Loxodonta_africana Locus WDR43
snOPY snoRNA Orthological Gene Database
Loxodonta_africana WDR43
Loxodonta_africana
WDR43
GeneScaffold_5133
SNORD92, SNORD53
5145..5231, 17981..18056
31050
CATAAGGTATCCATTGGTTAAAAAAAAAAAAAAAAAAGGCTGAGAACAAGAAAAAAATT
TAAATGTTCTGAGGCATGCTTTATGTACATTCATCAGGAGTGTAGGGTTGAGCCAGTTTC
CACCAGGGCTCCATCCAATACAGCGGACCTTACTATTGTCTTTGCTCCTTCTGGAACCAA
CATGCACCTAAACCCCGTCGCATTACCTTTGGATATGATATGGAAGGCCCTCTTTTCATC
AATAATACATAGTCTTCCAAGGCCGGCCTCCTCAGCATGAAGTGCTTACCCGAGCAACTC
TTCAGCATCTGGCCGGGGAACTTCCCCAAGATCTCGCTGAACAGGACTAGCCCTCAAAAA
GTTACTATTTAAATGTCCGGCGTTGCTCAATCTAAATAATTTTTTAAATTGTGTTTCTCT
CTTGCCAGTCTCGGCTAAAATCAGCTCCCAGCCCGAAAGGGGCCCTCCCTGGAAGTTGAG
TCAGGAAGCTCTGCGACCTCGGTAGCGGACTGATCCAGGGCGGGCTGAGAGTGATCCCCG
GATCCTCTGTGTGCGAGATCGAACTGGCCCTGGGCTCCGTTCGAGTCCTCGCTCTCCCGG
GGAGGTGACACCTCCCGCGGCGCCAGCGGTCTGACACTCTCCAGTGACGGAAGACATCGA
ACCCCAATGCCCGGGCGCCGAGAGAGACCTGGAAGCGACTCTGCGCGCAGCCGCACCACT
TCGTGCCCTCCTTCTCCATCCCGCGCGTCTCTGCGCGAGGACTCGAAAGATAGTGACCGG
GCTCCTCCGAAAGGTTCTCGCCCAAGTTCACCCGGATTGAACAGAGCCCAGGCCTCGGTC
GCTTCCGAAGGTGCTGCACGTGCAGCAGCAGGGGGCAGCCGCGCCCGGCCAGCAGCATAG
TATCCGGTGCAGGCGCCGTCGCAGACAAGTGACGTACCGGCGGGGGCGGGGCCGCCCTTT
CCGGCGGCCATTGCTGCTCAATCTTCCTACGTAGCGGTCTAGGGACTCGCAGCGACGTGG
GAGGGACTCCGCGACTGTGGCTGCGCGCGCAGAGGAGGCGACCCGGAGGCCCCGCCTGGG
ACGCGGGCGTCCCGGCGGCGTTGAGTTACTCTCCGAGGAGGGAGGCCTACTCTTCGTGGA
GTAAGGGCAGAGTACCGTTTACCAATCCCTGGTTGCCTCGAGCGGGGTAGGATTGCGACA
AAACTTGTCAAAGCGCTGTGTAAACCGTAAAGCAGGATGGTTGTGAGTGCCTAGTCATAG
CGACCATGTGGACCTTTTACGTACAACAGAACAAAATGCTGCCCGAGCGTGCTGCACTGT
ATCAGTGTTACGCCGCTGCTAACGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNACTTCAGCCCTGTTGTTTTCTCCTTTCTCCAGCACTACGTATG
CTATTTGGATGTTCTCTGTATCTCCTGTACTGACCCTTTCAGTTTCTTAATTCTTTTATT
TTCTTTTTTGTTCTGTTACCTGGAAGATTTCCTTAAATTTCATCTTCCAAGCCTTCTATT
AAAAAAATCTCCTTAAATATTTTATTTATAGTAATATTTCATATTATATTTACTTTTGAA
ATTGCATATTTTCAATTTCTAGGAGCTATTTGTATCCTCTAATTTTTCTTTTTATTGCAT
CATGTTTCTTTGATGTATGTAATATCTTCTAATTCTCTGACGATATTAATTATAGGATTT
AAAGTTTTTTTTCTCTTGTTCCTTATATCATCTCCCTTTTGAAGGTGTTTTTGGTTTGAT
TTTGATCTCTGTCTTTCATGTTGAAGGCATCCTTCAGATGACTTGCAGAGATCCTTGGCT
GTCTGTTGCTGTTTGAAGAAAGCATTAAAAAGCTCTTTGGAAGGGCTGTGTGTGGGTGTG
GCTTGTCAACTGTGTTAGGCTTCATTTGCGTCATTGGGACGCCTTCAAATGTCAGTATGT
GGGTCCTTTCTCTGGAGCCAGTCACATTTTTCAGAGAGGAATCGTCTAACCTAGTGCTGT
TTTAGCTTTAATGTGCATATGCTTGTACATCACTTGTGCAACTCTGATTCACTAAGTCTT
AGCTGGGGCTTGAGATTCTGTGGCTCCCAGGTGATGTTGATGCAGGAGAGCTACACTTTG
AGTTGCAAGGCATTTCATCTGGGTGGTAGGGAGATGATAGGGTGGTGGGGTTGCCTCTCT
GCTGGCATTCTCAGAGCTGAGTGGGGAAGTAGATCCAGGAAGTTTGTTGGCCTTCTCAAG
GTTGGGTGGTGACCATGCCTGTCTTTTGTATACGTATATACATGCACACATACGTATATA
TATTTTTTTCTTTTGGAATAATGTCACAGTTGAAGCTATGTGACTCGATGAGATATGATG
TAAGAAGTTTTTTTTTTTTTTTTTAACCTAAATTGGCAAAAAATTTAGGAACAGGTGAAG
GTAAAGGAAATACATTCTCATACATTATTGGTGAATTTTCTTGATTACTAGTGAGGTTGA
TTATTTTCATATTAGTTGACAATTTGTATTTCTAATGAATTGCATGCTTATATCCTTGTC
TAATTTTACTTTTGAGTTATCTTTCTTAACGAATTTATGTATTTTCAGTATTAATGTTTT
GTCTATAATATGTATTTTTGCTATTTTTCCTAGCCTTTTACTTGTACTTTAATTCCATGA
TTCATTACAGAAGTTTTATGTAATTAAATCGGGTCTTTTTTTCTTTATGATTTCTGGTTT
GTTATTGCTTTAGAAAACCTTACCCTAAGATGATAAATAACATCCCCCTATATATTCTTC
TGATACTTTAATTCTTTTAAATCAATTAATTTTTTGTGTGTGTAGTGTAAGATACTTTGT
TTTTCCAAATGACTAATTTGACATATTCCAACGTGACTGACAGAACAATACCTTTTCTCC
TACTCTAGAATTGCTGCCTTTTAGTAATAAGTTTCCTACGTGTTATTTCTTGATTTTATA
AGTGGATAGTTGAGCTCCCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNAACCCATTGGGGAGGCTTTACTCTAGTATTGTCCAGGGTTAGTTATATGGCACAAG
CTTTTAGGGAATGCAGTTTGGCATAGAACCTTAGGTGGTATTTTTAAGGCTTAGTTTGTT
TATTTGTTTTGTATGCTCTGAGTAACGGTTTCCCTCATTGAAATTTTTGTTTTTCTTCTC
AATACAGCAAATGGAAAGGTGACAATAGCAGCGTCAGTTCCCTGTGTATCAGCCCGGATG
GAAAGATGTTGCTTTCTGCTGGTCGAACAATCAAGTTATGGGTTTTGGAGACCAAAGAAG
TCTACAGAGTGAGTGAATCAAATTAGTTGCAAGCATAGTAAAATCTCAGTCATATAGAGT
AAATATGGAGAAAGGCAGAAATCTGAGCCATGGGGTATTGTTTAAGGATGTAATTTCTTT
ATTTACAAGTATATCAATTAGTAGAATTAATACACAAAACTTAGCTTATTAGTCTGTTTT
ATTGATGTTAAACATTCACATTCGTTGGAAAAATGAATAGAACATATAAATAAAATTTGA
ACTAAAAACCTTTTACTCTGATGTGATTACTGTAACTTGCATCTAGCATTTTGCCCACTT
ACAGTATTTAAATGCAGAGCTTTATTGTTGTTGCCATTGCATCAGTGCCAACTCATCCTG
ACCCCGTGTATGCAGGGTAGAACTGCTCCGCAGGATTTCCAAGGCTGTGACTTTTCAGAA
GCAGGTCACCAGGCCTGTCTTCCAAGGCACCATGTTTACTTGGGTGGGTTCTAACTGCCA
ACCTTTCGGCTAGTAGTTGAGCGCTTAACCATTTGTGCCACTCAGATTTAGTACTGTATT
TTTTGAGAAGGAAAACAAATTTTAGTTGAGGGGTTGCTAAACTTATGGTGCTGTGATGAT
GCCTTAAAATTGTGGTTTCGACTCACTGAGAGTAAATGAAGACCTACAATTCCTTGGCTG
TGTCTGAGCACCCAAAGTATCCCTTTAAATATAGAATTAAGTGACTCTTTAACTCAGAAT
TGAAAGAAATAGGGACTGTGTGGGGTATAGTCATAGGAGGTAGGAGGAACATCTCAATTT
TTAGTATTTTCAGTTTTTTTTTAAGTAAGGGGAACATACCAAGTAACCTCAGTTGTTAAA
ATTAAATTTAACTGTTACCTTTAGTCTGGAGTCCTGCTTTCAGGTATGTATCACATGTGT
CTTGTTTATGATACGTATGGACTCTTACTGCTTTGAATCCATCCTGTCAAGACTAAATGA
GATTTTGCTTTCTCTAGCACTTCACAGGACATGCGACGCCAGTTTCATCACTTATGTTCA
CTACTATCAGACCTCCTAATGAGAGCCAACCCTTTGATGGAATTACAGGTCTTTATTTCT
TATCTGGAGCAGTACATGACCGGTTACTTAATATCTGGTATGTAGTCTTTTTTTTTTTAG
TCTTTTAGATTGGGGAGGTAGTTTTACCTTGATGACCCTGTCATTTGGTTACGTGGCTAT
TTTACATGGTTATTGTAAATATGAGTATGAAACCTGTTATATTGTATTTAATGTTGGATT
TATATTAACTTGTAGTAAACAATTGAGCCTGCCTGAAAACGTCTTATGAGAAAAATGAAG
GGCATTACATAATGTAGCCTCCTCTGTGCTTGTTTAGAGGTATAGTTGACTGAATCTTTT
TGTGGCTAGGTAATTTAAAAATAGCTTTTGTTTGTTTAAATAGGAAAACATTTGATTTTG
TTGAAAAGAAATAGGTGGTGCCACGTTGGGATAATGAACTGATGTCCATTTATTGATCGT
TAAGTTCCTTGGTGTGCCTGAGAATTCCCAGTAACCCTTTTTTGTAGTAGTTTTTATTAC
TAATTCCTTTTTAAACTATTTTTAAAAGTAAAAAATAGTTTTAGCATTAAAGAAAATTTA
TGAAATATAAGAAGAACAATTTTCTTGGATTTTTTGACATCATCTGATGGCGAAGTTGAC
TTTTTTTTTTAAACCTGCTGTTCATAGACAAAATAAGTATGTATAGTGTTTGAAGAGATT
TTGAAAACAGAAGTAGTTTTCTTATCTTAGTAATGATTAGTTGAACATGCTCTTTTATAT
AAAGTTACTATGAATTTATACCAAATACTCATTTAGAAGTGGGAATCATAAAACATTTAT
TCCTTAAAAAATAGTTGTATGGGGAAAGGTTCATGATACAAAATGTGTACCTCTGTTCAC
CTTTAAAACCACCTGCTAGCCCATAGTTTCTGGTGATACTTCTAATCAAGTTGATTTGAT
TTTGTTTCATGTGTTTTAGTTCTAGAGGCTTTATCACTATGTAAAAAATTAATAATGTCA
GAAAGCTAAAATCTGCCATCAAGATCTCCTGACATTACTGAGGTGCTTCAGTTGTAAATA
CTTCACCTCTTTGGCTTCCTAGTATGAAAGGGTTTCCAGCTACAAAATTTCTTTCTCTAA
AAGAAGAGTTTGATTTCTATTTTGTAAGAGCCTGAAAATAGCATCTTTTATACCTGGAAC
TTCTGTTAACCGGAGAATAAATTTAAAAAGCAAACAAATTTAGAACCCATATTGCAAGGC
TACCTGACAAGACCATTTGTGAAGCTCTACAAACTCAGTGAGTTGGTGGGTAGAGTACGT
CTGAGGTTTCCTGGTAGCCACCTTTGAAGAGCATATTTCTGTAAGGAAATAACATTTGAA
GGTTTCTTGCTTCTGACTTGAAGGTTCTGGTCAGAAGATAAAAGAATGCAGCGATGTATT
TCATAGTTACAGATGAACCTGTCTATAGTGTCCTGAGTTTTCATGTTACTATAAGGAGAT
AGTACTATCTTTATACGGTGGTCTAAAGGCAGTGATTTTGAACATGGATAGTGTGTGACT
TCATGTTAGAATGAATTTTGTTTTATTAGGAATTTAGTTTGCGTGAAAACATTTAAACCT
GTTGCTGTCGAGTCAATTCTGACTCATAGTGACCCTATAGGACAGAGTAAAACTGCCCCA
TAGGGCTTCCAAGGCTCTAATCTTTATAGATGCAGACTGCCACATCTTTCTCCCATGGAT
GGATGGTGGGTTCAAACCACTGACCTTTTATTTAGCAGCTGAGCACTTAACCACTGCACC
ACTAGGCTCCTGATGAAAACATTGGAAGTTCATCAAATCAACTCATAATTTTCTTCCAGA
CACAAAATATTGGAACATATTTAGTGGTGAATATATGAAGTCTTACTAATTGATAAAAAA
GGAACTGATTTGATCATGCTGTAAGCTATGTTATTACTGTCTTTATTTTTATCTGCGGTG
CAATGGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAACCTCCTAGA
CCCAGGAGACAGAGAGCTGTAACACTGGAGATGACATGAGACAGCAAGAAGTGACGGCAA
AGAACTGGCAGCAGCAGAACTAGGAAACCAGCTTGAGACGGCCAGTGAGCTTCCTGGCCC
ATGGAGCAAGGTGGCAGTGGTGGGAATGCTGACCCATGGAGTGAGAGAGCTTAAGAGCCT
TTGGGCAGAAGGCTTCCTGGTGGAGTGGGGTGGCTCTGGGCACTTGCTGGTGGAGCTGGG
TCGCAGACCCGGGGAACAAGAGAGCTGAGCACCTTCGGGCCGAGGCTCACTGGCAGAGTA
GGGTGCCCCGGGCACTTCTGGCAGAGCTAAAGAGCTTCGTAACACTTGGCTGAGTAGGGC
AGAGGCTGAGTCGAGAGCTAGAGAGAGGCCTGCCTGCAGGTACAGCTGAGAAGCTGTTCT
GACCGAAGAAGTGTATCCCGAGTTGTTCCTGATCCTGAATTGTAACCTGTTATTCCCTAA
TAAACCCCATAACTGTGAGTGTGATCTGTGAGTTCTGTGTGGCCATTGCAGTGAACTAGT
GAACGCAGCAGAGAAATAGAGAGTGCTGTGGGAGGGATGGCTGGTGTCAGAATCGGTACA
AAGTTTGGAGGATGGAGGTGTGTCTGACTTCGCTTTGTAGGAATCACGCACAGGCTGATG
CTGATAGTGATTGTGATTCTCCTTCCCACTTGTGAAGTTAGAGGAGGAAGTCCGATGCCC
CAGTGCCAGCACTTTTACATCTCTATTTAACAGTTTTATTGAGGTATAATTGACATACAA
GAAACTGCACATACGTGTACAATTTGATAAGTTTCAACATACGTATATACCACTGAAACC
ATAACCACAATCAAGATAATAAACATACGCATTGCTCCAAAGAATTTGCTCTTGTTCCTC
CATAATCCTTCCTACCCCAGCCTCCAGACTTGTTTATAATTCCGGGTCATTACAAATGTT
GCTGCGGACGTTTATGTACAAGTCTTTGTATGGGCATTTTTTCATTTCTCTTCGGTACAT
CTTCAGAGTGTAATGGCTGAATCATGCGGTAGGTACCTTATACATTTAACTTTTGAAGAA
ATAGCCAGATTCTTGGTAGTTGTACCGTTTTACGTTCCCTCCAGCAATGGATGAGATGCC
AGTGTCTCCACGTCTTCACCAACACTTGGTATGGTTATTTAATTTTAGCCATTCTAAAAG
ATGTGTTTTAATTTAATTTCCTAATGGCTAATAAGAAGACCTGGTGGCTCAGTGGTTAAA
GCACCTGGCTGCTAACCCAAAGGTCAGCAGTTTGAATCCACTAGCTGTTCTATGGGGCAG
TTCTACTCTGTCCTGTCGGGTCACTGTGAGTCAGAATCAACTCGATGGCCGTGAGTTTGG
TTGGTTTTAGAATGGCCAGTGTTTTGAGTCTTATGTGCTTACTTGCCCTCTGGATATGTT
TTTTAATGAAGTAGCTGTCCAGATATTTTTGCACATTTTTTAATTGAGTTATTTTTGAGG
TTTGAGAGTTGTGTATATATTCTGAATTATCAGATTTATGCTTTGCAAATACTTTTTTGT
TGTCAGGGGTTTGTCTTTAATTCTTTAACAGTGTCTTTTGAAAAGCAGAAGTTCTTAGTT
TTGATGAAGTCCAGATCATGTTTACAAATCTTTGTCTGACCCTAAAGGTTATGAAAATTT
TCTCTTCGATTTTATAGTTTTAGTTTTCGTTTACTAGTCATACGGTCTGTTTTGGGTTAG
TTTTTATATATACTGTAAGGAATGCATTGAAGTTCATGTTTTTGCATTCTGGATATGCAA
AAACTAGATTCGGTACAATCTTGGTCAAAATCTGACGTGGCTTTTTTGTAGAAATTGAAA
AATTGATTCGAAAATCAAATGGAAATGCTAAGGACACAGACTGTCCAAAACAACTTTGAA
GACGAACAAAGCTGGAGTACTAACATAGCCTCATTTCAAGACTTACTGTCGAGCTACAGT
AATGCAGACCACTATGGTATTGACATCAAGATAGACAAATAGATGAGTGGGAAGAATATA
GAATGCTATGCATTCTTGAACTCTGCCACAGATTAATGCTTTCCTTTTTTCCAAGTACTG
CATACTATATGGTAGTGACATGAACACACCTCTTATTTTGATCTTTGTCATCTTATGTTG
GTGAAAACCCTACTGGAAGTCTAATGCTGTGATCTCTATCCCTTAGGTGCTTGCTTTTTT
TTTTTTTTTTAAATCTGTTTCATCATCTAATTACTGGTTTTGTTATCTAGGCAGGTCCGG
TCAGAGAAAAAAGAAAAGAATGCAGTGATGTCTTTCACAGTCACAGATGAACCGGTCTAT
ATTGACCTGACTTTGTCAGAAAACAAAGAAGAGGTAAATGGCTCAATTTTTGAGAATTTG
TTTTTGGATTTTATAAGCGTTATTTTTTTTTTAAATCAGAGTTTTGATGATTTAACAATG
CATCGGGAAAGAGGGGTCATGAGGGTGTAACAGCAAAATACAGCAAAAGCCTTTTTTTTT
CTTTTTTAAGTAATATTGTGTTTTTGTTGAAGGTTTACACATTAGATTCCCATTCAACAG
TTTCTGTACAACTTTCTAAGTTGTTCCCGTTGGTTACGTTCTTCACAATGCGTGAACATT
CTCATTTCCGTTCCAGTTGTTCCGTTGCCATTAATCTAGTTTCCCTGCCCCCTTACACGC
TTATCCCTGTTTTAAAGTTATTGTTGACAGTTTGGTCTCACAGAGATCTAGATTTTGTAA
AGAAGCACAGTACTCACAGGTGGTACTGTTTGTGAGCCAGTGTGTTATTTAGCTAAAAGG
TAACCTCAGGAGCTAGTTTTTGTTCAAGGTTTAAAGAATATCTCAGGGCAGTAGTCTTTG
TAGACTACTTCAGTCTCACCTGGCCCAGTGAGTCTGTTTTGTATTTTTTTCAAATGGAAT
TTGAGGTTTTATTCCACATTTTTCTCCCATTCTGTTAGGGTCCATCTATTGTGGCCCTGA
TCAGAATGGTTAGTAGTGGTAGCTGGGCACCATCTAGCTCTTTCAGTCTCAGTGTAAATG
AGGCTGTGGTTTGTGTAGACTGTTAGTTCTGTAGACTAGTTTCTTCTTTGAGTGTTGGGT
TTCCTTCTATCTCTTTTGTTCTGAATGACTAGAGACCAATAGTTTTATCTTACATGGTTG
AACAAAAATCTTTTTTAACTGTTCAGCAAAATCGTTAAATTTCTGTGAAAAGGTTTTGAG
GGGAAGGGAAAATTTTATATGCAAAGGCAGTACATTTTGGAATTTATTATGTGCATTAAT
AAAATTTATCGGGATGGATTTTTGTTACTAGGAGTTCTATGTGTGATTCTTCTATCAGAG
GCTTTATTTTGTCATAAAATCTTGTAGGCCCTGACTAAGATGTATTATTATTAGTTACTT
TTTTATACTTTGTTTTTTCATGTAAAAATTAGGTATTTGATTACAATATATCTTCAGCAT
TTGGTAAACCTCACATCTTGGAAGTGCTTCATATTCGTGTTTCTATTTGACTAAAGCTAC
TTAAGATTTACATTTGAGCAGACTCCTAGTCCTGAAATGAAAGCTAAGAGCATTTCACTT
GTAACACAATCTCAGTTTTGATATGTGTATGTTATTTAAACTTCTAATAGGGAGAGATAA
TTTAATAGTTTTTTATCGTGTTTTGATAGTTTTGAAAATGTTATGATAGAAAGTGTTTTG
GCTTAAAAATCAAGATTTTTGGTTTAAGTCTTGATTCTGCTGCTAATGTGATCTAAGGGC
AAGTAAACAAACTGAAGAATCTCAGCTCTCTAAGGTGAGTCGGGGGTGGTGTCGATACAT
CAGTGATGCCCTGTACAGACCTTTGTCTCTTAAGGGACTCAGATCTGGGAGTAACGGGCT
CCAGGAATTATTTTCAGTATTTTACAAAAACCTAATAGAAATCCTATGTTTTATAACAGT
AATGCACTGTAAATTTTAATCCTGTGTGGTTGGTACACTGATACGATGATTAAAGGTTTT
GATCATAGCAGTGGAGTCCTGGTGGCGCAGTGGTTAAGAGCTATGGCTGCTAAACAGAAG
GCTGGCAGTTGGACTCCACCAGTCGGTCCTCAGACACCCTCTGGGGCAGTTCTCCTCTGT
CCTTCAGGGTTGCTGTGAGTCAGAGTCAACTGGATGGCAACGGGTTTAGGTTTTCTTTTT
TTTTTTTGGAGCGTAGGAAACTGTAGTAAAACAGAAACACCTTGGTATTTGTCTCCATAA
CTATTTCAGTTCAAGTGACTTAAAAAATTATTTTTATTGTGTGTGTGGGTGATTATTTAA
AACTCCTAACCAGGTAATTTATGTGATAAAAAGTCTGCCTCCCTTGGAATAGCAAAAACT
TGCCCCTAGTCTGTTTAGAGAATTGACTGCGTTGTTGCTTTCTCTTTTTCTGACTGAATT
CTGATGTTAATCTTCCATTTAAATGATCTTAGAATAATACCGACATCGTACATTAACATT
ATCAATAATAAGGGGGGTATACCTGCCCACCATCAGAACTTTTTAGACATTTTTAAGATA
TTAAAGTAGGAGTGATGGAATCTACTTCTCAGGAAGCCATGTTCTAATTCTGGCACTTGA
TATAAATTTATAGTTATAGCAGTCATTTCAAATTAAAATTCTAGAACAAAACTTCGATTC
TGCTTGTGTTTTCTTAAAAAGATATCAGCCTCTCTAGCTGTTTCGTGGGGCTGGATTTGG
TGCCTGTTAGTGGGGGATGCAGCAAGGAGAACTAGAAAACTTGATGGAGAAAAATAACCT
CCTTTGCAACTTTCATTTGCTGCTAAACATCAGAAAGAAAATAAAAATTAGTTACTCTCC
CTTTATGAGATTTTTTATCGTTGGATATACCAGTAAATTCTTTAAAGTGTTTCACAATGT
AAAGTTAGCTTTAACGTATTTTATATAATTCCATTTCTCCCAATACGTTGGCTGCTCCCC
GAATCCTCCCACTACGTTTATAACTAGAGTAGAGATAGCAGCTTTTTGGGAGTGCCTTTT
GGGTGTGCTAAGTTTTCATGTAAACTTTCTTTAGGAAAGCTTCAGAACTTTTAAAATGAG
TTGTAGGCACTGCTGGGGTGTGGGGCTGACAGCAGAGAGTGGTGCAGTGTCCAGACAGCC
CGGCTAGTAGCATGGACAGTCCTGGGGGATTAGGAGCCCCCCCACCAACCTCACTCCTTC
CCATCCATCAATGCAAAAGGGCATTTTCACCAATCCTGACTGCTGAGGTGGGTGAGTCAT
GTCCATTCCAGGTGGCCAACCTATGGATTGGTAGTAACTTTGTTCATCTGACTTCAGTGC
TGCATTGTTCTTGACCTAAAAATTTGCTTATAATCTGAGCGACAGTAACAATAATCATTG
TTATTGTGACAGCTAATTGCAAGAATTGTATATTCTTGTGCTTCTCTTTCTCAGGTTATT
TAGAGATGTGGGAAGAAAATTGAGTTTTCCTAAGTTAAAGACTGGTTAGATTTGACTGGT
ATAATGTTTTATTTTCGAGTAATTAGTTACATTTTTCTTTCAGCCTGTCAGGTTAGCTGT
GGTTTGCAGAGATGGTCAAGTTCATCTTTTTGAACACGTACTAAATGGGTAAGTTTTTCA
AGTGGAAATTTATTTCTCTTTCCTCTGAACTGTTACTTCTTTATAATCCTACCTCAGTGT
ACTTTGCATTGTATTACTTTTCGTTTTGATTGTTTTGAATGCAGTCTTAAGGCTTGAACC
ATTTCTTCATGTATTTGTGGTTAGGGGAGTGGCTTCTTAGGATGTGTGCCTAGTAAGTAT
TGGTACTTCTAATGACAAATTTTAAAAGAAAGTGGCTAAGTTGAAGAGATTTGCTTGTGA
ACTTGGGTAGTGCCTTATTTTCTGTCTTTGATAGTGCTGTAATTCCCTTTGCCACATGTA
TGCAGTCCAGGGAAGCATAGGAGTGAGTTTTGGTGGACAGAGAGGGAGTGCTGTTGTTAG
GTTGTGTAGTAGTCATGGAGCAGGGCTTAGCAAACTGTGGCCTCCCACAGAGTCCTTAGA
TGGTTTGGAAAACCTAAAATATTTATTTCCTAGCACCTTACAGAAAAAAGTTAGCCAACC
CCTGCCGTATATTGTAAACACGGTCTGAGACTGAATTATGCGCAAATTATTTTAAACTTT
AAAATACTTTCAATTTTTATTGTCAGTTGGTGTCCTTTAAAAATCCTAGAATAAGCATTT
ATTTAAAGGTAAACTAATTATGGAAGTAATATATACCCGTTTTAAAACATTCAGGATGTA
TAGAAGAATTGATTGTAAAATCTGAGTCACCACTGCGTTGAATTCTACTCCCTAGAGATA
AGTTAATGAACATTTTGGTGTGTAACATTTGAGGCCTTTATTTACATAGTTATATGTATG
CATGGAAACCCTGGTGGTGTCGTGGTGAAGTGGTTAAGTGCTACGGCTGCTAACCAAAGG
GTCGGCTGCTAACCAAAGGGTAGGCAGTTCGAATCCGCTAGGCGCTCCTTGGAAACTCTA
AGGGGCAGTTCTACTCTGTCCTATAGAGTCGCTATGAGTCGGAATCGACTCGACGGCACT
GGGTTATGTATGCATGGAGTAGATAATTGAGGTCCCAGAAGAAGTTGGGGCCCAGAAATG
GGCTGTGGTAAGGACCTGGGCATTTCTGCTTGGGCATTGGTAAACCACCAAAGTATTTAA
GCAGGGCAGAATGATGGGATTTGACCTGAGTTTTAAGACAGTAATTTTACGTGTTATAGT
GAGAATAGACTATAGAGGGGTAAAGACCAAAGCAGATGCCAGAAATCCTGGGTATAGATA
GTTGTAGAGTCAGGATTCTAGAAGGAGCAAGTAGAGCATGCACATATTGGTAATGAGTAT
AATAAGGTGTCTAGGGTGTGAGGAGTGGCTGAGACAGTGAAGGTAGGCTTAAGGAACTGA
GAGGCCAGCGTGTTAGGAGGATCATCAGCCTGGTTGCTGGATATAGAAACCATTAAGAAA
GGAATTCAGTAGGAGTAGTGTTGGAAAGGGAAGCTGGCGACACAGTGGTTAAGAGCCATG
GCTACTAACCAAAAGGTTGGCAGTTTGAATCCACCAGCTGCTCCTTGGAAACCCTATCGG
GCAGTTCTGCTCTGTCCTGTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGAG
CCAAACTGTGTCCGAAGCTCAGGGTCATGAGGAGGGGACTTGGGAACCTAGGCTTCTCGA
GGGGTCTGACAAAATGGGATGGAAGAGTAGATGGATGTCAAGGCAGATTTTGGTGGTGAA
GTTTTGAGTGTTGGTGGGTATGAGGAGCAGGGGAAGTCTTGATCAGGAATGCTAGTGGTC
TGAGGACCCTGGTCAGTTTTGAAGGAAGGGTAGTGGCTGGAGGAGGTAGTCCCATCTTGT
GACTTGATGCCAGCTTCACAGAATTAGTATGAGATGTTCTGATTTCAAATTCTCTGATTT
TTTTCATTTCTAGATTCTGTAAAAAACCTTTGACTTCAAACTGCACAATTCAGATAGCAA
CATCTGGGAAAGGCAAGAAATCTACACCAAAACCCATCCCTATTCTAGCAGCTGGTTTTT
GCTCAGACAAAATATCCCTGTTGCTTGTATATGGCAGTTGGTTTCAACCCACCATTGAGC
GAGTGGTACGTAGATGCTACTCTGAAGTAAAACAATATAGCATCAAAATGTCCATGGAAA
AGAATGATTTGAAAATGGTTATTTGGTCTGCTTAGTGGAACACTGAAAAAGAAATAGTGT
ATTTTCCTTTAATAAGAGGACCTTTCATGGGGTGGTTTGATTTCTGAGAACTCTATTTAT
ATTTTCTTTAGTGCTGTATATCCAGAATAATTGTTTTAACATTTAGTCAGTATAAAAGAA
AAATACTTTGAGAAGTTTTACACATTTTTTTTTTTGGTATTAAGTCCTCAAAGTCTGATG
TATTTTACACTTAAAATCCATCGCAGTTTGGACTAGCCACATTTCAGACGCTCAGCAGCC
ATATGTGCCTCTAGTGGTCAGCATGGGTATAACTTCTGTGAGAACTTGGTCCAGTTACAC
AAAAGGAAACCTTTGAATAAAAGAACCCTTAGTAGTAGCACTCATTGAGTTTTCTAAGTG
GTAATACAATGGGCAGTGCAGTGATTTAATGTTTTTTAATACAATGTTTCTTTAAAGGCT
TTCAGTGAGTTATCATGAGCATGTCTAATAGCAGATGATTTCTGAAGCATGCATTTATAT
TAGTAAAACCCTCAGGGAGACTGAGTAGAATATCACATGTCCAAGCAAACTCTGGTTGAA
TTAAAAAAAAAAAAAAAAAACTTATTAAAAAAAAAATTTATTAATACATACACCGGTTGC
CGTTGAGTCTATTCCAACTCATAGCAACCCCATAGAACAGAGTAGAAATGCCCCCATAGA
GTTTCCAAGGAGCACCTGGTGGATTCAAACTGCTGATCTTTTGGTTAGCAGCTGTAGCAC
TTAATCACTATGCCACCAGGGTTCCCTATTAATGTGTAGATATGGTTTAACCAAAAAAAG
GAGAAATGCATAAGGTGTGTGAAATATAAGCCTCCATTCCATATGTTACCTGTTTGTTTG
GTATCCCTTCACTGATACTGGTTGTTCATACGGGCATACAGAATTACGTATAACCTTAAA
CCATAAATAGATACATACATTGCTGCATCTGGCTTTTGTTCCCCCATTTAATATGTCTTC
GAGGGCATTCCTGTCAGGACCTGCCTCAGAGCATTTTGTTAGTCAGCACTACTGTCTTTG
ATTGCTTTTGGAAAAGATAGCAGTGGCAAGTTTTAAGGGTAGGACCTTTTTATTTGTGTG
TATGCACAGATTATTTTTTATACGGGTGATTTCTTAACTGATAGATTTCTTTTGGAAACT
GTTACATTTGAAAAATCTGTTGATCTTTTAAACTTTAAATGTGAAAAATTAAAGAAATTT
CATAACTGAAGATAATAAATGTTGTGCCCCGTGTCTTTAGAGTTTACTTGTTCTCTTCAA
CTGCCATCAATCTGCCTGGTGATCGTGGCCAACAGTTTTGTGTTGAAGCCTTCCATATAT
TTTTCTTTTTGGTAAAAATGCACGGTTGGTCATCTGTTTTTCATTTTATTTTTATTCCCA
GTTGCTTTATTTGACACACTTCTTTTTCATCCCTCCTCTTTCTCTTAAAAATGTATTCCC
AGGCTTTAAACTCCAAAGAACCTCATGTGTGTTTAGTAAGAGATGTTTCAAACTGCTGGG
CCCCAAAAGTAGAAACTGCCATAACAAAGGTAAGTGCATTGCAGATTCGAAGTTGAGAAA
AAAGAGATTTGAGTTCTTTACATTTAGTTACATGAAATGTGTTTGTAATTGGCATAGTCT
GAGTTGTGTCAAGGAAGTATAAAGGAACAAAGTCCTTCCCTATTTCCTGACTCATTTGAG
TTGTGAATCATACTTATATACACATTCAAGTAACATGCTTTGGACTTACTCAGGTAAATT
TGTTTTTAAGAAATTATTATCATTATTTTTTAAATCAATTTCAGTACTTAGTTTGATGGA
GAGGGATCCTGTATTTCAGGGTTGAAATTAAACCATGATGGGTCCGGAATTTACCGTTAA
ATGTAAGAACAGCGTCATGGTGCTCTATTTTGAATATAACTTTGCCACTACATGTAGATC
TTGTATGTTTGGAAGTTTGTTGAGAAAAGGAAAGCCAAGACATGCTGTGATGACATCCAC
GTGGTTTCGCTTCTGGCTGAGTTTCAGTGATGACACTTCTCTTGGCTGTCTGAGCATTTC
TGGCAGTTAGATTACTGGAGATAGTCAGAAAGTGTGCAACTGCACGGTCTAGTAGTTTTT
AAACCAGAATGCCCTTGTATAATCTGTAGACCCCCCTGCCCCCTGGATTTTACTCTTAAG
TGGTATTTTAAGCTTTAAAACTATGAACTTTCAGATTATCATTTTAAAACTTAATTACCA
AATTCAATTAAAATTTATCTTTAATTCATGTTATATTGTTAATTATTTTGAGTTTTTCAA
TAGAAAAAGCTTTCAGAAGCTGTCAGTTTTCTCACTGAGGGTAAATCTTGGGAAGACTAA
GGCATAATTTCCTTTGGCATACCCCTGCCATCCTGTTTCACAGGTGAGAACACCAGTGAT
GAATTCTGAAGTAAAAGTTCTGGTGCCTGGGATTCCTGGCCATCGTGCAGCGGTCAAGCC
CGTTACTCCACAAGCTGAGGAATTAGAAAGCAAGAGGAAATTAGGGGAAAAGGAGGTAAT
GCAGTGGCTGTGCTCAAATATTTGAGTTTAAAATGTAAGAGTACCTGAGAGATTATGACA
AATATATCGGGTAGATCCAAAGTTGGAATTTTAGAAATGTAGTTGAGATTACTCCTGCCC
TCTTTTATCCCTGGCGTTGTAGGTTCTGAAATTCCAGACTGTAACCTTTGGAGAAGACAG
AACTTTTATTAATTGAAGAGGGTGCTTTTCTGGGCCATTTGGTAATAGTAGCTGAATAAC
ATGTAAATTGAGTAAGTGAAGCCAGGACTTGCCGTGGATGACTTTCACTGGGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNATTCCTCAATTGCTTGTTGTCTCTGAGAAATAGACACAAAGTA
ATTTGAACAAACTGCTTTAGGCCTTGTCTGTCTAATCAATCTACCTGAATAATAGGGTGC
AGTCAGTATTGACCGGATCATTTCTGTTCTGTAGGTTAGCATTGAAGAACGCCTGGGAGC
AATGGATATAGATTCAAAAAAAGGAAAAGATGACCTCCCACAGATGAATAGTTTTCCAGT
TCTTCTTACACAGGGCTTAGAAAGTAATGATTTTGAAATGTTAAATGTAAGTATTATGGT
AGCTTTTTAAGGGATGAAATATGATTAATTTTTCTTACAAAGTGATTGATTTTATCATAT
TTATAGAGTGAATAGTCATGTTGTATAGCTGTTTTGAATTTAATGTTTCATGAATTTAGT
CAAATATATATCACTTGGTGGCACTATGCAGACAGTCACCAACCTACAAAGGGATTGTGT
TGGTTTAATTTAAACCTGGAATGCATTTTCTCATAGAAATATTGTTCTGAATGGTTATTA
GGTTCTTAGGCTTAACCCACAAAGCCTTTATAAACATAGTGTAGCTGAACTATGATACTC
AGCATTCTAGATCACAATTTATATTTTTTTCTGTAGGAAAATGCGTTCCTGAGTTTTTAC
TCTGGATTCCAGAAACTTATTTCCCCCTGGCCGTGAAGGGGGCAGTGAGGTGGAACCTTG
GCAATGGGTAGGAGGTTTGGGGGAAAGGTTCAAGAGGGTTGGGGGTGATGTTGTGAAGTA
TTTAGAGGTAAAAGTAATAGAAACTTTGTATAGGGAAAGGGATTTATAATTTCTATGTTT
GTAAGTTGGTGACTGCTTGTATGAAGTTACTTAATTCTGTTCTCTTAAATTCCAGAATTT
GACAGTTGTTTGTATAACAAATTTAAGTGTAAAAACAGTTGAGTTTAAGCACTATCTGAT
CAGAGTAAAAGCATTTATATTTCTTAAGTGCACTTATTTTAGTGATTTATAGCAGAATTA
TTGCGCCGCTTGGTATAGATATGACTTTAATATTATACATAACCCATGAATAGTGTCTTT
CTAATTTATATTTTGATCCAAATGAGAATATTTTATGTATTTTGGAAGACAGATTTTAAT
TTACCATTGCACTAGAAACCTAGATGAGGATTTGGTGAAAAATAAAGAAGTGCTAGAAAG
CAATTGACCATGTTTTTGAAATGTAATATAACCTATATGTCATCATTAGCAATTGAGCTA
TGCTTTGAAGCCTTTTTCCTTAGTAGATAAAAGTGAATCAGTTACCAATTTTTTTCTTTT
TTTGACTTTATTAAGAAAAATTTTAAAACAGAAGAATAGTACAGTGGTCCCATAAATCAG
TCACCCAGGTTCACCAGTTATCAGCACTAGCCAATCTTACTTCATCTGCCCACATACCTC
CCGCCCTTACCACTCCCAGACTGTGGTGAAGCAAATCCCAGACATATCATTTCATAAAAT
ATAGATTACCCAGTAAGCAAGGTAAGCACGTACTCAGGGCATCAGCAAAACAGGGACATC
AGTTGTCCAAAACAAAGACCCATAGATGCCAAGCAAACAGGACACAAGGAAAAGTGAGTG
CTGCGGTAGAAGGAACTGGCAAGGCAGTAAATGAATTGATACCAGCTCCAGTGAGTGAGA
ATGTGCCAGCAGGAAATAAAGTTCACGCAGGGTCATGAGGGTGCCCATGGGCAAGGTTGT
TTAAGCTATGAGGCCCCTACCACTTCAACACCTTTGTTGGGATCTGTCTCCTACAGTCCC
CTCCCATGTAATTGAAACTGGTTATCAGTGGGTTTCTTGGGAGCATACTATTTCTTTTTG
GTAAACAGGAGGTGTGGGTGTGGAATATTCTTTTTGTAGAAAATACGGTATATAGTAAAA
ATATTACTACCCAGCATACACTAAAAATTGTAATAATTCTGTTTACTTAATCCACTAAAA
ATGACATACACCAGGTTTGCGATTAGATCACTAATAATTGTAGTTGCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCCCAAACTAATCAAAATCCAGTAGCCT
CTAGTAGAAATTGACAAACTGACCTAAAATTTGTATGGAAATGCAAAAAGACATGACGTA
CCAAAGTGGCTATAAAATGGAACAAAGAGGACTTATTCTACTTCATTTCAAGATAAAGCT
GTAATAATTAATAAGTTTGATATTGGTTAAAAAAAATTAGGTGTAGATTAAGGGACTAGA
GTCCAGAAGTAGTTGCTGATTTTCAGCAACGATGCCAGGGCGAGTCAGTGGAGGGGGGAA
GCAAAGTCTTTTCAAGGATTAGTGGATTAGTACTGGACCACCTGAATATGCATATGGAGA
AAAATGAATTTCAACTCTTACCTCACACTGCATGTAGAAATCAGTTCAAAGTACACTAGA
CCTAAACATGAAACCCGAAACTACAAAGCTTCTAGAAGAAAACAGGAGAAATCTGCATGA
CCTTGGATGGGGAAAGGTTTCTTAGATATATCACAAAGAGCATGAAACATTAAAGAAAAA
AGTGGTTGGTTGAACTTCATCAAAATTAAAAAACTCTGCTCTTGAAACAACCCTGTTCAG
AGAATGAAAAGACAAGCCACAGACTGGGGGAAAAATCAGACAAAGATTTGTTTCCAAAAT
ATGTAAGAACTCTTAAAACAGCACGTATTTTTTAAAAAATGGTGAAAGATTTGAAACAGA
CATTTCACATAAGAATTTGAATGGCTGGTAAGCACATGTAAAGGCACTGTATATCATTAA
TCCACAGAAATGGAAATTATCACTACAGGGAGATAATTGTATACCGATTATAGATTGGTT
AAAATGAAAAAGACTAGTAAAGCATGTGGAATAACTTGAAACTCTCAAGTTAAACATAAA
AAACCCACTAGCTGTCCAGTCAATTCCAAATCGTAGCCACCCTGTAAGAAAGAGTAGAAC
TGCCCCATAGAGTTTCCAAGGCTCTAAATCTTTATGGAAACCAGACTGCCATATCTGCAG
AACAGCTGTTGGGTTTGAACCTCTGACCTTTTGGTTAGCTGAGTGCTTTAACCACTGCCC
ACCAGGACTCCTCCAAGTTAAGCATACACCTACCATGAGACCTAGCCATTGAGGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTAAAGAAGTATGATGATATTTCCA
TAGTGTATAACCTATGGAGATTGTGCAGCTACACATTCTGCATTCCCCTTTAAAGAGAAA
AAGGCCAGTAAAAAAATGTTAAATATTTTTTTTCCCTAAAAATAATCTTCCCTTATTCTC
AAAAGGTGGCTTTTGAGGTTACGTAAGCTATAATAAGAGGACATTAAAATAGGAACAAGC
GAGTAAAATGAGCAATTGCAGGGATACAACATGGGACCAGAAGTGAGGTTAAGAATGTCT
ACCATAAAAAACTTGACATTAAAATTTCTGGCATTAGGAAGGTAGAATTTTGACCCTATA
GCTTATGCGAAAAGAGAAGCCTAGTCGTTTATGTAATTCTTAGTATCCGTGAGACAAGAT
GATTTTACATTTATCTTTAAAAAGTATTTAAATTATTACATTTTTTAAAAAATTCCATTT
ACGGTAGTACTAAAAAACACCTAGGATAAAACTAAAAAAAGATGCCTATACCTCTGCAAA
AACAATGTTGAGAGAACTTAAATGAAGACCTAAACAAATAGAGAGTTAAACCATGTTAAT
GCATTAGAATATTCAGTATTGTTAAGATGAGAAATTCTCCCCAAACTAATCAAAATTCCA
GTAGCCTTCTTAGTAGAAATTGACAAACTGACCCTAAAATTTGTATGGAAATGCAAAAAG
ACATGACGTAACTCAAAGTGGGTTATAAGAATGGGAACAAAGAGGACTTATTCTACTTCA
TTTCAAGATAAAGCTGTAAATAAATTAATAAAGTTTTGATATTGGGTAAAAAAAATTAGG
TGTAGATTAAGGGGACTAGAGTCCAGAAGTAGTTGCTGATTTTCAGCAACCATGCCAGGT
CGAGTTCAGTGGAGGGGCAAGCAAAGTCCTTTCAAGGATTAGGGGATTAGGTACTGGGAC
CCCCTGAATATGCATATGGGCGAAAAATGAATTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAGCAAATGAAGCTATAGGGAATTG
TGAAAGGATAGGTTAGAAACTAACTCTGTATTTTTGCCCTTCAGCAATCTGGTGCTTGTG
TCCTGTTCTGTCTTACACCAACAACCAAAACAAAACATTCACCATCAGGGGAGTCCCTCT
AGGAACAAAACATTTTGGAAGAATATTTAAAAGTATTTAAGAGGAAAGAGATGGGGGATC
AGGATTTTTGAGACCTGAAGGGGTTCCTGTTTTGTACCCTGTCCTGTAGATGAAACATCT
AGGATCTGGAGAAGTTGAGCAGCCACTACAGGGAGATGCAGGTCCAAAGTGTCAGGATCA
GGACTCATCTGCTTTGCCTCCATTTTTGTAACCTGGGCTTGACCCTGCGTTTCCCTCATA
GATTCTCCCCTAAAGGCAAAGCAGTTTTGATTCAGACTTTGACTGTATGGTCTTTTGAAT
GGTTTAAAATTTTGTCAAAAAGGTGACGCTTTGTTTTAAAAGGTTTGTTGTTTTTTAAGT
ATGTGTTTGCCCCATACTTGTCTCTAATGTCATAAAACGAAGATTTGGAAACTTCAGTTT
TCTAAAGTGTATGTATCTGTACTTAAATGTCTGGAGGTGTTCTTTTGTGTTTTGAACAAA
ATTTTGGTTCATAAAACATTAGAATTTATAGAGAAGAAACCTGTTTATTGAAGTAAATTT
TTTATAACTGAAGGCCGTACCATAAGGCATAACATTGTCCACTCAGATTCAGTCCCTCCC
ACTTTTGCTGGCTAAAATCGAGTTGGTAGTTTTATTGTCTTGGTCTCTTTAACCATTTTT
ACAGACATTTTTCCTTGTGATATCATTAGCTTCCGAGTATGCCCATCTTTATACTTCTTT
TATTTTCCTGCAGAAAGTACTGCAAACTAGGAATGTAAACCTAATAAAGAAGACCGTGTT
AAGGATGCCCTTGCATGCTGTTATTCCCTTGTTGCAAGAGGTAACTGCTTTTTTCATTTT
GAAGTTCTAATACTATATATGTAGAAGAAAATTCAGTATTTTAGAGAATTGGATTTATAA
TATGTAAGTAGCATGGCATTTAGAGAGTGAATAACTGGGAAGAACTTGTAAGTACTTTAG
AAAGAATAGTAAGTTGATGAATTCCTTAGGCAGTGAAAGGAAATGTCATTGGCATATTTT
TTATTTTAAATAAATGACTTTGGCATTTTATTTTTATTCCACTAGTATGTGTGAGTTTCC
CTGAAAGGCACTTGGAGTATTAAAGTGAGCCATAGAGTGCTTTACGTGCAGGATGTCATC
TTCACGAGGACGATTGTTCCAGAAATCCCAGTGTAGAACCCAGATTTTCATGTTGGTTTT
TCTCATTATGTCCTGCAAAGTACCCTGACCTAACGTGAAAAGTTCTTTTGTGTGCTTTGC
TTATTCTTTTTTTTTAGTAACTTTTATTGAGCTTCAAGTGAACGTTTACAAATCAAGTCA
AACTGTCACATATAAGTTTATATACACCTTACTCCGTACTCCCACTTGCTCTCCCCCTAA
TGAGTCAGCCCTTCCAGTCTCTCCTTTCGTGACAATTTTGCCAGCTTCCAACTCTCTCTA
TCCTCCCATCCCCCCATCCAGACAGGAGACGCCAACACAGTCTCAAGTGTCCACCTGATA
CAAATAGCTCACTCTTCATCAGCATCTCTCTCCTACCCACTGTCCAGTCCCTTTCATGTC
TGATGAGTTGTCTTCGGGAATGGTTCCTGTCCTGGGCCAACAGTAGGTTTAGGGACCATG
ACCGCCGGGATTGCTCTAGTCTCAGTCAAACCATTAAGTATGGTCTTTTTGTGAGAATTT
GGGGTCTGCATCCCACTGATCTCCTGCTCCCTCAGGGGTTCTCTTTTGTGCTCCCTCTGA
GGGCAGTCATCGGTTTTGGCTGGGCACCAACTAGTTCTTCTGGTCTCAGGATGATGTAGG
TCTCTGGTTCATGGGGCCCTTTCTGTCTCTTGGGCTCTTAGTTATGGTGTGACCTTGGTG
TTCTTCATTCTCCTTTGATCCAGGTGGGTTGAGACCAATTGATGCATCTTAGATGGCTGC
TTGTTAGCATTTAAGACCCCAGACGCCGCATTTCAAAGTGGGATGCAGAATGTTTTCATA
ATAGTATTATTTTGCCAATTGACTTAGAATTCCCCTTAAACCGTGGTCCCCAAACCCCCA
CCCTTGCTCCGCTGACCTTTGAAGCATTCAGTTATCCCGGAAACTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNCTCAGCTGACGAAGAGACTGCAAGACATCTACAGT
GAGATGTTTAGGCGGCTTGACTTGATAGTTCTTAAAAATCTAGGAGAGTTTGTTGTTAAA
AAACTGTATGAAATTCAATACTGGGTAGCCCCAATTCTAACTAATAACACTCTTTAAGTA
TCAATGTTATTTGCTCCCTCACCTTTTTTAAGGTGAATGATTCTTATTCCTAAGATTTTA
TTATAAACATTTTTCTTTTAGAAAACTCCTATGTAGATATTTCAGCTATTATTTAAGTGA
ATTTAATGGTTTAGTCTTAACCATGATATAAAAAGTTGTCATAGAACTTGCTGACCTCTG
ATATCTGCTTAAGACAGTATAAGAAAATATTTTAGCTAAAACACAAAAATTTTGGGGTCT
TTTTTCTTAGTAATTTGATAAGACCCTAAGTTTGTAGTATAGTATTACCAATGTCTACAA
TATACAGGTTTGTCCTTTCTAAATTTTTTTTCCTGATCAGCTTCATTAATTAGCCTTTGA
CGCTCACAAAGGAAGAAGGCTAAAGAATTCATGATTTAGGCCAAGTTCACACATTTTTGA
TCTGTTTTTTTTTTTTTTTACTTACCTTTTAGTGTCGGGGTAGAAATCTTCACTGTTTGT
GTCTGTCGTTGAATAGATGATAGGCTCAAACATGGGCTTTAATAAAATGTAAAATTGATT
GAGCCCAGTTTAGATAAATATTGCTGCCTCGTTACCAGTTTATTACAAAATAATGAGTGG
GTTTTAGTCTTGAATTGTTTTAGAGGAAAGAATTTTTTCCTGTTTCCATTGCTTTGTGCC
CCCCCGCCACCAGAGATTATTATAACACAAATCTCAGACAGACTCAGTGAAAAATGAAAG
AGTGGTCAAGTTCATAGTAATTTATTATAATCATCTTAACAGAATACAATTTTTAGATAT
TCACTTTGCCTATCAGAGTTTTTCTGATTTTGAATTGAGTTGTATTTAATTTTGAATATG
TGAACACTAGTTTACTTGGATTTTTTCCTTTTTTTTTCAGTGCTCTTTTAATGGTTCAGT
GGCTAAAATGTGTGTTAACGGTTCATGCATCATATCTATCCACAGTAAGTCTTTTCAGTA
TAGTTGCTGAGTAGGAATAGTTTGACTTTCG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1006, 1009..1020, 1023..1045, 1047..1059, 1446..1736, 1837..1974, 2075..2196, 4447..4567, 5537..5680, 10134..10232, 13423..13487, 15733..15904, 17462..17548, 18403..18534, 19294..19425, 28453..28539, 29910..29927, 29930..29940, 30940..31003
1001..1006, 1009..1020, 1023..1045, 1047..1059, 1446..1736, 1837..1974, 2075..2196, 4447..4567, 5537..5680, 10134..10232, 13423..13487, 15733..15904, 17462..17548, 18403..18534, 19294..19425, 28453..28539, 29910..29927, 29930..29940, 30940..31003
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved