTAGCAGCCAAGCTCTTAACCACTGCACCACCAGGGCTCCACCT
TCAAGAAGAAGCCTCAAAGTCACTGGGTACAGACATTTCTTGCAACTGACTAAAGTTTGG
GGTCATGAATGTGGAGAAAGGGCTTTGTCTCCATAGGCAGGGACTGTGCAGGCTGAGGGC
AGGGAGTGCAGGGATTCCAGACATGCAGCCCAGTGGCTTGGTGTGAACCCCTCTGGGCCA
GGCAGAAGGAGCCCTGGTGATGCAGTGGTAAAGCGTTCAGCTGCTAACCAAAAGGTCAGC
AGTTCGAACCCACCAGCCACTCCATGGGTGTCTGCAGCAGTCTGCTTCCGTAAAGATTAC
AGCTTTGGAAAGTCTATGGGACAGTTCTGCTCTGTCCTGTAGGGTTGCTATGAGTTGGAA
TTGACTCCACAGCAATGAGTGGTGAATGTGTGGGCCAGGCAGGAAGTATAATATCTTCCT
TCTTTCCCACCAGGATTACCGGATGGACAGTAGCACTCTGCTGGTCTCTCCAGTGCTGAA
GCGCTTCACCTGGACTGAGAGCAAGCCCAAGGCCTCCCTGAAGATTGAGTAAGAAAGCGG
GTGTCTTTTTTTTTTGATCAGGTGTTGGGGTATGTGAAGGAAGATGTCAGAAAAGATGGT
GTCACGGCAGCTACTTGAGGGCTACTTGCCCTCCTTTGTTTTCCACCAGAGCTATAACCA
AGCCAACCAAACTCGAGTTTGGTTGCCATCAAGTCTACTCGGACTCATAGTGACCCTCTA
GGTCAGAACAGAACTGCCTTACAGAGTTTCCAAGGAGCAGCTGGTGGATTCTAACTGTCG
ACCTTTTGGTTAGCAGCCAAGCTCTTTAACCACTGTGCCACCAGGGCTCCACCAGAACTA
TAGTGTTCAGGAATTTTAGAAATGGACTTTTTTTTTTTTTTTTTCAATTTTTATTGTGCT
TTAAGTGAAAGTTTACAAATCAAGTCAGTCTCTCATACAAAATTTATATACACCTTGCCA
TATACTCCTAATTGCTCTCCCCAATGAGATACCACACTTTCTTTTCGTGTCCTCCACTCT
CTCTTTTTGTGTCCATTCCACCAGCTTCTGACCCCCTCTGCCCTCTCATCTCCCCTCCAG
ATAGGAGATACCAACATAGTCTCATGTATCTACTTGATCCAAGAAGCTCATTCTTCACCA
GTATCATTTTCTATCCCTTCGTCCAGTCCAATCCCTGTCGGAACAGTTGGCTTTGGGAAT
GGTTCCTGTCTTGGGCTAACAGAAAGTCTGGGGACCAGGACTACCAGGGTCCTTCTAGTC
TCAGTCAGACCATTAAGTCTGGTCTTTTTGCAAGAATTTGGGGTTTGCATCCCACTGCTC
TCCTTCTCCCTCAGAGGTTCTCTGTTGTGTTCCCTGTCAGGGCAGTCATCAGTTGTAGCC
AGGCACCGTCTAGTTCTTCTGGTCTCAGGCTAATGTAGTCTCTGGTTTATGTGGCGTTTT
TTGTCTCTCGGGCTCATAATTATCTTGTATCTTTGGTGTTCTTCATTCTCCTTTGCTCCA
GGTGTGTTGAGACCAATTGATGCATCTTAGATGGCCGCTTGCTAGCGTTTAAGACCCCAG
ACGCCACTCTCCAAACTGAGATGCAGAATGTTTTCTTAATAAATTTTATCATGCCAATTG
ACTTAGATGTCCTTTGAAAGCACGGTCCCCAAACCCCTGCCCCTGTTATGCTGGCCTTTG
AAGCATTCAGTTTATTCAGGAAACTGCTTTTGGTTTAGTCCAGTTGAGAAAAGCACTTTT
TTTTTTTTCCAGAAGGGAAAGAAAGTGGGCATAAAACTGGACCCATGAATGCCAAACTCT
GGGGATGAAGGCTTGGGGTTTAAGAGAAGAAAACATGCACGAATTTATAGCAAAGATGGG
AAATCCAGACCAGGGCTTTGAATTGGTCCATTCTGGTTCAAACCTCTGCTGAGAATTTGC
ATTTCTAACAAGTTCTCTGCTGAGAATTTGCATTTCCACCCCAGGTATACTGAGTCAGAA
TCTACATTTTAACAAGCTCCCCCAGGTAATTCTTAGGTATAACTTCTTGGGAACTTGTTA
GAAATGCAAATTCTCAGCAGGGTTTCAACCTGGAATGAACAGGTTGGAAGTCCTGAGCAC
ATAAAGCCAGTGTCTTAGTTGAAAACAGCCTGATTTGCACATTTGTGAAAAGTGAAAAGG
TGGGAAAAGTCATATGAAGACTCTCTTCTGGGGGCAGGGAAAGGATGCGGCCCCATTATT
ACGCTCTGGGCCAGGCAGTTTGCACAGGAAGGGCCATAGTACTGCTTTGCCAGACTGAGA
ATGCCACTCTAAGGACCCACCTTTTCAAATGAAGCTTTCTCTGCTTCCTGTTTGACCCTG
GGACCTTTCTTCACACTTGACGATTTCTCCAGGGGCCCCTGGCTTGCCAGTTAGCCCCTC
CCTCAATACTGTGGAGCCCTAGTGACACAGCGGTTAAGAGTTACAGCTGCTAACCAAAAG
GTTGGCAGTTCGAATTCACCTTAGAAACTCTGTGGGGCAGTTATACTCTGTCTTATAGGG
TTTCTATGAGACGGAATTGACTCCACGGCAACAGGTTTGTTTTACTATACAGTGGCCGTC
TGCAGCTGCTGTCAGAGTGGCCCGGGTTCTCGCTTTATGCTCCNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCTTGTGGGCCGTGCAGTCTCTTTTGCAACTCCTCATCTCTGC
GGTTGTCGCGTGGAAGCAGCCCTAGACAACGCCTAAGCAAGGAGGCCTGGCTGCGTTCCA
GTGAACATCATTTACCAAAACAGGTGGCTACGGCCGATGGGCACATACGTGAAAAGCTGC
TCAGCATTAGCCCTCAGGGAGATGCAGACAGGAACCACGAGAAGCCACTTCACACTCACT
AAAACCAGAAACCAAACCTGGTGCCATCGATCGATTCCAAACCATAGCAACTCACTAGGA
TGGCTGTAATCAAAACGTCAGACAGTAACGAATGTTGGCTAGGCTGTGCTGTAATTAGAA
CTCACACACTGCTGGTGAGAATGTAAAATGGTACAGCCGCTTTGGAAGACAGCCTGGCAG
TTCCTCAAAAGGTTAAGTATGGAGTTACCACCCAAAACACACCCATTGCCGTCGGGTCGA
TTCCAACTTATAGGACTCTCCGATGCTATAGGACAGAGTAAAGCTGCCCCATAGGGTTTT
CAAGGCTGTAATCTTTATGGAAGAAGACTGCCACTTCTTTCCTCTGCAGAGCAGCTGATG
GGTTCGAACTGCCAAACCTTTCTGTTAGCTAAGAGCTTAACCACTTGACCACCAGGGGCC
TCCTTACCATATGACTCAGCAATTCCACTCCTGGGTATCTACCCAAGAAAACTGAAAACT
TAGGTCCACACAAAAATTTGTAAACAAATATTCATAGCATTATTTATAATAAACAAAAAA
TAGAAACAACCCAGTGTCCTCAACAGATGAATAGATGAACCAAATGTGGTATGCCCATAA
AATGAAATATCATTCATCACAAAAAGCATGGAACAAGATACAAGCTACAATATGGATGAG
CCTAGAAAATGTTATGCTAAGTGAAAGAAGCCAGCCAGAAAAGACTACATGCTGTATGAC
TGTATTTATATGAAGTGTCCAGAATAGAAACAGAAAGTAGCTAAGTGGTTACCTCGGGCT
GGTGGGGGAGGAGGAGTGGCTGCTAACGGGTATGGATGTGGGCGGTGTTGAAATGTTCTA
AAATTGATTGTGGTAATGGTTGTGCAACTTTGTGAAAATCCTAGAATCCACTGAATTTTA
CACTTTAAATAGGTGAATTGTATGGCACGTGGATTATATCCCAAGTAAGCTGTCATTCAG
AAAAAAAAAAAGGCGGCTAGCTCAGAGGTTATAGACTGCTGTTTCTCCGAGATCTAAATC
GAAGATGGCAGCAAGTGCCTTCAAAAGATATACACTGAAACCTGTGAGAGCCGAAACTCA
GGACTCCAAAGTTTTCCACTTTGACAGGGTGCAGTCTTAGCATTTTTCTGTCATTCTCTA
TTAATGGAAGATATTTGAGTTGTCCTTCTCTGACAAGTTTCCGCCTTACGCAGGTTCTGG
TTTTCACCGATTTTACCGTAGTTAGCACAGTGCATCACCACAAGTAAACTGAAAGGACAG
GAACACTTCCAGGCCAATATTTGCGTGTTTGTTTCCTTCTAACGTGAGTATTATGATGGT
ACCAGAGAGGGGTCACAGCAGGTAAGAGGACAGCCAATGAGGAATGAGTGGACAAGGAGA
GAGTTGGATAACATGCCCTTTTACTTGCTATTTTGGAACAGTTCAGAAAATGCATGGCAA
CTTTCACCTATATCTTTGTGGAAAAGGAAAACCATAAATTCTACCCTCCACTCTGACACT
AAAAATATAAAACGTGGACCAATCCCATGATATGCTAGTCTAGAACCAATCTACCTAACA
TGGCGACCCCCTCTCATCCCAGCCCCTATTTAAAATAAAAACAGCTTTCAAACAAATAAG
AAAGGACAAGAGCAGCTTTCCTTCTTCATATATTTGTCTCAAGCTGGATGTAACATACAG
AACCTGGAAGCAAGTTTCTCCACCCCGAGCCTCAATAGTGATATGTAGCCCAGTGACTTA
CAAGCCTTCTGCTCAAGAACACAGCATGATGGGGTGTCACCTGCACTAACCTTTGTGTAT
CACTTTCCTGAGGCTGCATAAACGTGGTGGCCTAAAACTGAAATGTTTCTTCCTTAACTC
TGGAGGCCAGGAAGTACGAAATCACGGTACCAGCAGGCCACACCCTCTCCGAAGGCTCTA
GGGAAGGACCCTTTCTTTGCCTGTCCCAGCTTCTGGTGGCTCTAGGTGTTCCTTGGCTTG
TGACTGCATCACTCCAGTCTCTGCCTCCGTGATAACGTTGCCACCTCCTGTGTGGGTCTT
CTCAAAACTCCCTCTGCCTCTCTTAGTCGTGGTTGCCTTTAGGGCCCACCACATAACTCA
GGCTGAGCTCCTCCTGTCAAGAGCCTTGACTTAGAAACATCATTTGCCATATAAGTTTCC
AGGAATTTGGTGTGCATGCGCTTGGGCCACGCTTCAGCCTACCACAGAAGCTAAACGACC
CCTGGGTACCAAGCTGTACCAAGTCTTTGAGTTCTTTCCTACCTAGAATCATGAATTTGC
ATTGTCTAGTCACACACATGCCACACTCCAGCCAGTGGCGTGCACCTTCCTGCCCAGTGA
CACCAAGCTGATCTTAAAGAGGTAGTATGCAGCTTAAAGGAGCCCTGGTGGCGCAGCGGT
TAAAATGTTTCGCTGCTAACCAAAGGGTCAATGGTTCGAACCCACCAGCAGCTCCGTGAC
AGAAGATAACAGTCTTGGAAACACCTATGGGAAAGTTCTACTCTGTCCTCTAAGATTGCT
GTGAGTCAGAATCGACTCAACAGCAAGGGGGTTGGTTTGCTTCGGTTTTAGTGTTCACCT
TGAGGACAAGGAAAGTCTGACTGGAGATGGAAGATGAGGTTCAATAACCATTCACTTTGG
GACAGGCACAAACAAAAGGCCCACTCAGAAACTCAAGAAACCAATTTTTACATTTGCCTT
TTTTTCTTTTTTTCTAGCTTAAGAGTGACCAGTAAAAGTAAGGAGTCGGGGCTTTCCGAC
CTCACCAGGCCTGGTTTCTGCCACCCTAGCTGTGGGCACATCAACAAGGGCAGCCGCAGA
TTCACATACGACAACTCGGAGCTGGAAAGGAAGATCTCCTGCTGCTCTCCGCCCCCAGAC
TACAACTCAGTGGTCTTGTACTCCACCCCACCTGTCTAAAGGTTGACACAAAGCCTTGTT
TCTAGAAGCACACGTGTATTTATAGCCCCAGAAAACTAGCTTTTGACAGTATTATGCATA
TATAAGTTTACACCGTTACCTTTCCACAGGAAAAGCCAGCTGCTTTTTTGTGATTTTTAA
TAGTGCTTTTTTTTTTCTTTGACTAACAAGAATGTAACCCCAGATAGAGAAATAGTGACA
AGTGAACAGCGTTACTGTTAAATCCACATATTATGCAATGTGTTACAGAAATTCTTTCTA
AGCCCAATGACTGCCTGTGCCAGCCCCCAAGACCTCAGGGCACAGAGGGCTTTGGATGAT
CCAGGAAATACACTGACCGAGCCATGCAGCGTGGATGCTACTGGCCAGCCCCTCAAGCTC
TAGAACTAGGGGACACCCAGCCCTGTAGCCGCAGGGATCACGAGCTGGTCTAAGCAGTGC
CCCTGGGGCCTCCAGCAGGCGTAAGCATATAAGGGGGCAAAGGGAAAAAGGAAGGAGCTG
CAGAAAAGAGAAGGCACCAGAAAGAATCTGAGATACACCACACAGGAAGGGCGTGGGGGA
AGGCTCTCAACAGTGCCACTTCAGTGGGTCAGAGGGATGAGGGGGCATTTTCTGGATTCT
GGGAGGGAAGACAGGGACAGACATATTCTTTGGAACTGCAAAGCCAATTTGAAAACATTA
CCTGTGGGACTGGGTCTCTGCTCATTCCCACAGGTGGCAAGTTTTGGATTTCTAGCACTA
AGGGTGGCCCGTACTGCTGAGTCCTTGAACAAGATACACTGAAAATTCAAGATAAGCACA
GCTCTCTTGGCTCCTTGCCGTGATGGCCTTATACTTAGCACATTGCTTATAGTAAGCTAA
CTGCAACGAGTTTGGTCTGTTAGGGTTATCTACTGCTGGGCGCAAAGCCCTTTTTTTTTT
TTTTAATGTCAGATTCTATTTACAGTATTAAGACACTTAACTCAATTTTTGTATCATCCC
ATTTTGTACAAGTTACTTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1095, 1808..2034, 33911..34035, 34629..34791, 34893..35029, 37941..38115, 39714..39831, 41965..42134, 43595..43754, 64122..64236, 78309..78417, 86537..86845, 91532..91678, 121531..121662, 143575..143681, 146939..147071, 153896..154000, 157475..157588, 159835..159923, 165542..165698, 166137..166234, 166979..167101, 168833..168944, 170569..170668, 177979..178084, 178365..178507, 180468..180552, 183013..183107, 188357..188558
1001..1095, 1808..2034, 33911..34035, 34629..34791, 34893..35029, 37941..38115, 39714..39831, 41965..42134, 43595..43754, 64122..64236, 78309..78417, 86537..86845, 91532..91678, 121531..121662, 143575..143681, 146939..147071, 153896..154000, 157475..157588, 159835..159923, 165542..165698, 166137..166234, 166979..167101, 168833..168944, 170569..170668, 177979..178084, 178365..178507, 180468..180552, 183013..183107, 188357..188555
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved