Loxodonta_africana Locus SRCAP
snOPY snoRNA Orthological Gene Database
Loxodonta_africana SRCAP
Loxodonta_africana
SRCAP
GeneScaffold_777
SNORA30
2011..2146
52000
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTTTCTTTTCCTTCTCCCTTCCA
CCCCGTACACGGCAATTGATGGGTGTATCTCAAACCGTTTACATGTGTTCTTTCCCTTTG
CTGCGGGTGCCTCTCTCCTCTTCTCCACTTAGGGAATACCTCGTTATTAAAGCCTGGCTC
CAGGTACATTTGCGAATGTTTCCTGGCTGCTTGAGAGTCAACTGGTTCTCTTCTCCCTGT
GTCCCTTTTGTGCTTTCCTGAGAAATACCGTGTTAGATTGAGAGCATGTTAAGGTTATTT
AGCTCTTTTCTCTTGAAGGGCCTTTCATGAAATAGCCTCTAAATGTTTGATCAAAGTACG
TAAGTAAGTGTTTATCTTGGACCCTTTTATGCTTGTGGCAGGTGGTGCAATTCAAGCAGC
AGTCTCGGCTTGAAGAGAAGCGCAAAAAAGCTCTGGATCTGCACTTAGACTTCATCGTAG
GGCAAACTGAAAAGTATTCGGACCTTCTGTCGCAGAGCCTCAACCAACCGCTAGCCTCCA
GCAAAGCTGGCTCCTCCCCTTGCCTTGGCTCTTCCCACACTGGCTCGGCTGCCTCCAGCC
CACCACCGCCTGCTTCTCGGCTGGATGACGAAGGTGTGTATCCTCTTTGTCCCTGTTACT
CTTTTCTGTATACCCTTTCCAGAGCTGAAAACCCACCCTGTGGCTTGCAGGGCCCCGTGG
ACTTTGTGACCTTGTTCTCCTGCTATAGATGGGGACTTCCAACCCCAAGAGGAGGAAGAG
GATGATGAAGAGACAATTGAGGTTGAAGAACAACAGGAAGGCAATGACGCAGAGACCCAG
AGGCGTGAGATTGAGCTGCTTCGACGTGAGGGAGAATTGCCACTGGAAGAGCTGCTCCGT
TCCCTGCCCCCTCAGCTGCTAGGAGGGCCTTCCAGTCCCTCACAGACCCCCTCATCTCAT
GATAGTGATACCCGAGATGAGCCTGAAGAAGGTGGTGAAGAAGAGCCCTCTCAGGTTTTG
AAGGTATAGGCAGAAGGGGCAGAGGGAGGGCTCATAGTGGGAACAGTGGGAGAAGTTCAG
CGTCTGGTTTCTGTTTGGTTAATGGTTTTCAGAAGCCTTCTCTGATTAAGGAAGTTGGAC
TCTGATTTGGGGATAGGTAGGGAAGAATCTGAGTTTGCGGCAAGCTGTAGTCCAAGATAG
GCAGTTTCTGGTGCTGTATGGAAGAATGCAGTACGCTCTACTGTTCAAATAAGTGTGTGA
TTTCTCTGATTCCTGGCACTTTTGTGAAATGGCAGTAATGCTTCCTTACTAGCTTGCAGT
TTGGGAGCTGGGGTGGTAACCTTGAAGTCGCTCTCTAGGCATAAGCTCTGTGTTTATCTA
TATGTTTGAGTGCATGAGGATGTTTTATTATCCAGCACTTTTCACAGATCCCTCCCCTAA
GACTGTGGGGGTCAGGATTTGGTAGCTGGTGCTGAGAGAAAACCCTTGAGTTGCATCCTT
GCCTGGCACTATGCCAGTGGCAGCTGTTGCTAACGAAAGAGACAGTTTTCTGACATCTTA
TTCAGAGTTGTGCCAGTTCCCTGCTGCTCTAACCTTAGGCCCTTTCCCTTTCCATCCTTT
GCCATATAGGGGAAGCCCCCACCCTCATCAGTCACCCAGCGCAACAAACAGCCTTGGCAT
CCGGATGAAGATGATGAAGAGTTTACTGCCAATGAAGATGAAGGTCAGGCCTGTTCGCTT
CGTCCTGTTGCTCCTGACTCCTTGAATTGTTTGGACCTTACCTCCCAGGCTGTTTCACCT
TCTCTACTTGGACTGTGTTCTGTGCCTCTGTCCCTACTAATCCGGCTTCATTCTCTTCTC
TAGCGGAGGATGAAGAGGACACCATAGCAGCTGAGGAGCAGTTGGAAGGGGAAGTGGATC
ATGCCATGGAGCTGAGCGAGTTGGCTCGAGAAGGTGACATTCATCAGACATTTTACTGAG
CATCCACTTGGTGTCTTGGTGTCTACCTTGTGCAGAGTGCTAAGAATAGAGAGATGAATG
ATGCTCTCCATCTAAAAACAAAGACAGATTTATGAGTGGATAATTATAAGTAGAATGTGA
TGAGTGGTTATGATGGGAGTTTGAACAAAATGAGGGAGCTCGTTGTCAAAGGGTTTTGGC
AATATTTGACCTGAACTTTAAAAAAGAGGTTCACTAGGTTGATAATGTTCTTCCCAGGGA
TAGGCAGCACCTTCCCCAGATCTAGCCCAGGTTGTGGGGCTCAGCTTTGGTAGTTGGTGC
TCTTTTGCCTCCTCTCAGACCTGGATCTAATTCAGTGTCTGCAGACGAGAAAAAGCCAAA
CCTAATGCCGTTGAGTGGATTTTGACTCATAGCAGCCCTGTAAGTCAGAGTAGGACTGCT
CCATAGGGTTTCCAAGGAGTGGCTGGTGGATTCGAACTGCCATCTTTTGGCCCAGCGCTT
AACTGCTGTGCCACCAGGGCTCCAGTGTTTGTTTCCCCTTTGCCCTTGAAGCAACTGAAG
CTTACATTTTATTTCTCCAGGGGAGCTATCTATGGAGGAGCTACTGCAGCTGTATGCAGG
GGCGTATGCCTCTGATACCTCAGCCGCCGGTTCTGGGAGCAGTGAAGAGGAAGAGGAAGA
AGAGGAGGTTGAGCCTAACACCTCTGACTGTGAACCAGAGGAAGGCACAGAAGCTGAAGA
GGCGCCTCAAGAGAATAGTAGCAGTCAGTCAGGTGAATACATGGTCATGAGCAGGAGCCA
GGGGAGGGCAGACATTTGGAGGAGAGGTATGGTGAGCTGTAAACTTGGTCTTGTGCTTTA
GACTCTGCTGAGGAGCGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGCCTATCCCCCTGCTGCTGCGGGGCCAGCTCCGGGAA
TACCAACACATTGGACTGGACTGGCTGGTTACTATGTATGAGAAGAAGCTTAATGGCATT
CTGGCTGATGAGATGGGACTGGGCAAGACGATCCAGACCATCTCCCTGCTTGCCCACTTG
GCCTGTGAGAAAGGTAGCTTAGCAGGACCTTTTCTCATGAGCCCCCTTAGCCATCTCTGT
TATCCTGCAGCTGCAGGATGGTGAACTACTCACTCTCTTCCTGCTATCCTAGTAGCCTCA
CTAACTCTGGTCGGTAATTGTATAGAGAGGCCAACACAGGTGCTGGGATTCTTAGGGCCA
TTAGAAGGACAGGGTGGTCAGGGTTATACTTGAGGAGCCAGAACCACAAAGTTTATGTTC
CCTTACCATTTCTCGTTCTTTTGCTAAACAGGTAACTGGGGACCCCATTTGATCATCGTC
CCCACCAGTGTGATGTTGAACTGGGAAATGGAGCTGAAACGATGGTGCCCCAGCTTTAAA
ATCCTCACTTATTATGGAGCCCAGAAAGAGAGGAAGCTCAAGCGGCAGGTTTGATCATCC
ATGTGGTTACTTTCCCCCATTAATCTCTCCTTGTCTTCTTAGGCCCCAAGGTGAATCCCT
TTCCTCCTCCTTTCTATTGCTTCATTCTTTTCCGGGGACTTTCTCTTTTCTCCTAACCTG
ATTTCTGTCCCTTAAGGACTTCGGCACATTTCCCTTTGCCCTCTTTGTTTTATTTTCACC
CCACTATCTGTTACTTTCTGTTTGTTCTCTCAGGGCTGGACCAAGCCCAATGCCTTCCAC
GTGTGTATCACGTCTTACAAGCTGGTGCTGCAGGACCACCAGGCCTTCCGCCGCAAGAAC
TGGCGCTATCTTATTCTGGATGAGGCTCAGAACATCAAGAACTTCAAGTCACAGCGCTGG
CAGTCACTGCTCAATTTCAACAGGTGGAGATGGAGATGCGAATCTGTGGGAGGATTGACT
TGGCCTGAAGGGTGGGCTGCCTGGGTTGAGCATATCAAGGATGCCAGGAAGCTTGGGACC
TTGCTTACCATCTTTTCTCTAATTTTCTGCTATCTTTTTGCAGCCAGAGGCGCCTGCTCC
TGACAGGGACTCCCTTGCAGAACAGCCTCATGGAACTGTGGTCCTTGATGCACTTTTTGA
TGCCTCATGTCTTCCAGTCTCATCGAGAGTTCAAGGAGTGGTTCTCTAACCCTTTAACTG
GCATGATTGAGGGCAGCCAAGAGTATAATGAAGGGCTAGTCAAACGCCTGCACAAGGTAG
GGCCTGAAATAATTTGTCAAGAGTACTTTTTAAAAAAAGATCTTTTATTGTGGTTTAAGT
GGAAGTTTACAAATCAAGTCAGTCTCTCATACAAAAATTTATATAAACCGCGCATATACT
CCTAATTGCTCTCCCCCTAATGAGACAGCCCACTCCTTCCCTCCACACACACTCGTCGTG
TCCATTCCGCCAGCTTCTAAGCCCCTCTGCCCTCTCATATCCCCTCCAGATAGGAGATGT
CTCAAGTGTCTACTTGATCCAAGAAGCTCATTCTTCACCAGTATCTTATTCTATCCTGTT
GTCCAGTCCAATCCCTGTCTGAAGAGTTGGCTTTGGGGATGGTTCCTGTCCTGGGCTAAC
AAAGTCTGGGGGCCATGACCACCGGAGTACTTCTAGTCTCAGTCAGGCCATTAAGTCTAG
TCTTTATATGAGAATTTAGAGTCTGCATCCCACTGCTCTCCTGCTCCCTCAGGAGTTCTC
TTCTCTGCTGTGTTTGCTCTTAGAGTAGTCATCGGTTGTTGCGGGGCACCATCTAGTTGT
TCTGGTCTAAAGCTGATCATAGTCTCTAGTTTACGTGCAGGGTACTTTCTTTTATTTTTG
TTGAGAATATACAGAGAAGAACTTACACAAATACAACAGTGTCTGCATGTTCAGGTTAGC
GACATCAATCACATTTTTCAAGTTATGAAACCATTCTCGTTTTCCTGAGCTGTTTCAACA
TAAACTCACCTCTCAAGTTTCTTATCTAATTTTTTCAGTTGTGTTTTCGATTTGATCCCA
TATAGATAGTGTCCAGAGTGTTGGGATGCCAGAGAACTAAGGACAATATCCAGAAAGTCC
TTGGGGAGAGGGAAGTCAGCGCTTGGCTGAACTCACCTTGTCATCAAGCTGCAGTATTCC
AGTGACTAACTCGTTTCCCAGATTAAACGACCTCAACTTAGTCTTCACTTAACTTGTTTT
CCTTAACGATGGTAGATCTGTCCTGAACCTCTCTTAGGGGAATAATACTGCTGATCAGCC
CCAGCTTGGATTCCTCTGTACTTTGGTTTCGTCACCATAAATTTTTTGGTGTGCTTGTGC
ATGCGCGTGCGTGCATGTTCTGTCCTACTCCTCAGTTTTCTTCCTCTGTGGTCTTCTCTG
GCTGTTTCTCGTTTGCTCAGCTTTTAAATGACAACATGCGTTAGAATTTTGATTTTTTTT
TTTTTTGGATATATTTGCTGTTTACATGTCTGATCGTGCTACCCGTTCCTAAGGGCTGCT
TTCTGTGATAATGACTCTGATCTGTACTTTTAATCCCTTGATTTTCTAGACCACACAACC
CATATTTTGAATTTCTGACTTGCTATCTTTGATGAAAAGTTCCCCTTGAGCTCACTGTGT
CCTAAGGCTTAACATTTCTGGCCTTCCTAAGCGGTTACCCCATTTTGATCAGTCATGCTG
TCATTTTGGTAAACCCAGCTAGAAACCAGGGACTCTTCCTGAACTATCCTTCCTTCGTTT
TCACCCCTTTCTGCACTTTTTTCCGTTCAACTTAGTGACTATAACCTATCAGATTTTACC
TCCTGAGAGTTCAGATTTGATCTTTGTTTTCTATTCTTTGTTGTTTGTGTCATGCCACAA
TTTTTGTTCTCGGCATCCCTACTGGATTTACGTTCAGGAGCTGGTAAACTTACTGTCATT
TCTTTGAAATGTAGTCTGAGTCACCTTTCCTGCAGAGTTAGATGTTCTGTTCTCAATGCT
GCTTTTCATGTATCACTTCTTGGGTTGTGCTGTCTCTCCCTCAGTACATGCTCCTGACTC
ATCTTTATGTGGTTGGTAGCTGGCATGCTGCATAGCTCATGAGTGTTTGCTGATGGGCTA
AGCCAGCACTCAGCCAGTCATCATGCTGAGACCCAGCTAAGTTCTCCTCTCACAGCCTCC
TGCTTATTTGCTTTTAGGTTTTGCGGCCCTTTTTGCTACGCCGAGTTAAGGTGGATGTTG
AGAAGCAGATGCCCAAAAAGTATGAGCATGTTATCCGTTGCCGGCTTTCTAAGCGCCAAC
GCTGTCTCTACGATGACTTCATGGCACAGACTACGTAAGGGAGGGCTAAGGGTGGACTCT
GGGATCCTAGATTAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNACTTCGGAAGTCTGCAATCATCCAAACTTGTTTGACCCTCGGCCTG
TCACCTCCCCTTTCATTACCCCAGGCATCTGCTTCAGCACCGCCTCTCTGGTGCTGCAGG
CCACTGATGTCCACCCTCTCCAGGTAAGTAGTTGCCTTGAAGGTTATCAGCCCTAATGTC
TCTTTTTTTAGGCCAGATATTGATCTTTTACGTCGTTTTTCTTTCGCTCATCTCAGACCC
TCAACACTATTCCCCTAACTTCATCCTTTTCTTGCCACCTGGCTTTGGGCAAGGTAATTA
TTAATCTCTGACCCAGGTTTCTTTGCCTTTCGAAACAAGGGTTATAAAGCCTGTTTCTGC
AGTACACTTGTGAGAATTGAGTTAATATTTTTGGAAGTGCCGAGGCCTGTACCTGGCTTG
TTAATAGATGTTTCACAAATATTATTTTATTTTTCCTACTCCTTTCCTCTTTTTGACTGC
CTTTGATCCCATGCGTTTATGTTCCTTCTTATGGCAGCGGATAGATATGGGTCTGTTTGA
CCTTATTGGCCTGGAGGGTCGCGTCTCTCGATACGAGGCTGACACCTTTCTGCCCCGACA
CCGACTCTCCCGCCGGGTACTTCTAGAGGTGGCTACTGCTCCAGACCCCCCACCCCGGCC
CAAGCCAGTCAAAATGAAGGTCAACAGGTACCAGGGCTGAGGAATAAGGAATGGGGATTT
AGGAAAAACGGTTATAGCTGGCTGGAGGGGATTGAGGTGGAAAGGACAGAGCCAGAGGCT
AGGCTAGATTGTGTACGTGGAGCAGGTGCAAAGTACTGTAGAGGGACTAGTGGGGAGAAT
ACCTAGAAGAGGGTCCTGGGAGGGGCCACTGGGTTTGTCACTGATTTTTTTTTCCCTCTC
CCTCTGCTTGGTGCTTTCTGGATGTCTTTGATTTCTTCTCTTTTTCCTTTTGCTCTATAA
TTTCTTTCTGTATTCTTCTTTTACTACTGGCTCTTCTTTCTCCCTCCCTACNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCCAGTCCGACCCCTTCAGGCCCAGAG
CTCTCAGCCCAGCTCACCCTGGCTCAACCCCCCCGGTGCTGCCAGCGCCACTGATGGTGT
CGGCCTCAACCACTGGGTCCCCGCTTATTCCAGCATCCCGGCCCCCTGGCCCTCTTCTGT
TGCCCCCGCTGCAGCCAAACAGTGGTCCCCTCCCCCAGGGTGAGTTGCAAGGGAGCTAGG
ATGCTGGGGTAGTTCAGGAAAGTTGTTCAGGTTGAGGAAGAGGTAATGAAATGAGAGGGT
TTGAGGACCTGAACGGGGGACACGGGTGGTGGTTGATGGGCAGAAGGGAGGATGGAGTCT
TCTGGGACCAGAAAGGCTCTAGGCAGGGTGCATCTGACAGGCATTTGCTTTGTGTCTACA
GTGTTGCCATCTCCCTTGGGAGTCCTGGGTGGAACCTCACGGCCTCCCACACCAACCCTA
TCCTTAAAGCCAGCTCCGCCTGCTCCAGTTCGCCTCAGCCCAGCCCCACCCCCAGGCTCC
TCCAGTCTGTTGAAGCCCCTCACAGTGCCACCGGGCTACACCTTTCCTCCTGCTGCTGCC
ACCACCACTTCTGCCACCACAGCCACTGCCACTACCACAGCAGTGCCAGCTCCAACTCCT
GCGCCACAGCGCCTCATCTTGACTCCTGATATGCAGGCTCGCCTGCCGTGTAAGTCCCCA
CATCTCTCTGATAAGAAACTAGGGATGGGAGGAAGGAAGGCTTATATGCCAAGGAGCTGG
AGAATAAAAGCTTAGGAACATCGGACTATCAAATTCTAGGCAGCTAACAGATATTTGCCA
GGCATTAGTAATTTGTAATCAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCAACAAGCTGACTTTGACTGGTGCCCAGGT
GCGCCAGCTTGCTGTGGGGCAGCCCCGCCCGCTGCAAAGTAGGTAAAACCCACCCCCTGT
CCTGCCTTTTTCCTCCTCTTCTCTGTTCGTTTGTTTTTGTGGCACTTCGTTTTTAGATGT
CAGCCTTTACGTTTCCTTCACCAGCTTGGGCTGGGTGGTTGGAGGGGGCCTTTTGATAAA
GAGAAGGAAGAGGTCATTCTAGAGATAGTGGTCCCCTTTCTGTTCATTCCCTTTTCTCTT
GCCTTTGCCTCTCCCATTCCCTGGCTGATAGCTGCTTCTCTCTTTCTTTCTCTTTTCCCT
TAACCCAGGGAATGTGGTGCACCTGGTGTCAGCAGGGGGGCAGCACCACCTCATCAGCCA
GCCTGCCCACGTGGCCCTCATCCAGGCCGTGGCACCAACCCCTGGCCCTTCCCCTGTCTC
TGTGCTGCCTTCTTCGACCCCCAGCACCACCCCTGCCCCCACTGGTCTCAGCCTTCCGCT
TGCTGCTAACCAGGGTGAGGCTCTTGGCCTTCCTACTTACTTAGCCCTTTGCTGGCCTTG
GTCCTTCTAGGCATGCCCTGGCTATTGTTTGTCCAGCCTTCCTTCAGTGTTGCTTCCCCC
TGCTGATATCACTGATGTCTGTCTGCCACCCTCTCCTGCCCCTGGACTTTTTCCATCCTT
TGGGCCTGTTGTATGTTTTCTACCTTTCTCTCAATGTAGCTTTCTCTTGCAGTGCCACCA
ACCATGGTGAATAATACAGGCGTGGTGAAGATTGTAGTGAGACAGGCCCCTCGGGATGGA
CTGACTCCTGTTCCTCCATTGGCCCCAGCGCCCCGGGCCTCCCAGCTCTGGGCTTCCAGC
TGTGTTGACTCCACGTCCCACATTAACCCCTGGCCGGCTACCCACACCTGCTCTGGGTAC
TTCCCGGGCCCCTATATCCACGCCCACTCTGGTGAGGCCCGTTCTCAGCTGGTCCACAGG
CCCTTCGCTTGAAGTCACTGGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTGCAGTAGGTCCCAGAA
CTGGGCTGCCCAGGCCCTGGCTTAAATCCGAGATTTATTTATTGGAACGTTGGAGGGAGA
GGAAATGTTGAGTTTTCAGGCTTCTTGCAGCTTTGACCTCGTGGTGTGGAACTGAAGGTT
GTATGGGAAACAGGTGAAGCTTGGGGGTGGGGGAAAGGGTGGGACAGGGTAGCAGAGCAG
AGGAAGAATTCTTGGCCTAACTCACCCTCTGTCTCCACAGCTTCAGCACCCGGAGCTGCT
CCCTTGACCATCTCTTCTCCTCTTCCTGTGCCGTCCTCACTCCCTGGGCCAGCTTCTTCT
CCAATGCCAGTTCCCAACTCCTCTCCACTTGCTAGTCCTGTGTCCTCTACGGTCCCGGTC
CCAGCCCCAGTCTCGTCTTCACTCCCCATCTCTGTCTCTACCACACTTCCTGCCTCAGCC
TCAGCTCCGCTTACCATTCCCATCTCAGCCTCCTTACCGGCTTCAGCTTCGGGCCCGGCT
CTGTTGACCACTGTGACTCCAACGCTGGCACCTGTTGTCTCAGCGGTTCCCGGATCCCCC
TCTTTGGCTCCAGCTGGGGCTTCCCCATCAGCATCAGCCTTGACTCTAGGTTTGGCCACA
GCTCCGTCCCTGTCCCCATCTCAGGCACCTGGTCACCCTCTGTTGTTGGCTCCCACCTCT
TCACATGTTCCAGGGTTGAACTCAACTGTGGCCCCAGCATGCTCACCCGTCCTGGTGCCA
GCTTCAGCTCTGGCCAATCCTTTTCCGGCAGCGCCAAACCCAGCTCCAGCTCAGGCTTCC
CTTCTGGCTCCAGCACCTTCTACATCTCAGACCCTGGCCACCTCTCTGGCTCCCATGGCG
GCTCCACAGACAGCAATCTTGGCTCCTTCTCCAGCTCCTTCTCTGGCTCCTCTTCCAGTC
CTGGCTTCATCACAGACTCCAGTTCCAGTCCTGGCTCCATCATCTACTCCAGGAACCCCT
TTAGTCTCAACTTCTTCACTGGTGCCAGCCCCAACTCCTGTGTTGGCTTCGTCGTCAGCT
CAGACTATGGTATCAGCCCCAGTTCCACCACCTCTTCCAAGCCTGGCTTCTACACAGACA
CTGGCCCTAGCCCCAGCTTTAGCATCCACTCTTAGCGGCTCGTCTCCATCTCAGACACAC
TCTTTGGGAACAGGAAACCCTCAGGGGGCCTTTCCAGCTCAGACATGTCANNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGAGACACTGACGTTGCGCTCTGGCCCCCCCCAGCCCACCCTCCACTGCTA
CCTCGTTCACTAGGCCCTCGAGCCTCGACGCCAGCCCCCACCACCACCTCGTTCCCCTTT
CTATCTGAGTAAGTTTTACTACCTCAAAGGAGAGAGAACAGGAAGTTGTTCTGTTGCAGT
GTGGGTAGGTTAGAGCGGATGGAACAGGATAATGTCACTGTTCTGGCAAATTTCAAAGCC
GTCAAAGTGTTGTAGACCAAGTACTTGAATGATACTGGGCAAGTCCCTTTTTTTCGCTAG
GCCTGTACCCGTGTCTGTAAAAAGGGAGTAACAACCCATGTTCTACTTTTCTCAGAGGGG
TTATTCAGGACCTGATGTGCTTTTCAGACTGTTTATCACTGATGCGTTCAAGGCCTTCTT
GTTACCATGGGTCTCTTTGGTTCTTGCTTGCTCTTTTGAGTTAGCATTGACATGCAATTG
CCTGTCAAATGATAGTTAATGTTACACAGTGAGAACACAGCTTTATTGACTCCATTGCTT
TTTCCTGTTCCCCACAAGAGACGGTCCTTATGTGGGAGTACTTTTTCATTGCGTATTCTT
TCCAAAGGAAGGATGACACACCGTGAAATAAAACCGCCCCCCCACCAAAAAAAAACCCAT
TGCCATCAAGTTGATTCCAACTCATAGTGACCATATAGGACAGAATAGAACTGCCCCACA
GGGTTTCCAAGGCTGTGATCTTTATGGAGACAGACTGCCATGTCTTTGTCTCATGGAGTG
GCTGGTGGGTTCAAATTGCCGACCTTTTGCTTAGCAGCTGAACACTTAAGCGCCACCAGG
ACTCCTCCACCACAGGATAATTCCCTAAAGATCATAAATTTCTGACAGCTGTTTCTTTTA
GTTTTTCACTGGTGAGAAGTGGGCAAAACAAGGAACTCTGTTCTCTCTCTTTGTGAGCTG
GTAACGTTTTTTTGTCTTATCTTATGTATTGTTCCCATATGTATTCGGTTAAATTAAACT
TGCAGCTTAGATTGGTGCAAATAATCCCAGAACTAACAAGAAGAAAAGTACCAGTGAATA
TCTCTAGGCTTTTTCTTCTCTTTTTCTCACTCTTTTATCAGAGCTGCTTTCTATTTNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTTGCTTCCCCCACCTTTTCCT
TTCCTTTTCTGATGCTGCCAGCCTAATCCTGATTGTTGAGAGTAGACAGATAGCAGCCCG
GGTCCTAACCCAGGGGTAGAAAACCATGGTCAATGCTGAATTTTGATTGATCTGCAGGGA
GGTGGCAGCTTCTTGTCATCATTTTTTTTATCTAAATAGCTTCATCAAGATATAACTTAC
ACACTACACGTTTTATGTATTTAAAGGTACGTAAATAGCTTCATCAAGATATAACTTACA
CACTACACGTTTTATGTATTTAAAGGTACGTAACCCCATGGCTTTTAGTATATTCACAGA
GTTGTGCAGTCACTGTTGTTGGCTTCTGGCGGGTTAGCCCCAGCTCAGGGCGAGCCTGTG
TACAACAGGATGGGACCATTGCGATTCACAGGGTTTTCATTACCTGATTTTTGAAAAGAT
TGCCAGGCCTTTCTTTCTGTGCCAGGCCTTTCGTCCTCATCCATGTTAGTCTGGAAGTTT
CTCTGAAAACTGCTCAGCGTCCTAACAGAATGAAAGTCTGCGCTGATAAATCGTGGCAGC
GCATGAGGTGCATTTGCTGGGAGTTGGGCCTTGGTTTCCTTCATAGAAGGCGAGGATTTT
ACTACTGAGCTGCCACTGCCCTCTCTGCAGTCATTACCACTAACTAATTTTAGAACATTT
CATCACCCCAAGAAGAAACCTTGTATTCATCAGCACTCATTCCCTCTACCCCTATCTTAC
CCCACCCATGGGCAACCACCAGTCTACTTCCGTTTTGTATAGATTTGCCTATTCAGACGT
TAAAGAGTATCATGTATGATGTGGTCTTTTGTGACTGGTTTTTCACTTAGCAGTAAACTT
GGGGTCACCATTAACTCAGTGGCAACTAATAATATTTTCGGAGTCCATTCGTGTCTTAAC
ATTTCACCCCTTTTTAAGGCCAGATAGTATTCCATTGTATGGTTCTACCACATTTTATTT
ATTCATTCATCAATTGATAGGGACATTTGTTTTGTTTCTACTTGTTGGCTATTACAGATA
GTGCTGCTATTACGAATAATTTTTGTCTGGAAATATGTTTTCAGTTTCTCTTGGAATATA
CCGAGGAGGGAATTGCTGGGTTGTATAGTAGCTATATGTCTAAGTGTTTGAGGAATTGCC
AAACTGTACTGCAAAGTGACTATACCATTTTATATTCACATCAGCAAGGTGTGAGTGTTC
CATTTTCTCCATGTATAGCCATCCAGTGGGTGTGAAATGGTATCTTACTGTGGCTTTGAT
TTGCATTTTCCTAATGCCCAGTGATGTTGAGTTGAGCATTCTTTTATGTGCCGTTTGGCC
ATTTATGTATTTTCTTTGGAGAAATGTCTCTTTACATCCTTTGTCCATTTTTAAATTGAG
TTGTCTTTTTATTGTTGAGTTGTAAGAGTTCTAGGTACAAGTCTTTTTTCAGATATATGA
TTTGGAAATATTTTCTCCCTTACCACTATTTTTTAGAACTAGCTTGTATTGGTTTTTCCC
TTTGCTAGGACATCCCTTCCTCACTTGGAGCACCAGGAGCCAAGAGATCATGCTTAAGGT
AGCAGTCAGGAAGGGAGATGTGGGACACTCCTTTTTCAGGACCCTTTCCGGGTTGTCTCC
TTCATTATTAGTTCATTCTATTAATGAATATTTACTGAGAACTGATGTTGTGTCAGGTAC
TAAGCTAGATACTGGGTGATTATAACGAGCAAAATCAGATACAGTTCAGATTATGTAGAG
CTTACAGTGTAGTGGGTTGAAACTAATATAAAACTACAAGTGTGATAAGTGCTACAAAGG
GGAGTCAAGTGGTTTTACAGATTGAAACTGGAAGTACAGAGCTGGGAAGCAATTGGGTCA
AAGTCATACAGGTGTCCTGGCTGCCAGGGCACTTCTCCTTTTCTTTCTTGGGGTGATGAA
ACTTGTATGGCTGTTTAGCCGTTCCTGTTCCCACCCCTGCCTGGACCTTGGCAGAAACCT
GCCGTAATTTGATTAGCTCCTTTGTCTCCTGTTCAGCCCGTTGGAGAAGGGTTCCAATAA
TTGTTTTGGACCCACCCCAACAAGATAAATTAACTTAGATGTTCAAAAGCTAAGTGTCGC
ATAGGAAAGTGCCTGCAGATCATTCACTTTATAAGCTTGTTGGATTGCAGATTTAATTTT
AACGTGCTGAAAGGAATTGCTCATTCTTGACAACTTGAAAAACTTAAAAAAGCATATCGT
ATTTTTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTGCCCCCTTCCCTGCCATGCCTGCCATCCACCCCCCTTGGGCTGGC
CCCACGTCAGGCAGCCTTCCAGGAGCAACTGGCTTGTGAGCTCTGGCCACGGGCTCGTCC
TTTACACCGTATTGTGTGCAACATGCGCACCCAGTTCCCTGACTTGAGGCTCATCCAGTA
TGATTGCGGTGAGTTCGGTGGCCAGTAGTAAGACTGTGATATCAGAGGGTCTCTGTGAAT
TTCGGTAAAGCGGTAGGTGGTTTTGTAGATTATGCTTATGGGTAAGATGGAGAAGTGGCC
GTATGATGGATTCTTGGCATTCGTGGGTTTGACTTCAGTGAAACTTGAAAATGTGTGCTG
CTAACTCATTCATTCAGTGAATATTTTATAAACGTCTATTATATTTTGCTAATCATTTGG
GCTACAATGATGACCAAGACAGTATAGCATAGAGTTTTCAGATATATGAGGAAAGGTGTG
TGGTGATTTAAGACTACAGAGCAAACAGGATAATTGGGGGAAAAGCAAGGGTTTTTGTAT
TGATGAGAATGCATTTAGCTGCAAGTAAAAAATAAAAACCAACTGTCGCTGACTTAAACC
ACAAGAACATTTGTTGTTAATGAGGAATTCTTAGTAAGTGCAGGACTGGTTTAGTAGTTC
AATTGTCTTCAAAAAACCAAGGACTTTTCTCTCTATTCTGCCTGTCATTCTTAGCTTTGA
TCTTTTTATCTAATGTTTATTTCATCATGATCTCAAGATGACTAGCAGGGAGCACAGCAG
TGCTCCAAGCAGGAAGCAAGAGGTTGAGACAATAATCCTTACAATCCTAGCAAGTTTTTT
TTTTTTCTGGAAAAGAATACCCTCCCTTAGACTTTGCTTCACGATTCATTGGCTCATACT
GGGCCGTATGCCCATCCCTAGAGCAGTCACTGACAGACCAAAACCAAACCAAACCAAACC
TGTCGCCGTTGAGTCGATTCTGACTCATGACGGCAAAGAGAAACAAACTTTGTTTAGACC
GATCATGATTTATCTTCTGGGGCTTGGTTGGGGCCTGCCTGCCGATATAATCAAGGGATC
TCTGCCAGCTGCCCGTAAAGTTAACCAGGTTCTGTTAACCAAGAATGGCTGTTGGACAGT
AGTGAATAGTTTCTGCCACAGCCTTGCCCAGACATTTCTTTAGTAACATGTTTAGAGATT
TCATAAGTGTTTTAACCAAAACCCAAACAAAGCCCGTTGCTGTCGAGTCAATTCCGACTC
ATAGCAACCCTATAGAACAGAGTAGAACTATGCCGCGTAGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCCCAGCATAATGTTTTCAAGTCCATCCATGTCATAGCATGCATCAGAATTTCATTCCT
GTTTCATGGCTGAATAATTATTCCATTGTATGGATACATTCTGTTTACCCATTCATCTGT
TGATGGATATTGGGTTGTCTCCCTGTGATGGTTAAGGTTGTGTGTCAACTTGGTTGGGCA
TGAATCTCAGTGGTTTGGCAGTTATCTAGGTTGGCAGCTATGTAATGATGTAATCACCTC
CATAATGAGATCTGATAGAATGTAATCAGTTCCATGATGAGATCTGATAGGAACAGCCAA
TCAGTTGAAAGGAAATTTCTTTGGGGGTGTGGCGTGCATCCAATATATGTGGACTTTCTG
GCAAAGCTCACGGGCTTTTGCTCACTCCGGATCCTGCACCTGGCATCTATCTCTCCTGCC
ATCTGACCTCTGGTTCTTGGCACTTGAGCTAGCAGCTTACCTGCCAATCTTGGGATTCGT
CAGCCTCCGCAGCTTGAGAGCCAGCAGCCTGCTGTCTTACCTGCTGATATTGGGTTCATC
AGCCCTGCAGCTATATGAGTCAGGAGAAGCCTCCAGTCTGACCCACGTACTTGGGACTTT
CCAGGCTCTACAACTGTGTGAGTCATTTCCTTGACATAAATCTCTCTCTCTCTCTCTCTC
TCTCTGTCCCATCCTAAGACACTCCCCCTTTTGGCTGTTGTGAATAGTGCAGTTATGAAC
ATTCGTACGTATACCAAGTGTGTGTTTGAGTCCCTGCTTTCAATTCTTTTGAGTATATAC
CTCAGAGTGGGTTTGCTGGATCTTTTTTTTTTTTTTTTCTTGGTTTATCGTAATTCTATG
TTTAACTTTTTGAAGAACCACCGAACTGTTTTCCACAGTGGCTACACCATTTAACATTCC
CTCCAGCAATGTACAAGCGTTCCAATTCCTCCACATTCCTTCATTAAAAAAAAATACATA
ATTAAAAAAAAAGTTGTCAACTCTGATTCATGGCAACCCCATGCGTATCAGAGTAGAACT
GTGCTTCATAGGCTTTTCTTTCATTTTTTACTATTGTTAAAACTATACACAGCAAAACAC
ACCCCAATTTAACAACTTTCTATATGTACAACTTATGGACATTGCTTACATTCTTTCAGC
TGTGCAATCATTCTCACTCTCTTTTTCTGAGTTGTTCCTCCCTCATTAACATAAACTCAC
CGTCCCCTAGGGTTTCTATCTAATCTTTCAAGTTGTTGTAGTCGACTTGATCCCATATAG
ATAGTTCTTAAAAGAACATAATGCTCAAGGGAGACCTTAGTAGCTCAGCTAAACTACTGT
TTGGATATTTTTGGTTTAGGGTTTAAAGGGCAATAGTTTTGGTGGTTCATCCAGCCTCCA
TGAACATCCAGAAAGGCTGGATTCCATGAGAATTTTAAGTTCTGCTCTGCANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNACAGGTCTTTGTGTTAAAGTGTATTTCTCTGTGTTAATTTATGATACTTAACTCAAAT
CTAGAGTTTCGAGCTCATTTTGATAATTCCTCTTTAGTCTGTGGAGACAGGAGTCTGCCT
TCAGCCAGTGGTGAGAGTGGAAGAAATATAGTCCCTAGTCCAGACTGGGGCAGGCTCTGC
TGCTCCGCAAACTAGGGGTGCGGTCTCTGAAGAGCCCTTCTGAGGACAGCACAGGAGGGG
CGTCTCGCCTGGAGAAAGAGCAGAGGGGGGTGGGGGATTGTTTGTGTGAGCAGTGTGGCC
TCTGTGGCTTCGCCTTCTCCTCCTGGAAGTGCAACCTGTGGCCCTTCACGTGCGGAGCCA
GAGTCCTAGGGTGACCACAACTCTCCCACCCTTTCTGGGTCTCTTATTTGCACAGTTCCA
CTCAATCATTGTGTGTAAGTCACAAAGACTACGGCTAGAAGGGCCATATTAAGTAATTCA
TTGAGCTGCAAGGATTGATAAACTTTTTCTGTAAAGGGCCAGAGAGAAAATATTTTAGGA
TTTATGGGCCATATGGTCTCTGTTGCAACTACTGAATTCTGTCCTTGTTGCATAAAAACA
GCCACAGACAATATGTAATGAATGGACATAGCTGTGTTCCAATAAAACTTTAGTTATGGA
ACTTGAATTGCATACTATTTTCACATATTACAAGATATTATTCTTCATTTTTTTTCTCAA
CCCTTTGAAAATGTAAAAACCATTCTTAGCTTTTGGGCTGTACAAAAATAGGTGGCAGAT
AGGACTTGGCCCGCAGGCTGTAGTTTACCAATCTCTGATAGAGAACATTTTTAGAATTCC
AGAAGATTCTTTCATGCCCCTTTTCAGTTAGAATCCCCCTCCGCCAGTCATTAGTGTTTT
GATTTTTATCACCAACAATTAATTTTACTTGCTCTTCAACTTTATATAAATGCAGTCATA
TAGTATATACTCTTGTGTCTGGCTTCTTAAGTTTAACACAATGTCTACCCTGAGGTGATT
TTATATCATGATGCATAATTTGGGTTTTCATTTAAGTGGACTAAGAAGCCATTTGGGGGT
TTTAAGTGGAAGAGTGACATGATCGGATTTACATGAGAAAGAGTCACTCCTGTTGGTGGG
TGAAGAATGGGTTAAAGGCAAATAGGAGGAGTGGAAGTGCAAAGTAGAGTCAGGATCAAT
CCAAGCAAGAGACGATGGTGGCTTGAATTATGGTGATAGGGAAACACGTCAGATTTTGGA
TTTATTTTGAGTTTAAGCTCATGGATCAGTACCAGTTAGTTTTGTTTTTAATACAGTGTT
ACAGGTAGCTCGCACTAGTCAATTTCCTAAATATTCTGAGAAACGTGTAGTGGATATGTG
TTGTATAAACCGTGTCTCTGCTCTAAAGGGTTGATAATTTTTTTTGGAGGGGAGGAGGAG
ACCATGAAACAAGATGCAATGCAACTGGTGCTGTAAGAAGCCCAGGGGGCTATGGGACAA
CTTCCTCCTGGAGGTTGTGGTCCTTGAGCTGAGTTTTGAAGGAAGAATGGTTGAAAAAAA
GAAAAGCTATACGGAAAGGCCAAGAAGTATGAGATCTCCTAGGAGTTCAGTGTGGGTCTA
TGGGGGGGGAAGGGGTGTGTCTCAGAAATATGTAAGCTCGGCCTGGAAAAGAAGACTTAG
AACTGGGCCTGAACAGATGCGCATTCATTCACTTATCCGATTCACCAATCCTTCCTGGAT
GCTTCTATGTGCCTTGAGGTCCCAGCATAGGCCAGAGTTAACAAATTGGCAGCCTGTGGG
CTGAAATATGACCCATCGATTTTGTATCTATACATGTTATCATACATATCTATAAAGGGC
CCTGGTGGCTCAAACAGCTAAGGGCTCAGCTGCTAACAGAAAGATTAGCAGTTTGAACCC
ACCCAGTGGCTCTGTAGGAGAAAGACCTAGAGATCTGCTTCTGCAAAGATTACAGCTAAG
AAAATCCTATGGAGCGGTTCTACTCTGTCATATGGGGGTCACCATGAGTTGAAATTCACT
GGACAGCACGTGATAACCGTATCTGTATCTATACACGTACGTCCCTAGGTGATTTTGAAT
CCACTCAGCAGTACCACGGAGAAAAGGGCTTCAGCATTTACCTTTCGTTAAGATTACNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGGAGCCAGACTGGCCGTCGTTGGGCA
CCCGGCGTGTCTCCTCTCCCCTCCCGCCCTTCTGCGCACGCGTACCCGAGCCAGCGAGCG
AGCCCTGAGAGGACGGACCCAGGTGCGCTCCTGCCCGCCCACCAACCCAGCCCTCCCGCC
CCAGGGGCGTGCGGGAAGAGGCAGGGGGGCGTGGGGCGAGTCGGGGGCGCGCGCCCACCA
TATCCAGTCAGAGGACCAGGACCTGGCGGCACGAACCCTCATTTTCCTCAGCCTTTTGCG
GTGTGGTTGTGGGGGGGGGGAAGGATCCAGACAAGCTGGGATGAGCTGCTTCCCTGCCCT
GCGACCCTTGTGTGCGTGGGTTTGGGTTCTGGCGGGAGCCCTCTGGTCTTGCGCGCTGCC
GGCTCGCTCCGCCTCCAGGCGCGCACGCGCGGGCCCCTCCCCCCGTCTGGCGCGCTTGAA
GGGTGGGGTGGGAGCCTAGGAGGGGGCGGGCTGTCTTAGGGCTAGCGGCAACCTAGGGCA
GAGGTCAGGGGTCACGCCGGGTCACCCGGCTTGGGAGGGATTGGAAGACAGGCATGAAGA
CTAAGGTCATGACTTGAAGTTTCTTGGGCTCTGGTTAGCTGGAGTCCTGGGAATCTTGTG
GAGGAGGCAGTGAATCAAAGGCGGCACCTGGTTAAGGAATTTCCTTAAACACTGGGGAAA
CACCTTCCGGGGCCTTGTGTGGGTTAACGCTCCCCGCTTCCGGTGCATGGCTCTTGGCTT
TGCGGCCTTGCGCACATCTGACTACGGTAATGTCTGCTGCCGTAGTTCTTGTGATTGGAG
AGGTGTCTCATGGAGCAGGTACAGGATTCACACGGCCCTGTCCTGAGGAAAAGTGGATTC
CCTTGTTGCCATATTTATGTACTTTTCCTGGCAATGCCACTCTTATTCCTGACCCAGCTT
TCACTGGGAAGGAGAACAGGCTGCCCTGCATTCAGCACTTTTTTGAACTTCTGGATGGGG
CAGGTTTTTTTGTTTTTTTTCCTTATTTGCTCACTAGTCGGTAGTTGGAGCTTTTGACCC
TTAAACTTTTTTGCTACACTTTTTCCCTGTTTCTTCTCTACAGCTAGAATCTTAACTTTT
CGAAGGATTGTGTTTTCACAAAACACGATTTGCTTTTTATTTCTTCTGAATGTTAGCTTT
TCCTACTACTGTAGCTCTCTTTGCAGTCTTCGAGCTGATCTAAAAAAAAAAAAGGTATAT
ATAAAAGCCTGGAAAACCTGGAACAAAGAATGGGCTTTGATGAATGTTGGCAAATGTGAA
ATAGTACCTCATGACTATCCTCCTCTTCTTCTGGTTGTTTCAGGTGTGATTCCCCTGATT
CCCCTCAGTACGGCGGCACCGTGGAAGTTCAGACCTTCACGGGGGGTGTGGTCTCAGCTC
ACACAGGTGAGAATTCAGTTACCTCTTTGTGTGCTGATGCAAATGGAAGAAATGGTTGAG
ATAATGAGAGAGATTATAGGTCAGTACTTTTGGATTCTTGCTCTGGAGAACTAAGGGAAT
ATTTGTGTGTAATTTCCCTGTGGAGAATTAGTTGACAGTAGGGCAACAGTGAGCCCCGGT
GGTACAGCGGTTAAAGTGACTGCTAACCAAAAGGTTAGCAGTTCGAAACCACCAGCAACA
GTCTGCTTCTGTAGAAATTTACAGCCTTGGAAACCTCATAGGGTTGCTCTGAGTCAGAAT
AGACTTGATGGCAGTGGTTCGGGTTAGGGTAACAGCAGAACTGAGGCTGTACATAGAGGA
AAATCTGGTCACCCTGGCTCTACCAAGGAGAGTGACAGGTTTTGGCATCAAACTACCTGA
GTTTAAGCCCTGCTTCCACCACTTCTACTGTGTGACCTTATGCAAGTTATTCAATTTTTG
TAACTTCTGATTTTTTCGTTTGCAAAATAGAGGTAACATTAGGACATAAGCTCCATTTAG
CACAGAAATCATATGATGTATGACTCTATATTCACGGCTAAGCATGTTACCGTTGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCTCCCCAGATGTGTAAAGCATCATAGAGACGTTTTTCTCTACAGAGTGCTTTCTCGTC
ATGGCTGGGCACATTCTGGTCCGCATCCCTCAGTGACTTGAGTGTGAACTCTGGGTATTC
ATCTCAAGGGAAAGATCGAATGTGGTTCATTTGTTGGAGAGACTTGTCGTGAAGTATGTC
AATACAAAAAAGAATTTTAGGGTTTTTGGTATTCAGAATTTTTTGTGACTGATTTTTTCA
GAGATCTAAAGCTAACTCCAAGGAAAGGAAGTAGAGCTAGAGGTCTCTAGAACAACTCTC
TTGTCTCTAGTGGGAGTCCTGGTCAAGTCCATTCCATCCTTAACGTGAACCACAGAGTTG
CTTTTGGGTAACTCTGAGGACCCACGAGGGCGTTGCGGAGTTCTGTTGCAAATCTGGGTT
TGGTGTAAACTTGGCCTCAAATTTTTGCCAGAATCAAATCCCAGGATGGTAAAGTTCTTT
CAGGCAGGTATGATGGGTTTTTTTCTTTTCCCACACCCTTGTAGGCGTTGTGTCGGGCAG
AGGAATGAAGGAAGATATCCGTTGCGGCCATCTCAGGCCAAAGCTGAACAGGTGGCCGAG
CTTGCGGAATTCAATGAAAATGATGGGTTTCCTGCTGGCGAGGGAGAAGAGGCCAGTCGG
CCTGGGGCTGAGGATGAGGAGATGTCCCGGGCTGAGCAGGAAATTGCTGCCCTTGTAGAA
CAGGTCAGTGTTGAAGCTGCAAGTTTTCAACCTCACCCTTTACAACTCCCTTCCACGGGC
TCTCCGACCCTCCTCCTTTTTGGTAATAACAAGCAAAGGTGATGAGCCCTGGGTAGCAGT
TCCGTTTGTCCATCACTACTACTCTTCCCTGCAGCTGACTCCCATTGAGCGCTATGCCAT
GAAATTCCTGGAAGCCTCGCTGGAGGAAGTGAGCCGTGAGGAACTCAAACAGGCGGAAGT
GAGTATCTCTAGGGGGTGGAGCTGAAAGTGGGAGGCTGCTGATTTCTACCCACTCCCACT
CTATTTGCCACCCTCTAACCATCCCCTGGGCTCTTTTGTTGGCAGGAGCAAGTGGAAGCT
GCCCGCAAGGACCTGGACCAAGCCAAGGAAGAGGTGTTCCGCCTACCCCAAGAGGAGGAG
GAGGGGCCAGGGGCTGGGGATGAGGCTTCCTGTGGGACAGGTGGAGGCAGCCACCGGCGC
AGTAAGAAGATCAAGGCTCCTGAGAGGCCGGGAACCCGAGTCAGTGAGCGTCTTCGTGGA
GCCCGGGCTGAGACTCAAGGGGCAAACCACACTCCCGTCACACCTACCCAACATACCCGC
AGTACCTCCACACCCCCCCCGCAGCAGCCCTGCTAGGGAGCGACTCCCCGGCTGGCACCT
AGGCTTCGACCCACTCCAGCTCCTGCTATCCCAGTTCCCCACCCCAGTCCCCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGACGTG
AGTGGGATGCCCTCACCTAGGCTTCCCAACATGGCCCCTCTTCCCCACACCAGGCCTGAC
TCTGTTAACCACTACTTGAAGTCTTGAGAGAGAAAGCCTCCAGAGAGACTTAAGGGCCTT
CTCCCTTCTTTCCACCAAAGTAGGGGGTAGGCAACTGGTTGTCATGGAAATACGGCTCTT
CACCCCCCTCTTCCCTTCCACCCCACATGGTTGGGCAGTGTTAAGGGTGGCAAGATAGTC
TCTGTCCCCACCCCCTTGTACTTGATTTTCCAGCTATCTTTCCTAGCCTCCCACCCTTAG
GAGAAGAGGGAGGAGCTTCTCTACAATGAGGTTTTTTTTTTTTTTTTTTTTTAAAGAAGA
AAAAATAATAAACTTAGTTTCTGTATGAGCATCCGCGTAAGGAGGCTTCTGATTTTCTGG
TCTGGTGGAGGGTTGGATGGGAACTTGGGCATCGTTTTTTTTTCTTCCCTCTTACTCTTG
CCAAAACCCCAGTGCCTGATCTCTAACTCGGATTATATACACCTTTGAGGGGAAAATCTC
CACTCAAGAAGAAGGAAGATTGGCAGATTTGACCTCCTGGTAGGGTGCCTTTCCCTAAGG
GTTGAGATTTTAAGTCACTTGGATTCTTACACCTTTCCTTCAGTTCAATCCCATTGGCTC
TTGGACTTTCCCTTTGAGCTCTGATGCCTCAGACTTCCCTTTTATCCTTGCTCAGGTGCT
TCCTTGTACTCTTTCCATGAAGGCAGGCATCCCACCTCCAGTTGCCCCATCCCTTAACCC
TCCCCTGCTTTCCATCCAGCCAAACTGGTTTGAGTCAGCCACACCCCCTTCCCAGCTCCT
GGGGCTCCTCAGGTGGTGGGGTGGCCACTCAACCCCACCCCTGGGCTTGGCTTGGAGTCC
TGAGTCAGCTCGTTCTCCACCCAAGCCAAATCAAACCTGAGGCAGGAGCCGAAACTTACA
GTCCCTCGAGGCGTGTAGCCAGGTAAGAGCCCCTGTTCCTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1232, 1348..1622, 2229..2322, 2463..2552, 3140..3331, 3421..3743, 3855..4032, 4291..4427, 4653..4822, 4963..5155, 7097..7233, 7449..7513, 7521..7642, 8017..8186, 8505..8508, 8611..8622, 8625..8657, 8660..8798, 9893..10057, 10732..10835, 10837..10917, 10919..10929, 10934..10950, 11440..12405, 12641..13038, 13270..13299, 13301..13330, 13332..13339, 13341..13386, 17051..17316, 17620..17653, 17656..17668, 17670..17690, 17693..17827, 19040..19209, 19310..19506, 19607..19721, 19822..19941, 47744..47763, 47765..47769, 47771..47781, 47783..47791, 47793..47942, 48094..48168, 48285..48551, 48553..48582, 48585..48626, 48658..51000
1001..1232, 1348..1622, 2229..2322, 2463..2552, 3140..3331, 3421..3743, 3855..4032, 4291..4427, 4653..4822, 4963..5155, 7097..7233, 7449..7513, 7521..7642, 8017..8186, 8505..8508, 8611..8622, 8625..8657, 8660..8798, 9893..10057, 10732..10835, 10837..10917, 10919..10929, 10934..10950, 11440..12405, 12641..13038, 13270..13299, 13301..13330, 13332..13339, 13341..13386, 17051..17316, 17620..17653, 17656..17668, 17670..17690, 17693..17827, 19040..19209, 19310..19506, 19607..19721, 19822..19941, 47744..47763, 47765..47769, 47771..47781, 47783..47791, 47793..47942, 48094..48168, 48285..48551, 48553..48582, 48585..48626, 48658..50997
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved