Loxodonta_africana Locus ENSLAFG00000000425
snOPY snoRNA Orthological Gene Database
Loxodonta_africana ENSLAFG00000000425
Loxodonta_africana
ENSLAFG00000000425
GeneScaffold_5444
SNORA3
3827..3956
5191
TCTTTATGTCGGGTAGATTTGCAGTTTGGGGTGGGGTCACCTGAGGTAATGCTAACCTC
CTTCCAGGAAACTGGAAAGTAAGGGAGGATCATTTGAAGTTATGTTTCAAAGACGTAGCT
GCCAAATCCTTGAGAAAACATCTTAGATTTACACACTTTACAAAAACACAATGAATTGAC
AAGTTAAGGAGTCCAGTGGGCTTCTGAGCAGTACTATATCAGAACGGAAGTGGGGAGGAA
GGGCCGTGGAAAGCTTCTCAGGGCATGACCTCAGAGTCGAAGCTTGAAACAATGTGAGTT
ATGAAAGAACAACGGGTGAGGAAAGCCTCTTGCCTTATTTTCAACAGAGTTTGTATTTTT
TTTTACAATAGATTCCAGAAGCGTAGGTATGATTCGCACCGGGAGTACCCCTCCAATAAT
GGAACAAAGTCAAAGAAGAAAAGACGAGTGTGGGCAAGCAGGCCCCTGAGGGCAGACAAG
GCAGCTCGGGAGACTGTTTCAAACGGGCTCCAAAAGGAGTGAAGCCAAACACGGGTTTAG
CACCTCATTGCAGCTGGGGATCAAACAAACAACCGCTACAACCGGGGCCGAGGAAACCCC
TGAGAACAGCGGGGCACGCGAGGGCGGTGAGGGCAGGAACATTTGGTAAAGGGCCTTTTG
GGTCGGCCTGGGTGGATTCCTGGCCCACCTAGGCAGCGGGAACAAGCACCACAGCGCCCC
AAGCCCCGAATTCCTCGACTGCTCTCAGTATCCGAGCGGAAGCGCACCCAATGCCGCACC
GAGAACGGGTCTCAGCCGCAAAGGCCACAGGGACTGCGCAGTAATATCGATGGTGACCTG
GAGAAATAAAAGGTAACGCGAGAACCGGCTGCGCGAGACCAAGGAGGGGCCGCCAGAAGC
CCGCCTTCCCTGGCCGGAAGTGGGGCACTTGGCTCCGCCCGCGTATCGGTACCTCGCGAG
ACTTTGCGAACACCGCCCTCTCTTTCGCATCGGCCGCCGCCATGGTAGGTAATTCGCGTG
TGGCTCCCCGGTTGTTGCTGCTGTCCTCCCAGATCTCTACAACCCCCTGCACTCCAACCC
TGGCTCAGTTTTCCAGGCCGCGTTTGGCGGCCGCAGGGCCCGAGGCGGGGAGCCAGCGGC
CGCGTGTTGGGCTCGGGGTTCTGATCACAGAGGCACGCGGGCCGGAGCGCCGGGGCGCTG
TTGTCATATGGCCGCACAGCCGGTGGTCTTTCCGTAATCTCGCAGCTGGGAAACTTCGCC
CTTTCTCCCTAAAGCCTTTACGGACCACTAAGCTCCCATTTCCCTACAGCCATCCAGACT
GAGGAAGACCCGGAAACTTAGGGGCCACGTGAGCCACGGCCATGGCCGCATCGGTAANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCACCAGGTTAGCGACATGCTTCAGATTGACCTGTACAACTGTTA
GATTAGTTTATGCCCACAAATTAGGAGATAATATTCCAACAATATTTAGGAGAACTTTGT
TACAGGAATGTGTAGAATTTCCATAGAATTCTGTTAGGTAAGCCTAAGTTATAGTTTTGG
TACTGTCCCTCACTTACCCTGGTCCTTTGAAATAAAGTGAGGTTCTTCTTCAATTCAGCG
TACTTAGCAACTACGTGCTATGTGCCGGTCACAGTTCTACACTAGTGAACAGCTAGTCGG
GGGGTGGATAGACTGAAAGAAAGAAACCAAAGCCATCTAGTTGATTCTGACTCATAGCAA
CCCTATAGGATAGAGTAGAACTGCCCCATAGGGATTCCAAGGGCAGCTGGTGGGTTTGAA
CTGCCAACCTTTTGGTTAGCAGCTGTAGCTCTTAACTACTACACCACACACTAATAAGTA
TGGTGAACATAGTTTCTTAATTGGTGTGAGGTTCTGAAGATGGTTGCTCTCTCTTCCCAG
TCATCCAGGTTACTTTGGGAAGGTTGGTATGAGACATTACCACTTGAAGAGGAACCAGAG
CTTCTGTCCAACTGTCAACCTCGATAAGTTGTGGACCTTAGTCAGTGAGCAGACAAGGGT
AAATGCTGCCAAAAATAAGAATGGAGCTGCTCCCATCATTGATGTGGTGCGATCAGTGAG
TAAATTGAATATTTATTACCTTTATAAATTTGTTTTCTCACCTGAAGTCTATGCTATACT
TAGCCAGTTACCTATTAGATAATTCAAACTTTTGGTAGAATTACTACAGATAATTAATTG
ACCATGACCAAACTCTTCCTTAGTCCACGCTCTGTCTTGCTCCTTTCTTTTCCCTCACAG
AAGGGGAACGTAAATCAGTCGAATGTGGTTCAAACAAAATATTTGACAGTGATCCTTTAA
TTTCCTCCTTCATTTAATACATTTCCTCTTGAATATCTTTCCAGTCAGTGATCTTTTTGT
TCTTACTGTTGTTGCACTGATCTGCACGTACAGGTTTGCGTTTCTTGCCTGACTATTGGC
AGCAACCTCCATAGCAAGCCTGGCATGCCTCATGTAGAGGCACAGCTCTGATTCTTCAGT
AGCATTGCATTCTTACCAGAGTAAAATCATAATATGCTTGACTGTCATTCAAGGCTCTAC
ATAGTCTTAAGAGATTTCCCCCCGCAAAATCTTCCTAGGTCAGAACCCTAGGGAAGCTTT
TAGTTAAACTTTAAATTCCTCTTCCCAGCCTATTTAATGTCCCTTGAGCAATTTTGGGGT
CATCCATGGCTTCACAGCTTGGCTGGGAATGTGGGATTTGTGCTTTGCTCGAGACTAGAG
TCACATCTCGACACAGCTCTCGTCCTGGTGTGCTAGAGTCCTCGGAGAGAATCTGCTGGT
CTTGATTCATTGGTGGGGCAGTCAGTGCCCCTACTAGTGCCCTGGTCAGAAACATGCCCT
ACCTGGCTCCTAGAAGGTGTGAGTTGGCAGGTACCTTTCCTTGTACCTATCAGAGTTGGT
ATTTGCCATGGTGTATTACAAACCCATTTCTTTATTTTTTTAGAGCTACTACAAAGTTCT
GGGGAAGGGAAAGCTCCCCAAACAACCTGTCATCGTGAAGGCCAAATTCTTCAGCAGAAG
AGCTGAGGAGAAGATTAAGGGTGTTGGGGGTGCCTGTGTCCTGGTGGCTTGAAGCTACAT
GGAGGTTAATTAAATGTTAAATGCTTTTCCCTTATGTCTGAGTGTAGGTTCTTTGGTGCC
ATCTCTACATCCCTACCTGTGTAGCTAATGCTGAGCACTGCCAGCATCAGGACCCTACCT
AAGAGATTCTAGGAGTATGGAGGCCTATGTTTCCCTGCTGACTTCCCTCAGAAACTCTAT
GGTAGGGATATACCAGTACTTTAGAGGCTTGGGCCATTACCTAACTTAACACACCTTTCG
TTTATAAAGTGAAAATTACACGTGTTGATAATATATTATCTTCTGGTTGAAATACCTGTT
TCTGTTGTATACTCTAAATTTACTGTGAATGGGGAAAATGTACTCTTACATGCTCCGTGG
GGCTCAAAATGGAGGACTTGGCTTTGATGGGGCATGTCGTGAGGTGCTATAGGTTCTGAC
TCTTAATGATCCCACGTACAACAAAACGAAACGCTGCCAATCCTGCACCATCCTCACAAT
CGCCATAGGTATGAGCCCATTGTCGCAGCCACTGTGTCAATCCATTGTTGAGGGTCTTTT
TTTTTTTTTTGCTGACCCTTTATTTTACTAAGCTTGATGTCCATTCTCCAAGGGCTGCTC
CCTCCTGATAATATGTCCAAAGTATGTGAGACATAGTCTTACCATCCTTGATGACGCATG
GCCCTAGTTAAAACCAGAATCTATTGAGTCAAAATACAGGGCCAGCAATCTGAATTTGAA
ACACCAGGGAGTTAACACATCAAGGTGGGTGGGATCCCAGAACACAGTTTCAAGGATTCG
TGGGTGCCAAGAGTAGGGGTGTAAATGTTTAAAAACAAAAATAGTCTATAATTTTCTCTC
CTTTTGAGCCCAAACTGTATGTAAACCAATTCTTGTGTGCAGGTAAGACCCTCAGGTCTC
CATATAAATTATAATTTGCTGTATCTCTTACAGAAACCCTGGTGGCCTAGTGGTTAAGTG
CTATGGCTACAGACCAAAGGGTCGGCAGTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1309..1372, 1888..1963, 3000..3174, 4063..4191
1001..1003, 1309..1372, 1888..1963, 3000..3174, 4063..4188
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved