Loxodonta_africana Locus CNOT1
snOPY snoRNA Orthological Gene Database
Loxodonta_africana CNOT1
Loxodonta_africana
CNOT1
GeneScaffold_1373
SNORA50, SNORA46
78793..78928, 97736..97874
149995
NNNNNNNNNNNNTCCTCTAGTCTCAGTCAGACCATTAAGTATGGTCTTTTTGTGAGAAT
TTGGGGTCTGCATCCCACTGATCTCCTGCTCCCTCAGGGGTTCTCTGTTGTGTTCCCTGT
CAGGGCAGTCATGGGTTGTGGCCGGGCACCATCTAGTTCTTCTGGTCTCAGGATGATGTA
GGTTTCTGGTTCATGTGGCCCTTTCTGTCTCTTGGGCTCTTAGTTATCGTGTGACCTTGG
TGTTCTTCATTCTCCTTTGATCCATGTGGGTTGAGACCAATTGATGCATCTTAGATGGCT
GCTTGTTATTTTAGTATTTTTGAATTATTATCCGCCTTTCAGTCAGCCATTCAGATACGT
AAAACATGCATCCTAATGTATAACTTTAAGACCAAGCTATCAGATTCTGAAGCAATATAT
AAGGAGTAAAGTGAATAAATGGATTATTGTACATAGATTGTCGACAGTGTGGAAAGAGGC
ACTTTAAATGTGGAATGAGTATTTCTTTCCACAAACCCTAATTTTAACTGTAAGTACAGT
ACTTTCCTGCTGTTTCCAAAGAGTAAAATAGAAATCTCAAATATTATAGATTGCCTTGTT
AAAATAAAATCTTTTGGGAAGGGTTATTTTCTTACACTTGCCCTGTCTTATTTTGAAACT
TGGTGACATTTGTCAGTTGCTGTTGAGCTATCTGAAGGTTTTTGTTTTCAGTCCTTAGGT
GATGTTTTATGTACTACGATGGAGAGAAGAAAAAATTTTTAAAGCTTTTTTTCCTGTACT
TAAAAATGACTAACCTGAAGTTCTGGATTTTTTTTTTTTTTAAACAGGTGCCATGTTTCA
GAACAGAGTAAGACCCCTGGTTAAGAAGAACTGAACACATTGTGCAGACACCAGATATAG
GCTAATTACAAAGAAAGCATTAACCTGCCTCTGAGGTGACTAAAGGGGAATAATGGTGAT
TTTGCGCCGGGCTCGGCCGCCTGCTTCCGCCCCAACCAGCAATGAATCTTGACTCGCTCT
CGCTGGCCTTGTCTCAAATCAGCTACCTGGTGGACAATTTAACCAAGAAAAACTACCGAG
CCAGCCAGCAGGAAATACAGCATGTAAGTAAATTTGTCAGAAAACAAATACCATTAAAGG
TAATGAGTGTGCAGTGGGAAAAAAGCTGGAAATTTATGTGGGTATTTTGCATGAAAGGTA
ACTAACTTTTGCCCTTTATTTCAGACGCTTTCACTTCAGCTTAATATGTAAGAGGTATCT
TACCTCAGTCTTTTTTTTTTTTTAGCATTCGCAGATTTTTATTTTTCTATGGAAATTATG
GCCTAGTTCCCGTTTTTAAATTTTATTTAAAAAATTGAGATACAAATCACAAAAGTTAAT
TCTTGTAAAATGTATGTAATTCAGCATTTTAGTCTATTTGCAAAATTGTGCAGCCGTCAC
TGCAGTCTAATTCCATAACATTTTCATCACCCCAAAAAGAAATGCCGGTATCCATTGGCA
GTCTTTAATTCCTCCCCTAACCCCTGGCGATGACTAATCTACTATGTATCTCTATGGATT
GACCTATTCAGGACATTTCCTATAATGGAATTTGACAATAAGTGACCTTTTGCATCTGAC
TTCCCTTACTTAGCATAATGTTTTTAAGGTTCATTTATGTTGTAGCATGTGTCAGTTCTT
TTTTTGTGGTCAGCAGTATTCCATTGTATGAGTATGCTACGTTGAGTTCATTCAACAGTT
GATGGACATAAGGGATTGTTTTTACTTTTTGGCTATTACAGATAAATGCTGCTGTGGATA
CAAGTATGTTTTCAATTCTCTTGGATATATTCCTAAATGTGGAATTGCTGGGTCAGATGT
TTTAACACTTTGTGGAACTGCCAAACTCTTTTCTAAAGTGGCTGCACCATTTTACATTCC
CACTGTGTATCAGAGTTCAGTTTTTCCACGTTCTTGGTAACACTTGTTATCCGTTTTTTA
GTCATCCTAGTGGTTGCAAAGTGGTATCTCATTGCATTTCCTTAATAACCAGTGATGATG
AACATCTTTTCACATGCTTACTGGCCGTTTGTATATCTTTGGGGGAAATGCCTATTCAGA
TCCTTTTGGACCCCTTCCCCTCCCTTCTCTCTCTAGTCTATTTTAATTGATTTCAAGCTT
AGGTTTGACTTCTGGAGCATTTCATTTGATCTTTATGAAAGTTAAATAGTATAGTTTTAG
TGGTCTTTCTTCCCAGTTTTAAGTCAGCTATATGTATGTATGTATGTGAAATTACTGTAA
CTTCTTAGCTGTGTGACCCCGGCTAACTTTTCTCAACCTCATTTTTCTCATCTGCAAAAT
GAGGATAAAAGAATAAAATTTACTCATAAAATCTTAACATGGTTAAAGGAAATTATAGTA
CCTAACACAGTTCCTGTCACCAAAAAAAAAAAAAACCAAACCCAGTGCCTTTGAGTTGAT
TCCGACTCATGGCGACCGTGTAGGACAGAGCAGAACGGCCCCATGGAGTTTCCAAGGAGC
GCCTGGTGGACTTGAACTGCGGACCTCTTGGTTAGCAGCCGTAGCACTTAACNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAAGTTCAGCAGTTGAATCTACAAGG
TGCTTTTTGGCAAACTGTAGGGGCTGTAATAGTATGTCCGGTAGAGTTCCTATCAGTCGA
AATTCAGCTAGAGAAGCAACGGCTCGGGTTTGTTTTTTTTGTGGCGATACAAAGCCCTGG
CCTGGATAGGGGGGTGCGGACTCCTCCAGTATGGTGTGCTGTCTCACCCTCCACCAAAGT
AAATGCTTAATTATTGCCTAGTTAGTGTTTTTCCTCCCCCTCCCTTGCAACCAACCATCA
AGAATTGTTTCTGTATGTAAACCTTTTCATGAGTTTTTACAATAGTAGTCTCATGAGTGG
AATTGCTGGATCATAGGGTATTTCTATTTCTAGCTTTTTAATGAAGCACCACATGGTTTT
CCAAAATGGTTGTACCCACCAGCTGTGCGTAAAAGTTCCAATATCCCAGAAGCCTCTCCA
GTGTTTCTTATTTTCTGTTTTTAATTGCCAGTAATGTGGGGTGAGATGGTATCTCATAGT
AGTTTTGATTTGCATTTCTGTAATGGGTAGTGATCATGAGCATTTCCTCATGTGTGTGTT
TGCCATGTGAATGTCGTCTTTGGTGAAGTGTCTGCTCATATTCTTTGCCCCCCCCCCCTT
TTTTTTAATTGGATTGTCATTTTGTTGTAGAGGTGTTGGATTTTCCTGTAGATTTTAGAG
ATTAGACCTTGTCTGATTTATCATAGCCAATTTCTTTTTTCCCAGTCTGTAGGTTCTCTT
TTTACTCTTTTGGTGACACCTTTTGATGAGCATAAGTGTTTAATTTTTGATTAAAATTGT
TAAGATTCCAGTTATCGAGCTTATCTTCTGGTGTTTGTTTATTATTAGTTATGGTTTGTA
TCCTATTTATGCAGTATATTAGGGCCTCTGGCATTGACCCTATTTTTTTTTCTATGATCT
TTATCATTTTTGGTTTTATATTTAGGTCTTTGATCCATTTTGAATTAGATTTTGTGTACG
GTGTTAGGTATGGGTCCTGTTTCATTTTTTACAGATGGATATCTGGTTTTACCAGCACCA
TTTGTTAAAAAGACTGTCTTCCCCATTTAGTAGGCTTTGGGCCTTTGTAGGTAGATGAAT
TTACATCTGGGTTTTCCATTCTGTTCTGTTGGCCCGTGTGTCTGTCGTTGTACCAGTGCC
GGGCTGATTTGACTACTGTAGATGTATAGTAGGTTCTGAGATCAGGTAGTGGTAGTGTGA
GGCCTCCTACTTTCTTCTTCTTCAGTAAAACCAAACCAAACCCATTGCCATCGAGTCAAT
TCTGACTCATAGTGACCCTATAGGACAGAAGAGAACTGCCCCGTAGGGTTTCTAGCGTGA
ATTCGATGGCCAACCTTTTGATAAGCAGCCTGAGCTGTTAACCACTGTGCTTTTCAATAG
TAGCTTACTTATCCAGGGCCTTTTAAGTGGAATTTTAAGTGAAAATCTTGTCTCTGTGTA
GCTACTATAAACTGAGACCTTATTTTCTGTGCACTTACAAACAGAAGTATTTATTAGTCT
GTTTTTTAATAGAAATAGGATCATGCAATTCAAAGTTTTGCAACTTTTCACTCAGTATCA
TTTATTTGCTTTACCCAACAGTGTATAGAAAACAGTTTATATGTATTCTTTTATGTTAAC
ACTTGACAAGACAAATGTAAATGACAGCTGCTTGGTATTCCATGGAATGGATGTACAATA
AGCAAATTTGTAATACTGTGTAATGTTTTTCTGATAAAATATTAAACAATTTTATATAAA
TTGTTGTTGTTGTTAGGTGCCGTCGAGTCGGCTCACGGCGACGCTACGCACAACAGAACG
AAACATTGCCCAGTCCTGTGCCATCCTTACAATTGTTGTTATGCTTGAGCTCATTGTTGC
AGCTGCTGCGTCAATCCACCTTGTTGAGGGTCTTCCTCTTTTCTGCTGACCCTGTACTCT
GCCAAGCATGATGTCCTTCTCCAGGGACTCATCCCTCCTGACAACATGTCCAAAGTATGT
AAGACGCAGTCTCGCCATCCTTGCCTCTAAGGAGCATTCTGGCCCCACTTCTTCCAAGAC
AGATTTGTTCGTTCTTTTGGTAGTCCGTGGTATATTCAATATTCTTCCCCAACACCACAA
TTCAAAGGCGTCAGCTCTTCTTTGGTCATCCTTGTTCATTGTCCAGCTTTCACATGCATA
TGATGCGATTGAAAATACCAGGGCTTGGGTCAGGTGCACCTTAGTCTTCAGGGTGACATC
TTTGCTCTTCGACACTTTGAAGAGGTCCTTTGCAGCAGATTTGTCCACTGCAACGCGTCT
TTTGATTTCTTGACTGCTGCTTCCATGGCTGTTGATTGTGGATCCAAGTAAAATGAAATC
CTTGACAACTTCAATCTTTTCTCCGTTTATCATGATGTTGCTCATTGGTCCAGTTGTGAG
GATTTTTGTTTTCTCTATGTTGAGGCGTAATCCGTAGTGAAGGCTGTGGTCTTTGATCTT
CATTAGTAAGTGCTTCAAGTCCTCTTCACTTTCAGCAAGCAAGGTTGTGTCATCTGCATA
ACGCAGGTTATTAATGAGTTTTCCTCCAATCCTGATGCCCCGTTCTTCTTCATATAGTCC
AGCTTCTCAGATTATTTGTTCAGCATACAGATTAAATAGGTGTGGTGAAAGAATACAAGC
CTGACACACACCTTTCCTGACTTTAAACCAATCAGTATCCCTTTGTTCGGTCCGAACAAC
TGCCTCTTGATCCATGTAAAGGTTCCTCATGAGCACAANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNAGTACTGATTTTTATCTCAGTGTAATGATGTGAATGACATTG
GCCGTTACTGTTTTAAACCACATATTACTGACATAGATTTGTTTGTTTTTAATATCCCGG
TATTATCAAGAAAATCCCTTTATGTAAGCTGCATATCTCATAATGAATGACTCTATAGTT
TAATTTATGACTTTGGGTGGTGTGTGTGTGTTTTGCCACTTCCCTCTTTGCCCTTATTGC
TTCTCTTAACCCTACTCTTGTTTGTTCTATCTGCTCTCTCAGCTGGAAAAGAAGTTATTC
AAATTTGAGGTTCTAATAAATGGTGAAGTTAGTGAGATTTTGTGATGAGGAGTGCAAGAG
CCTTAATTTTGTGAGGTGTATTAGTTGTTTAAAGGCCTTTTCTAAAGTTTTTTCTTCAGT
TTACAGCTGTTAAGGAGGCTTGTTTACCTGAAGCATGACCTTGATAAGTGTAAATTGTCT
CTTGACCCACCTTTCAAGTTATTGTGTAATTCTACATAAGTCAGTAGCTGCTCCCCAGGA
GTTGTAGTGAATGAGAAGGAAATATGTCTAAGCATGTTTCCATACCTGTGAAATGCCTGG
CACGAAGTAAACAATCAGGTAACAGTGATTCTTCAGCCCTTGCCTCCCTTTCTTTGTCAG
CTTTCGGGAAACTTTTTTTTTTTTGGTTCTATATAAAGTGGGGAAACCCTGGTGGTATAG
TGGTTAAGAGCTACATCTGCTAACCAAAGCAGTGGCAGTTCAAATGCACAGGCACTCCTT
GGAAACTCTATGGGACAGTTCTGTCCTGCCCTATAGGATCGCTATGAGTCTGAATCAACT
TGACGGCAACGGGGTTTTTTTTTTTTTTGGTTTTTATATAGTGTGGATTTCCACTGTAGA
GATGTGCGTAATGACTTCCAAGAATACTATGGCCAGGTTTTATTGGCAAACAGTTGGTGG
TTTTTAGTTAGTGCTTCCGGTTCTGACCAGGTTTTTGAATCCTGAACCTGAAAGATCTTT
GCATTGCTAGTTACCAGCTCTTCACTAGTAAATTGGAAAACAAATACCTAAAATGCAGCT
TGTCACAGCAGCATCATTGCAGTAAGAAGAGGCAGTTTTGTATTGCTTGGTCTGTTTCCT
TTAAAACTCTGCGAAAGAGAGCCATATCTTAGTTGTGGCATATATACTAAAACTCTCTTT
TTTTTTTTTAACTCATAAAGTATATTTTAAGCACTCTTCACCACTCTGCTGCCAGGACTC
CAGGTGGTGTCATACTAAACATAAAATTAGTGTTTTGCCATTTTCAGTGGGTCTGTCATT
CTTGACTGCATGGTTTTCCATAGTGTAGTTGTATTGTGATTTAATTAGTAACCCATTGAT
GGACATTTAGTTTGTATCCAGTTGTTTGTTAGAGCTGTGCTTCAGTCAACATTGTTTTAT
ATGTATTTGTATACGTGTCTCTGAGGCACTAATTCTTAGATGTGGAAGTACTGCTAACTA
GGTCAAAGGATCAGATTTTGGTACATGTTTTCAGATGCCCTGGAGAAGCACTTAACTCCC
AACAGTGAACAAGGGTACTCAAATCCTCAAACTCTCAGAACTCTGGGATTATTAAGCTCT
ATAATCCTTTGCTGTGTCTTTCTGAAATGTTATGTTACTATGACAAACTAAATGAATGAA
ACTCTTTCGAAAGAAAGCTTTCTTTGTATACCCTATATTTTAGGTAAGTAGTATATTTGG
ATTGTAATCGTAACATTTTATGAGTATGTCTTTGTGCTTAGGCAACTCTTCTGCTTTCTA
ATGGAAAAGCTTAGTCCTTGGAATTATTTAGCTCTTATTTGACCTTTCTCTTTTCCCGTA
CCACTGTTTCTGTGGTAGACTGAAATACCAGCAGGAGTGTGTGCCTTTGGATTTGACTGC
ATTTGACACTGCTTTGTTTACCACACTTAGTAAGGAGGAAGAGTGTATCTTTTTTAATGT
GAGATTGGGGGTGTTCCTAGTCAGAAGTGTAAAAAATAAGATGAGTTAACAGTGCTTAAG
TTTGTTGGCTCTAATAGTTTCAGTGCTTCTCTTACTACAGAAACAAATCTAAGTTCTTCA
TTCTGAGTTTCAGGGCCTTAAAATCTAGTCCCAAAAGCTGTCCAGTAAAGACTTACCAGT
TTTCTACCTTAACTTCCACTAATTACTTAGGATAAAGTCTGAAAACTGTGATTAGTCAGA
ATTTGACCTAACAGTTTCATGCAGCTGCTATTTAAACATCTGCTGTGTGCCACACATTAT
TATGTTTTAGTTTGTTTTATTGGAGCCTATTATACATATGTACCTATAGAACAGTTCACA
GATTAAAAGTGTTCAAATCAGTGAATTTTCAGAAGTGAACATACATCTATCATAACCATG
TAGGTCAAGAAAGATATTATCAACGTCTCAGAAGCTCAAGCTCTCTTCCAGAAACTGAAC
ATAATCACTGATGATCTGTTGGTTACACTCCTTAGGTATATATCAAACAAATGCATACAT
ACGGTCACCAAAAAACACATAACAGCCCCAAACTGGAAACCGCCCAATTGTCCATAATAA
GGTACACTGTAAAGCAATGCGACTATTATATGGAGCAACATGGATGGATCTTATAAACAC
TGTTGAGTAAAAGAACCTAAGTGTTCCTTCAGTTTCGTCACTGTGTGTAACGTCAGTTCT
CTCGTTTCATAGCAATTGTTCAAACGTCTATGGAAACCCTGATGGTGTAGTGGTTAAGAG
CTACACCTGCTAACCAAAAGGTCAGCAGTTCGAATCCACCAGGTGCTTCTTGGAAACCCT
ATGGGGCAGTTCTACTCTGTCCTCTAGGGTCACTATGAGTTGTAATCACTTGACAGCAAT
GGGCTTGGTGTTTTGTTGTTGTTGTTGTTGTTGTTTTTGGTGCAAACATTTACAGTGTTA
CAGGCTTTACTTTTTATGGTGCTTTAAGTGAAAGTTTACAAATCAAGTCAGTCTCTCATA
CAAAAATTTATACACACCTTGCTGTATACTCCTAACTGCTCTCCCCCTAATGAGACAGTA
CCCTCCTTCCCTCCACTCTGTTTTTGTGTCCATTCGGCCAACTTCTGACCCCTCCACCCT
TCCATCACATAGTCTCGTGTCTACTTGATCCAAGAAGCTCACTCTTTGCCTGTATCATTT
TCTGTCCCATTGCCCAATCTAATCCCTGTCTGAAGAGTTGGCTTTGGGAATGGTTCCTGT
GTTGGGCTAACAGAAGGTCTGGGGACCATGACCTCCAGGGTCCTTCTAGTCTTGGTCAGA
CTGTTAAGTCTGGACTTTTTATGAGAATTTGGGCTCTGCATCCCACTGTTCTCCTGCTCT
CTCAGGTTCTCTGTTGTGTTCCCGGTCAGAGCAGTCATCAAGTTGTAGCCGGGCACCATC
TAGTTCCTCTGGTCTCATGTTGATGTAGTCTCTGGTTTATGCGGCCCTTTCTGTCTCGAG
TTCATAATTACCTTGTGTCTTTGTTCTTCATTCTCCTTTGTTCCAGGTGGGTTGAATGTT
ATCTTAATAGATTTTATTATGCCGGTTGACTTAGATGTCCCCTAAAACCATGGTCCTCAA
ACCCCCGCCCCGGCTACACTGGCCTTTGAAGCGTTCAGTTTATTCAGGAGACTTCTTTGC
TTTTGGTTTTAGTACAGTTGTGCTGACCTCTCCTGTTTTGTGCGTTGTCTTTCCCTTCAC
CTAAAATAGTTCTTACCTACTATCTAATTAGTGAAAACCCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTAAAATTTTCTAACGTAAAATATATACAT
GATTCAAAGATTAAAATCATATAAAAGGTATAATATGAATTTCTGTTCCTGTTTCTGTTC
CTTCTGCCTCCTTCTCTTTTACTCTGTTACAAACCAAACCAAACCCAACCCGTTGCCGTC
GAGTCAAGTCCAACTCATAGCAAACCCTATAGGATAGGGTAGAACTGCCCTATAGAGTTT
CCAAAGAGCGCCTGGTGGATTTGAACTGCCAGCCCTTGGTTAGCAGCCACGGGACTTAAC
CAGTACACCTCCAGAATTTCCTACTCTCTTATAGGTAACCATTTTTCATTAGTTTATTTT
TTCTGTGTATACTTGCAAAAAAAGCAGGTGTGTTTGTAGGTATATGTGCGGATGTACAAA
CAAAAAGCATATACACAAAAAGCCTAAAAGGTAGCCTACTATATATATTCACATATGCAC
ATACTGTCCAGGGTATTTATTCACCAGTCCCCTACTCATGGCCATTCTTTTGCAGTGACA
AATATTGCTGCAATGAATAGCATTTTCATACGTTACAGGTTTGGAAGTGTTTTCCAGTTA
GAATTCTAGAAAGATTCCTTTTTAAATGGAATCTTTTTTGAGTTATTATTCCATAGAACA
TTTTTTGTTGTGCTTTAGATGAAGGTTTACAGAGGACATTAGTTGCTCATTAATTAATTA
CACATATTGTTTTGTGACATTGGTTGCCAACTCTATGACATGTCAGCACTCTCCACTTCT
CTTGGGTTCCCTATTTCCATTCGTCCAGGTTTCCTGTCCCCTCCTGCCTTCTTGTCATTG
CCCCTGAGCTTATGTGCCCATTTAGTTCCGCATACATGGTTGAGCTGTGGGTATTTTTGT
TTGTTTTATGGACCTGTCTAATCTTTGGATGAAGGCTAAACCTCAGGAGTGACTTCATTA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTGTAGTGAGTGACTGTCTTCAGTCAGCAAAAACAAAACAAACCTAGTACTTC
CATAGAATCTTGGGCATTTCAAGACTTTTGAGATCATCGGTTAGGCCAGATTTTATATAT
TTTTCTTTTTATAAATCTTCTTGAGCTTAGAAAAATCGATGTGTGTTTATGTGTGTGCTT
TAAAGCTGTTTTAATGAGCTAGTGTTGAAGGCACAAGTCCTTAGATAATTGCTACCTCAT
CAGTATTAGATCCAAAGAAAAGCTTTAAAAAATTAATAAAGGATTCTGTTTCTGATTATA
GTAGTTGACCACCTCAATTTATGGAAAACCCTATTAGAAAGGAGCCAAAAACCAAGCTTT
TGGTGTTCTGTTTCGTGTAACCATCTTTCTGTTTCACGTAACCGTCTTTCACATAATAAA
GTCTTTAGTGTCCTCCATTATATGTCTTCTGTAGGCCACACCCCCATGTCAGTTTGTCAT
ACTGTGGGGGCTTGCGTGTTGCTGTGATGCTGGAAGCTATGCCACCGGTATGCAGATATC
AGCAGGGTCACCCATGGAGGACAGGTTTCAGCTGAGCTTCCAGACTAAGACAGACTAGGA
AGAAGGACCTGGCAGTCTACTTCTGAAAAGCATTAGCCAGTGAAAACCTTATGAATAGCT
GTGGAACATTGTCTGATACAGTGCTGAAAGATGAGCCCCCAGGTTGGAAGGCACTCAGAA
AACGACTGGGGAAGAGCTGCCTCCTCAAAGTAGAGTCGACCTTAATGACGTGGATGGAGT
CAAGCTTTCCGGACCTTGCTTGATGTGGCATGACTCAAAATGAAGAAGAAACAGCTGCAG
ACATCCATTAATAATCAGAACAAAGTATGAATCTAGGAAAATTGGAAATTGTCAAAAAAT
GAAATGGAACATACAAACGTAGATATCCTAGGCATTAGTGAGCTGAGGTATTGGTCCTTT
TGAATCTGACAATCATATAGGCTAATATGCCGGCAGTGACAATTTGAAGAGGAATGATGT
TGCATTCATAGTCAAAAAGAACATTTCAAGATCTGTCCTTAAGTACAGCCCTGTCAGTGA
TAGGATAATATCCGTACGCCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAATGTGTGTGTTTGTCCATA
TATACTTTATAGGGTTGTTGAGAAGATGGAGTGGCTGTGAAGCAGTTGTAAACTATAAAA
CATTATAGAAACAAATGTAAAGGGTAAAAGGGATGTTAGTAAATCTTTGCTGACTCCTAG
TTAAACACTTAGAACTTTTTTTTTTTTGCCATTGCCAGTCAAATGGAGTATGTGTTTTCC
TTTTTTTAGATTGGTATAATAGTGCTAGATAAGTTGTTTGTTAACTGTGACCTGGCCCCT
GACTATCATTGGCCTTTTTTTGTTCTTCAAACAAGTGCTTTCCTGTCTTGGAGCCTCTGC
AGTAGATTTTCCTTTATCCAGGACAGCTTTTCCTCCTTCCACCAGCTCTGTCTGTGGTTG
TGGACTCGCTGTATTTTGTCTCAGCTCACATGGGGAAGGCCTCTCTGAGCTCCATCCTCC
CCCCTGACCCCGCCCCCGTCATTACATCACATAGCCTGTGTTTTCTTCATTTAGTAGGTA
ATATTATCAGAAATTATTTTTGCCGATACTTTTCTTCTTCCACTTTATGAGAGTTAAATG
GACTCCACCAATCTCCTCTGCTGTATTTGCTGCACCTAAAGTAGTGTCTAGCATATATGG
AAATAAAAAAAAAAACAAAAAAACCCAGTGCCCTCGAGTCGATTCCGGCTCATGGCGACC
CTATAGGACAGAGTAGAACTGCCCCATAGAGTTTCCAAGGAGCACCTAGCAGATTCGAAC
TGCTGACCCTTTGGTTAGCAGCTGTAGCACTTAACCACTATGCCACCACGGTTTCCAGCG
TATATGGAGGTACTCAATAAATATTTGTTGAGCTAGATTTTGTTCTTGTGAGAGAGGCCT
GGTTAGTTGGAGAATATGTAATTCTATTTCTTACTAATCTGAGTTGGCCCCTTAAGATAG
TGGTCAGCATTCTAGGAGGATACTAGAAGGACAGACTAGTTTCTGCGTTTATAGAACTTA
ATCAAAGAAAGATAAAAACCTGCAAAAACAGTACATTATGAATAGGTTCATAGTAGTGTT
TGGAGATGCAGAGGTTTTTATTGATCGTCTGATTATATAGATTTTAACTTTCAGATGCCT
GTGGGACAATGTAAAGATTAATTTTACCTAACTCACACATTTTTCTGCATGGGAAAACAG
AAACTAAAATAAGTTAAATAACTTAAGCCAGCTGTCACAATAATTAGCATGANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGGTAGGATTGTTGATGAT
GAAACTGAGGAAGCTCAGTATATCTAGTCCAAAGTAGGTAGTTAAATATTATTTATAATG
TTTACTGTAGCACGTAACAAGTATTTATTCTGCACATACATTGCTAATACGCTCTTTTCT
AGACTAGATACGTAGACGTTAACACAACCAAACAAATTCCCTGTTCTCAAATAATAAACA
TACCAGGTGGTGGGTTGGGTGTTCGTAAGTGCTGTAGAGAAAAGTAAACAATGTGAGAGA
GAGGTGATGGTGGGATAGGTTATGTTGCTATTTTAGGGAGGGTAGTCACCAGTGGCTTCA
TGGATAAGGTGACTTTTCAGCAGGAAACTAAAGGACTTGAAAGAACAAACCATGCATAGT
TATCTGGAGCTTTCCAGTTAGGAGGAATAGCAAGTGCTAACGAATGTTGGTAATTTTGAG
CAACAGTGAGAAACGAGTTGATGGAGCTCAGAGGCGTCATCCAAAGCACCGAGTGCAGAG
GTAGCTGGTGGCCGGTTCATTTAGGGCCTTGTCTTTTAGGCCATTGTATAGGGTCACCGC
TGTGTTAGAGAAATCACAGGTTACATTTTTAGAGTAAAAATAATAACATAGAAAAAATGT
TCATATGAGTTTAGTTTGTTATACAATTGTTACCTTATAACTTTTTTTTTTTTTTTTTAA
ACTTTGTATTCCCAGTACATGTCATTTTTATGCTGGCCAGGTGTTTTTTGTGTAGAAGTT
GACTAAAATGAAAGGAGGCTTGGTTAGGCTTATATGGGGTAGTTACTGGTAGTTTTTCTT
CTTCTTCTATCTTTCTTACTAGTGGACTATTAGGGAGCATTCAAAAATATTAATCATAAA
ATATCGGTACCTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTGGCGATGGTAAAAGCAGTGGCAAAGATTTCCATCAGGTATTTGGGG
CTCGTAGAGTTTATATCCACTTAGCTGTAATTATTTAATGAATTGTATTTTGGGCATAGT
GGTTGTAGCGAGTGACACATACAGAGAGCATCCAGAAATAATCTTAGCTGGATGGCTAAA
AGGTGTTCTTGGACTTCTCCTTTTTTCTGTCCTTCCCTTCTCCTGCCCAGCTGCCCTTAC
AGCTACGTAGTTCAGGCTTAGAGAGCTGGGGATGTGACCTGCCTGAAGGAAGCAGGAATG
GGGATGTCCTGCTTGACAAGTAAGTAAGGCAGAGAGGGGATCTCATGTCCTGGGTTGAGT
CTTCTTTGGCTTGATTCTCAATCTGGTAATAGTTTCTTATGATACTGTTCTCATAGTCAT
CTTATTAGTGGGCATTATTTTGTGGAAGTTTTTGTTTAACATCGTTACTAATTGAACTTA
AAGTAGTTTAAATGGGTGTTTTAAAGAGCTGATTTGGATAACATAGAAACACACAGTTTT
ACATTACACGTTCATGTTCTGAGCACATCTGCTTTTTATTCGTGGGAGATGACTGTCAGC
GCTAATGAAAATTTCTTTTTTATTTTTGAAGACTCAGTTTCTGATTCAGGAGTGCGCGTC
GCTGATTACAAAGCCAAATTTTATCTCGACGCTGTCCTATGCCATTGATAATCCATTGCA
CTATCAGAAGGTTGGTATTTACTGCTTATATTCTCAGCAGTCCTAAGAATACGATCTCTT
ATAAGCTTTCTAAAGAGGCATCGACTTTGATCTCATAATGCATGCTTAATTTAAATTTCN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCTTTTAAACCTGTCGAAGA
CTAGTAAGTTCTTGTTTTAAAATCAAATTTGGTCTGTTTCAGAGTTTAAAGCCTGCACCC
CACTTATTTGCCCAGCTGAGTAAAGTTCTCAAGTTAAGCAAAGTACAAGAGGTAAGTGAT
TTAGAAAAAAGAGGTAGGCCAAATTAGGATTAAAAACAGCCATTTAAATTCTTAGTTACT
CTAACCCTTCTTGTTTCAGGTAATTTTTGGCCTTGCCCTCTTGAATTCTTCCAGCTCAGA
TCTCAGAGGTTTCGGTATGTTCTTTTTCTTAAAAATTCTATAGTGAAGTGAGACTCTTTA
AAATCAGCTTGGGGAATCTTGAGGCTTCATAGTTTAGAAATTAAGATGGTTTTTTTTTTT
TTAAAGATTGACTTCCATTGGTCTCTTTAAAGGTTAACTTTTGAAAAACCAACTAGAGAT
ACAAAGCATTAGAAGGGGGTAGAAGGTGATTTGGTAAATGAGAAGGATGAATAGATTTAT
TTATAGAATACACCTACTCCTCACTAATCGGCTGTCTTGTTATCTGACGTTTCACATTTA
CGACAGTAGTAAAAAATTTATTATCTGACTGTTCTATGGATTAACGATGGAAGTCTGGCC
GTAAGGAATGCTGAGGTGCGAGGCGAAAGTAACACAAACTGATAATTAAGGTTATGTGTC
AACTTGGCTAGGCCATGATTGTCAGTGGTTTGGTAGTTATGTAATGATGTGTAGTCATCT
TCCATTTTATGATCTGATGTGGTCGTCCTCCGTATTCATATAACACTGATTTTTGCATAA
TGACCTGGTCCTTTGGAACCTAATCATGTTGATAAGTGAGGAGTGGGTGTATATAGATAC
ATTTTGATAGTATATGAGTTTTTACCCATTGTGGTGTGGAAATGATTTTTGGTTTACCTG
ATTTTTAGCCGCCCAGTTTATCAAACAGAAGCTTCCAGATCTTCTGCGTTCTTATATTGA
CGCAGACGTCAGTGGAAATCAAGAAGGTGGCTTCCAAGATATAGCAATAGAGGTCCTACA
CCTCCTCCTCTCCCATCTCCTCTTTGGGCAGAAGGGAGCCTTTGGAGTTGGACAGGAGCA
GATAGACGCTTTTCTTAAGACACTGCGCAGAGGTAAGGGAGTGATCATGGCCTACAAAAA
ATGATTTCTTTGAATAATTAAAAACACGACAAATGCATTTTAGAATATAAGTAAAGGTAG
GGATTTACCCCTGTTTTTATGTTGGTGTAGTCTTTTTGAAGAGAGCATTTTGTAATTTAA
AATAACGAACCATAAAGCCTCATTATAGAAAACGTACAAATGGATATAGCTTAACCGACA
ATCTTGTTATATAACTATCATAGTTAAGACTATATATAAAGATATAGTCTTTTGTTTGTT
TTCTTCACCCTTAGGAAGACTACATTATAATAACACGCTGTTTTTTAGTTTTTAAAAATT
TTAATCATTTTCCGGTATTGGTCAGTTTTGATACACCCGCTTTGCCCCCTTTACTGTTGG
CTATTGTTACGCTAAATAACTACAGGTTCTAATGTTACCATTCTTTATTTCTATGATCTT
TCTTTTAGAGAGGTAAGTACTTTTAAACCTTTGGTAGTGGACTGACATTCTGTAATTTTT
TTCTTTCCTAATGCTTACATAGTTTAAGCTGCATTAACTTTTTCAGTGATAGGAAATTTT
CTACTTATCATTGAAATAAATAGCTTCTCATANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAAATTAAAGTATGCT
ATACGAAATTTTTGTGATATAAAATATTTGAATCGGTACTAACGATTCGAAAAAAACTAA
CTGTGCTTCGATATGAACTGTGAAGAGTCAGGTTTGAGCGGCTTTTAGTGAGCAAAAAAG
AGGATCGTTTGCATTTAATCACCATAGCAGTTATAATTCCTTCTTTTTTCCTCAGATTTT
CCCCAGGAACGCTGTCCCGTGGTGCTTGCACCACTTTTATACTCTGAAAAACGGGACATT
CTAATGGACAGGATCCTGCCTGATTCTGGAGGGGTAGCTAAAACCATGATGGAGAGCTCT
CTGGCTGACTTCATGCAAGAAGTAGGCTATGGCTTTTGTGCAAGGTTGGTAGTCAGACAC
ATTAAATTTTGATTACTCTTGTGCCAAGTACAATTTCATTCTTTAAAATAAGTTCCTCAG
ATTTCTTAATGTTGTCTTTGCCTTTCAGAATTTTTTACTTCTAAAACATGTTTCACATCC
TAGTTTCACTGGCTAAATTCCTACCCCCCCCACCCCCCATTTTCAAATGTAGAGATCAAG
AAACTACCAGGTTTTAACCTAATTGCCAGTATCTTTTTGGGGAAAGGGGGGTGTTGACAC
TAATGTTTATGGAACTTGTATCACTTTCCACTTAATGTGTCTAGTTTTCTCTTCTTCCTG
CAGTTTGCTCACTATGCCTTTATCTCCTACCATGTTTTTCTATTCATTTTATCCTCTGCC
TGTTGCATCTTTTTTTTTTTTTTAATTAGTGTGCTTTATTTGAAAGTTTATAGTTCGTTA
GTTTCAGATAAAAAAATTTATACACACATTGTTCATGTGACAGCACCACTCTTCCTTCCA
CCCCGGATTTCCCATGCCCGTTTTAACCAGCTCCTGTCCCTTTTTGCCATCTCTTCTCGA
CTCTGGACAGGAATGCCCATTTAGTCATATGTATCTGCTGAAGCTAAGAGGCACTCTCTT
CATTTTATGTCGTATAGTCCAGTCTATTCTTTTTCTGAGGAGTTGGCTTCAGGAATGGTT
TCAGTTCTGGGCTAACAGAGAGTCCAGGGGCTGTGTCTTCCAGGATCCCTCCAGTCTCCG
CCAGACCGTTAAGTCTGATCTTCTTACTACAATTTGAGTTCTGCACCCTATTTTTCTCCT
GCTCTGTCAGGGACTCTCTGTTGTGTTCCCTGTCATGTTGGTCATTGGTGGTAGCCAGGT
ACCATCTGGTTCTTCCGGTCTCAGGCTGATGGAGTCTCTGGTTTATGTGGCCCTTTCTGT
CTCTTAGGCTCGTATTTTCCTTGTGTCTCTGGTTTTCTTCTTTCTCCTTTGCTCCAGGTG
GGTTGGGATCAATTGATGGATCCTAGATGTCTGTTTGCTAGCTTTTAAAACACCTGATAC
CACTCACCAGAATGGGGCTGCTAGAACTTTTTTAAAATAAATTTTGTTATGCCACTTGAC
CTAGAAGTTCCCTGAAACCAGGGTCCCCGGACCCCCCACCCCTGCTACTCTGTCCCTCGA
AGTATTTGGTTGTATTCAGGATGCGTATTCTTTTTACCTGTCGGAGCACCAGAGAAAATT
GTTTCACCCTACTGGTAGCACTTCCGACTATGATATAGTGGGTTGTTAATATTTTTCTGA
GAAGAAGTTACGAGAGACATTCATGTGCTTTGCATTGACTTTAAGCGTAACTTTCAGTGT
TTTAAAAACCCTCATATCAACCCCATTCCCACTTATGTTTTAAATAGTTTATTTTTGTGT
GTGTGCCTGACATAAAGCTTGTTTTAGTAAACTCGAAGATGTAAAATGAAAAGGTTTGGA
TGTATTTTCAAGACTCTGTACGTATTAGAATGACCAAAGCATCTATTTTATTGAGTAAAT
TCTTACTGAAGATTGATGAAAATAACATGTGCTTTGTAAGAGAAATCATTACACTTTGGG
CACATATTTCTTCCATTGATCTTTTAAGGTTTTTCTTATTTATGTGATTTATACATTCTT
AGCTATATAAAAGTAACAAGAAATGATGCTTATCAGTCTGCCTCTGTTAGTAAAACTCTA
GGGATCTCACACAAGGGCTCGTTTTCTACCAGCATTTCTTAATCTTAGTAGCATTTTTCT
AAAGTTATATTTTTGTTCCAGTATTGAAGAATGTCGCAATATAATCATGCAGTTTGGTGT
TCGGGAGGTCACAGCTGCCCAAGTTGCAAGGGTTTTGGGAATGATGGCTCGAACTCATTC
AGGATTAACAGATGGTATTCCGTTACAAGTAAGTATGTAGAATTCAGCTGTTAAGTGAAT
TAATGTCCTGTGCTCTTTATTTATTAGAGTAGGCTTGATTGTTTTAACAAGAGCGAAACA
CAGTAAGGGTTTGGGTTTCTTTAATTCAAGTTGTATTTCTACAGAGTATCTCTGCTCCTG
GCAGTGGGATCTGGAGTGATGGGAAAGATAAAAGCGATGGAGCACAGGCACACACATGGA
ATGTAGAAGTCTTGATTGACGTTCTCAAAGAACTGGTGAGTACATGTGATCACGGTTTTT
GAGTCATGATTTTAGTATGAATCAGCTAAAGAAATCGAATTCTAATGAATAAAATTCCAG
CTAAGCGAAAGTAATGTTTTGTAATTCCATAACTTTATTGGCTCAAAAAGTAATAAAGTA
TCTGAGATAATTATGTTCTAGAAATAGTACATAATCAACTTCAGATTCTGTTAGTGGTGG
TTGGCATGCAATTCTGAAGCAGTGCAGTGCTGAAGTAAGTTGGTGGGTTGGGGGTTTGTA
TGTTTTTTGGGGGAAACTAATATGTTGTAATAATTCTCCCGTGGTGCTTGCACAGAATTA
TTGAGGAAAGGGCAGGCCTTCAGAATGTTTTCTGATAACCAAAAAAAAAAAAAAAACAAC
AAACCAAACCAAACCCAACCCAGTGCTGTTGAGTCGATTCCGACTCATAGCAACCCTATA
GGACCCTGATAGATGTAATAAAAATACTGCCAAGTCTTGTTTATGGTGGATAGGGATAAT
GAAAGTCCATATTTACTACTACTTCTGGATTATTCCCAAACTAAATAATTGCTGCCACTC
CCCCATGCCCCAAAACAACAAAGAACTTCTCCTAAGATGCTGAAATACCTAAATAATACA
AGAGAATGAAAACTTCTCAGATATGAAAAGGGAATGATGAAATTTAATCAGTGCGAGAAT
AGTGGCGTCAAGATGCAATATTTTCAACCTTCATAAAATGTCAAGAAACAAAATATAATG
TTAAAGAACGTATATACACATGCATAAAGTTCTTTTTATCGCATGTCCAGGTCATGTATC
CTATTTCTCACTTCAGTTTTCCATGTTTGCAGCTTATAGGTAAATTCCCGTTAGAGGAAA
TCATGCCGTTCTATGTGGGCCCTTACTGCTACCAATGTCAGTGGGTTTTCTTTTTGTTAT
TTTTCTTAGCAGATGGACCTGTTATGTCCATGGTAGTAGAAGATGGACAAAGTTGAACAC
TGCAGTGTTCGAGCTAATCTCCTTTAGTAATACATGATCATTGCTGAAAACTTGGAAAAG
TGGATAGAAAGAAAACCAAAGTAAAATGACAGTTTCATTACTTACGGATAACGAGTTAAT
GTGTGGTGCTTATCTTGTTAAAAGTAAAAACATGCCCTCTTAGCTAAGTTACTTCCATTT
TTATACTTGTGCCCCATTAAAAATACCGTTCTGAAAAAAGTTACAGACGAGTTCAGAATT
CCATGTTACCTGGATCGGTTTTGTTCCTGATTTCAGAGAGTGAGAATTGGCTGTAAATTG
AGTACTACATTGTGGGTTTGAATAGACGAATCATTTACCTGTTTTTCCTGTTCTTCGTTT
TTATTTCCATGTATTAGTGTTTTCTTTACTTTTTTTTTTTTTAAGCAAAGACCAGAGGAC
AATTTCACAAACACATCGGGCATCTAGTTTGGTTTTTTGATTGCCCACAAAGCACGGGAG
GAGGAAACCACAGGGGCATGCCCGTGGATATACCAAGCTCATCTTTCTCTAAGATAGTGC
TGTTAAAACACTAAAGTAATGGTAGTGTTAAAGCCACTCCTGGAAACAAATTTTAAAAGG
AAAAGATGTTTTTTCTGAATAGAAAACATTTTAAATGAAGAATGCAGAGACAATAAAAAT
CTTTTGTAGTAACTATTCAGAGCTGATCATACCTGATCCACATCTCTCCTGCCATCCCAC
CTTGAATATTGAGCACATATTCTGAATTCTTATTACTTAAAAGTGTACTCCTTTGTACTC
CGAGTGTTGGCAGTATTGGCATCACATAGAAGCTTGTTAGAAACAGAAACNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTCCTGATAACATGTCCAAAG
TACATGAGATGAAGTCTGCATCCTGCTCTGAGAGCATCTGCTGTACTCAAGACAGATCGT
TCGTTCTTCTGGCAGTCCATGGTATATTCAGTATTCTTCATCAATACCATAATTCAAAGG
TGCTAATTCTTCTTTGGTCTTCTTATTCGTCATCCAGCTTTCACATGCGTATAAGGCGGT
TGAAAATACCATGGCTTGGGTCAGGCACGGAGCCCTGGTGGCACAGTGATTAAGAACTCA
GCTGCTAACCAAAAGGTTAGCAATTCGAATCCACCAGGCACTCCTTGGAAACCCTGTGGG
GCAGTTCTGCTCTGTCCTTTAGGGTCATTATGAGTCAGAAGCTATTCGACAACAATGGGT
TTTGGCACACTTTACTCCTCAAAACGACATTTTTGCTTTTTAATACTTTAAGGAGATCTT
TTGCAGCAGATTTGCCCAACGCAATACATGTGTTCGATTTCTTGAGTAGATTCACTAATT
CATTGGGAATTGCAAACTTGTGATATTCTAATTGTTATTCATTCTTGCTTTATTAGGTAG
AATAGTTCTGTTAAGAGAAACTTGCCCTTATCAGCTATTTGGTTACCTGAGGGTATAGTT
TCTATAGGAAATGTAAGATAAATGTTTGATTCTCTTTTAATGGCCAGTTTTCAAAATAAT
GAAGTGGTTCCACATAGCCTACTCCAAAGGTTAAAAACCCGTTGCCATCGAGTCAGTCCG
ACTCATAGCAACCCTATAGGACAGTAGAACTGACAGCCAATGAGTTTTTTTAGTATTCTC
ATGAACTGTATTTTAAACATATTTGATGTGTTTCAATCCATTGAACTTATTATTTTTATT
GATGTTCACCCTGTTACATTTTATCCAGTGGAAGCTTATTCAGGTTGGCTCTAGAGCCCT
TTTTGTAGTCTTTGATGCCATCCCAGATAGCATGCAAACTAAGATGTTCAGTCTGCTCTT
GTACATGTCTTGCTCCAGACTTGGAATTAAGCAATTTCTCTGAAAAACTTTGGCTTTTCT
TTTAGTGGGAAATGGTATTTAGAGATCACCATCTCTTGTATTGCATATTGCTACTGGGTT
GGCCATTATTAGGACTTTTCAGTGGACAGAAATAAAGATAAAATAACACTCTGCGTTCAG
ATTGATACTTCCAATTTAATTTCAGGGCTCCAGGGTTTTTAGTTAAATTCATGATCTAAA
ATCTGTCTCTCCTTTCTTCGTATGTATAAAATTTTAGTTTTCAGTGATACACACCATACA
CAGAGAAGAGTCTTAGAATACCTATCCTGACACTGCTAACAACAATGTGATAATTAAAAG
TAGTTTATCCTTTTCCCTTTTTGGGAGTTCCTTAGAGTATGCCCTTTTTTTACTTAATTT
TTTCCGTTTGCTTTAGCTACTTTTTGTTTAAGAGTAATTTTCAGAGTCTCTTCTGGCATC
CATTTGGTCTTTTCTTTCTTTCCTGTCTTTTAAATGACCTTATACTTTCTTCATGTGTAA
TGTCCTTGGTTGAGTAAAAGGGCTGAACAGAAGATTTAAAAGGATGGCTCAAGAAGACAA
AGTTAAGTATTATAATAAATGTGCAAAAATCTGGAGTTAGAAAATCAGAAGGGAAGAACA
CGCTTGGCGTTTCTCAAGCTGAAAGAACTAAAGAAAAAAATTGAAACCTCGAGTTGCAAT
ATTGAAGGATTCCGTGGGCAAAGTACTCAACAATGCAGGAAGCATCAAAAGAAGATGGAA
GGAATACAAAGTCACTGTACCAAAAAGAATTGGTTGATGTTCAGCTATTTTAGGAGATCA
AGAACCGATGGTACTAAAGGAAGAAGTCCAAGCTGCACTGAAGGCCTTGACGAAAAGCAA
GGCTTCAGGAACATAACCCTGCTCATTCGTTTATGTATTTATGGCTGCTTTTGTGCTACA
GTGACAGCTAAGTGGTCCCAAGAGATATAGCATGGCCCACAAAGCCTAAAATATTTACTC
TCTGGCCGTTTGCAGAAAATGTTTGCAGATCCTAGAGCATAGCAGAGATTTTACTGAAGG
TTGATAATAAGGAAGAGGAGTAAAACTTGCAAGGAAGTTTACAGCTTTTGTCCAACCCCA
GAAGGGCTTTCTGCCTCTTTCTGGAACTGTGTCAGCGGGGCCAGGAGTAGCCAAACACCC
CATGAGCTTACCTGGGTTCTTAGGCTGAAGGAAAGGAATATAATTCGCTTTAATTGGGCT
CTCTTGAGCTTTTGTTTGTTTATTTATTGTGGTGAAATTATACACAATAAAACATTCATC
AGCAGTTTCTGTGTGTACAATTCGGTGACATTGATTGCACCCTTTATGTTGTATAACCTC
ATATATCCCTATCTAATTGTTCCACCACCATTAACATAAACTCAGTGTCATCACAAGCAA
GAACTCCGCTCTTCCTCCTCCCCACCTGTAGTAACCACTAATAATCTTTGATTTCTATAT
ATTTGCTTATTTCATATAAGTGAATTCTTAAAGTATTTTTCCCTTTATGATTGACTTATT
TGACTAAGCATATTGTTTTCAAGGCTCATCCATGTTGTAGGATGTGTCAAGATTTCATTT
TTTTTTTTAATGGCTGAGTAATATTCCATTGTATTATATACCACATTTTGTTTATCCATT
CATCTGTTGATGGACATTTTGGTTGTTTCCACCTTTCAGCTATGTGAGAGTGCTGCAGTG
ACCATTGGTGTATGGGTTTCTAGTTCTTGATTTCACTTCTTCTGGGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGAATTTAAATTAGTTAAATGTAAGCATTTGTTACATTCCTGACGGACTAAC
AAACTGATCTATACTCTTGTTATTTCATCTCCAATTGGAATTTCATATATAATAATGGTT
TTATCTCTACTGGGAAAGGCCCGTTTCTCAAATATTATTTCAGGTTTAACTTTGTTTAAA
GCTCAGGTGTGCACCATTGAACTCCCTTAACAGTATGCTTCCTGTTTTCAGAAGCCTTCA
AATCCATTTGAAGGTTACATCGAGGAAGGGGCACTCGGTCGATGTCATTGTGGCAACCAC
TGGTGCTCTTTGACAAGGTCCTGAGAGTTGAATGCATTCAGGGAAAAGGTGGCTTTAAAA
CGCTCTTTGTGATCCATTAGGCTCGGATCCTTAGCATGGCTCAGAAGTACAGTGGAACAT
TAGTAGGAGTCTGTGCTATCAGCAGCCCACAATGAGCCCATTCTTGACACCACAGACTCT
TAACATCTCAGTTTTGAGAAGCGCAGTGATGATTGACACATTTCAGAGAACAGACAGAAC
AAGCTGCTATCTATGAAGACATTAGCAGATGTACTTTTAAAGTGTTTTAAACATTTCCAT
ATGTCCTCGGTTATGTTAGAAAAAACCACCGTCTGCATTAATGTGCTGCGTAAGAATGTT
AGGAGATTCAAATGGATTCGTTCATTACATAGTGGGTGTATCTTCACAAAGCTCTGCCCA
AATATCTTCATCCATATTTACATACATAAGTATCATTATCAACAAGGCCCATTATTTATA
GCACACCACATTGTACCAACAACACGTCTAGGAATTAGGTAAATGGATCCTGACACTATT
TTTCAGCCATTTCTCTTTAATGGTTATTTTCAGTTTCTCTCTTGTTGAACAGTTTCCATG
GTGTACTCTAGATGGGGTTATCATTCTATATCAGCATACATGTGAAGAGGAAAATGTAAG
AGAATTTAACTGACATTTGTTTCTCATTCAGACTTTCCCATGTAGAATAAAATGCGGTGC
ACAAATATTGAACAGTATATGTAAATGTCACACAGCTAATTTGGTGGGAAATGCTGAGGA
TGGGGTGGAAACTCATTGTAACTGCTTAACTAAAAGTTTTAACCACTCAGCCTGATTGTT
GGTGACTGTTGTCAAAATGAAGTCGCCCCCAAAGTAAACTGTTTGTTTCTTGTTTGTCAT
TGTCAAGACGAAAATCAATAAATGATATATAAAGACTTCCCTTATCTGAAATTTTTCTCC
ATTTAGTGGGAACAAATGTTATCAATGACAGAGTATGTTTGCATTTTATGAGCATTACTA
CCATACCTTCTTCCAAATCTCTGTTTAGTTGTTTCCAGTTCCATGAGTCATTATTGAATC
CAAGCTCTTTAGGTTCTGGCCTGGATAATGACCATTTTCTCTTTATTTGTATTTGAACTA
TGAAGTAAAACATCATCTCTGAGTATAGAACAGATTAGCTCCACAAAGCAGATGCTAATG
ACTCCAGTCTTTTTGTTTCAACATGGATGAGATACAAGGCATGAAGGTTGGGTGTGAGGG
TGTTAAGGTGACATAGGCATTTCAAATTAAACAGGGTCAAAATTAGATTGCCTCTTGGGC
TGCCTGACACACTCTAATCTGAGTTGCTTCTTCCCCAGGGTTGCCCTTCTTTGGGAAATG
GCATATATCCATCTCCCCTCTCAAATCTCAGACTGTTAAATCAGTTCTCTTTGGCATCTC
TGTTTTCTTTACTCCTTACCTATGTCTAATGGCAGTCTTGTCATTTTGAAATCCAAGTTA
TTTCTCCATCTCACCGCTACTACCCTAGTTCAAGACACTCCCATTTCATGCCCCATCTAC
TTCAGCGGTTTGTTCTCCCCAGTGGTACTGTTTCTCCCTTCCGTATAATTTTCCACATAG
CAGCCAGAGACATTATTTTAAAAAATTGTGCTTTAGGTGAAAGGTTACAGAGCAAATTAG
TTTCTCATTCAACAGTCAGTACACAATTTTTTTGTGTGTGTGTGACAATGGTTGCAAATC
CCGCGATGTGTTAATATGCTCTCCGTTTCTACCCCAGAGTCCTCTTTCTGTTTGTCCAGT
TTTCCTGTGCTTGCCTGCCTTCTCATCTTTGCTTTTGGGTAGGTGTGTATATATGGATCC
CTGGTGGTGCGGCAATTAAGAGCTTGGCTGCTAACCAAAAGGTGAGCAGTTCTGCTTTTT
CCTATAAGCAGTGAGTCAGAATCGACTTGATGGCAACAGGTTTTTTTTTTTTTTTGGCCC
ATATAGTCTCGTATACGTGATTGAACCATAGAGCACGTTCCTCACATGTGTTACTGTTTG
TTTTATAACTCTGTCTAATCTTTCGCTGAAGGGTAAAATTCAGTTCTCAATTAAAAGGGT
ATAAGAGACAGACCATTTTAATAGGCAGTTTTGATCATGTCACCACACTGCTCAGTGACT
TCTTCATGCCATTAAAACAAAATCCAAAATCTTTAATGTGATGCAGTCGGGCCTACATGG
TCTGGCCTCTACCTGTTTTACGGGCTCATTTCCTGTCTTTGTGGCCTCACTAACTANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CAGATACTGCTTTTTAGGATACCTTTTCATACATATTTTGAATTGAATAGTCAGTCATTT
TGTCGTAAAGAATAATCTAGACCGCTTTTTCTGATGCATGCATTGAGATACTTTTAAGGG
AGATCTTCAGTTAATCAAGAATGATGGTTGGGATAATTGGTTTATCTTTTGCCATTTTGT
TCCAAGATAATAGAGTCTTGATGTAAAGAGAAGAGTTGCTGAATGAAGAGTTACTTATTT
GCCATATTGGGGTGGGAACTATAGTTGGGTTACGTAGGGGAAGAAAGGGTTCCCCTTTTA
CATACTCAGAAGTTTGGAAATATGCCACAAATTAAATTGTTTGAGTACCTTGCTCGTAGA
GCCAGTTTGTTCTGAGTATTAAGAATTTATCTTTCTAAATCTCTTTCAAAATGCCAGAAA
GATTAGATGACTTTGAGTTTTGTGATGAGAACAACTTGATTGAATTGCACGTTTAGGTTG
GTCATCAAAACATGAACCATTTGTTCATTTAAACTTAGAAATGCTTTTTTCTTCTATAGA
ACCCGAGTTTGAATTTCAAGGAAGTAACTTATGAACTGGACCATCCTGGATTTCAAATTC
GTGACAGTAAAGGACTTCATAATGTGGTTTATGGCATTCAAAGAGGCCTGGGAATGGAAG
TGTTCCCAGTAGACCTCATATATAGACCTTGGAAACACGCGGAAGGCCAGGTAGGTGAAT
GGTGTTCAGCTGTAGAAGGGGAACAAAGTAACGGCTCATTCCTTATGTATGGTGCCACCC
ACCCGTTGATTGAGATATTTCTTTTAAAGTAGAGTTTGTTCTGCATGGCTCAGAAAANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTTCATGA
CAAAACATCTACAGTTTCACAAACCATTGAGATTGACATTATTTTGTTTTATCCAAATCA
AGCATTTTGATTTCTTTTTAGTTTGTATAGAAATGCCTGTCAGGCCCTTGTGCTTTCCCC
TCCTAATTTTTTAAAATGCTTTCGATCAATAAGTATCCTTTAGTCAGTTGATTTTTCTTA
GTAGCCTACGTTTTTAGTTATGACAAGTGTAGAAGCTTTAAGAAAAAAGCAGTCATCTTC
TCCTTAACTTCAAGTACCTTTTGTGGCTACTTTTTTTTTCTTATATTAGTTTACATATAA
AAAAAAAATAAGTACCTTAAAAAAAATTAGTTAAGGCTATTATTGGTAAATAAAAAAATG
TTAACCTTGGTTCCACGTCATTCAGCCAGGTCCTCCTCCTTTCCTAGAGACTTAAGTAAT
GTGGTAGCATTTTGTTGCCCAGATAATCTTATGTCTTCCTCACCCAGGCTGAGAGGTTGG
GAGCCTTGTCCACTCAATCCTGGTTGAGTATGTCTTTCACGTAGCTCTTCTGCCACTCTA
GGACAGTTATTGAAATGTGACTTGGAAACACTGATGGTAACTGCTTTGCTGTCAATTCTG
AGAAATAATTTACTTAGCTCTATTTGTCAAGTACTATTTGAAGGCCTGGAGATTTAGGAG
TCAACAAAACAGAATTCCTAGTCTAGCTCATCATTTTCTACCAAATAGGATTTGTTCACA
GCTCTAAAATTTTGTTTTTCCATTTGTTACACTAGCGTTTAGATCTTTCAACTGAAAGTC
TTTGGGTCAGTTCTCAAAAAAAGACTGTGTAAGTAACAAAACCTAGCAACATGCTCGTTG
TCTTCTGGTGAAAAATATTGAATAATTATAAAACGTGAATATTTCTGTTTTTGGAAATAG
CTAGATTTAAAATGAGTATACAAATACTGTTCCCAGAAGTATTGATAAACACTAAACTGT
GTGAAATGAAAGGTGTTTACCTTAAAGTATTTTGTTTTTATTTATAGAGCAGAAATTTAG
AATTTAATTTTAACGAAGTAATATAAACTTTATAACCTCGTGGTTATATTCTGTTTTATT
TCATGTTAGAAAAGGTATGGGCAGACTTTTATAGGACAAATAAATTTGTTGAATGGCTGT
ATGTCCCAGGTTGAGAGACATAACTTCAATTTGGAAGACCTGGAAGTAACTTGGCTTTTC
CATAAAAAATGTCACTGCATGTGTACCCTGTAATGTCATAGTCTTTGTGGCCTGTACTTA
ATACTTGCACTGATATGCTTGATTTTTATATAAACAAGTAAAATTAGCTGGGAAGGTGCA
GTAGTGCTTATCAAAATGTTTCGGAATATTGCTCTTTAAACCTACTCACCCTCTTTCCCT
TAGGGGCAGTCTCCCTCAATTCGCCAACTTATCATGCATGCAATGGCAGAATGGTACATG
CGAGGGGAGCAGTATGACCAGGCCAAATTGTCTCGAATACTTGATGTGGCCCAGGACTTG
AAGGTGATTTGGAGGGATAGGTTGACTTTGTTTTATTTATTAATGGTAAACGCAAAATAC
CTTTTTCTTCAAAAAATAAATAAATAAATAATAATAGTTTTTTTTTTTTTTAAAGTAACG
TAAGATGCCTTAGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCAGGGTAGAGTTTTTTTGGAAGGTAGTTTCATGAGTTCACCTTTA
AAGTATGATCTTATTATGAGCAAGTACTAACATTACCTACCACTGAATTGTGCTAAAGCA
TTTAAAAATCTGTGACCAAAAAAAAAAAAAAATTAGTGGAATGTTTTATTTAGATTTGTT
TGTGAAAGTAAAAACTGGAAATAGAAAGTAGGATTGAGACACAGAAAGGGTTACTTAATT
GCTTGACTTGTACTTTCTAATACTCTTTTTCTTTAGGCCTTGTCAATGCTGCTAAATGGT
ACTCCATTTGCCTTTGTTATTGACCTTGCTGCGCTTGCTTCACGTCGTGAATACCTCAAA
CTTGACAAGTGGCTCACAGATAAAATTAGAGAGCATGGGGTAAAGCGGAATTTGTTTATT
CATGTCTGCCTTTTAATCTTGATAGTTACAGTGGATAAAGAAACAACTTGTAAATAGTAC
TGAAGATGCTGTTTATTCTGAATTTTAGTTATACTGCCTAGTAGTTATCTTTAATCTGAA
AATAATTCAGATGAATTTCAAATACATTGAGAGATTTTTTTCTTTTTCAGGAGCCCTTTA
TCCAGGCATGTATGACCTTTTTAAAGAGAAGGTGCCCTTCTATTTTGGGTGGACTTGCCC
CAGAGAAAGATCAGCCCAAAAGTGCTCAACTTCCTCCAGAAACTCTGGCGACAATGTTGG
CCTGTCTACAAGCTTGTGCAGGGTAGGAAGATCATGCCTGAAAATGACCTTTAATACTAG
AATTGGATTGTATGAATAGTTGATTTGGGGGAAAGTAGGTCAAATGAATAAAAGTAAAAG
CAGCTTAAGATAATTCAGTGGTTTTTAAGACGAAAGTTGTATACTACTTAAAATATATAT
TAGATCCATTTTGAGTTAATTATTGTGTATGATGTGAAGTAGCAGTCCAAACTCATTCTT
TTATATGTGGACATCTAGTTGTCCTAGCACCATTTGTTGGCAAGATTATTCTTTCCACTT
TGAATTGTCTTCTCAAAAAAAAAAAATTATCCATGAATATACGGGTTTGTATCTGGACTC
TGAATTCTATTTCATTGATCTCTGTCTTTCCTTTTGCTAGTGTCACTTTTTTTTTAATTG
AAACAATATTTGTTGTGAAGTGTATCATACATAGAGAAAAGTATATAAAATGTATATGTA
AAGTTTTAAGTTAAATAGTAAGGTGAATAGCTGCACTCCCGTCACTCAGATTAGGAAGGA
GAATGTTAGCAGAACTATACTACTTTCTTTTTGTCTTCCCTAGCCACAACCCACTCTATG
TCCGCCCCCCATTTCCCCCAGATAACCACTATCATCAGTTTTATATTAGCTTTTACTTTT
CTTTGTAGTTTATTCTTTATGTCGGTACTCTTAAAAGTGCACTGTGTCATTTTGAAAACC
TGAGTAACAAGAAAACCCAGCTGTGCAAGGGAAGGGCAATATGGCCACTGTCAGATGAAG
GCCCAGAAGATAAACCGAAAAGTTTCTGGGGCATAGCCTTGGCCTCACGTTCCCGGAGTT
TCCAGAGCGCCTCCAACATTCAACAAGACTACAGAGTTTGCTAGGTACTAGATGTTTGAA
AGGAATGTGATGAGATGAAGCATGATGAACTGAGTGTCCTCAGCTGATACAGGCAGCAGG
ACATGGAGTGGAAGGCAGAACTTTTTCTCCAAAAGCCAAGTACAGATGAGAAGCAGGGCC
AGGCTCAGGAGGGCATTGTATCTTCTGGTTTTAAAGACGGTGACTACTGTAGCTTTGGAG
TAAAATTTGGAATTGGGAAGTATGAGTGCTCTAGGTTTGTTCTTCTTTGGATTGTTTTGT
CTGTTCTGGGTCCCTTGCATTTCCATATGAATTCTAGGTTCAGCTTGTCAATTTCTGCAA
AGAAGCCAGCTGGGATTTTGATAGGAATTATATTAAATCTGTAGATTATTTGGGGGAGTA
TTGCTATTTTAACTAATAGTATTAAGTTTTCCAGTCTGTGAACCTGGAATGTGTCTTTCT
GTTTACTTAGGTTGTATTTAATTTCTTTCAATGACACTTTTGTCATTTTCTGTTTACACA
TCTTGTGCTGCTTTCGTTCCATGGTTTATTCAACCAGTCTCCTATTGGTTGTTTTTTTCT
TTTTGTATCATAAATAGTTAAATGAATAGTGTTTTTTTTCTTCTTAGATTTTCTCTGTTG
TTGAGAATATACACAGCAAAACATACACTACTTGAACTCTACATGTACCCTTTAGTGACA
TCGATTACATGTTAAGTTGTGCAACAATTCTCACCCTCCTTTTCTAAGTCCCTCCCCCAT
TAACATAATAAACTCACTGCCCCCTAAGGTTCCCATCTAATCTTTGAAGTTGCTGTTGTC
AATTTGATCCCATATAGGTAGTTTTTAAAAGAGCAGGGATTGATCCACCCGCCACGGCTC
CAAAAAGTCTGGAGTCCATGAGAATTTGAAATTCTTTAATACATTTTCCCCCTTTTGATC
AGGATTATTCTGTGGGGTCTTTGATCAAAATGTTGAATAATGGTAGCCAGGCACCATCCA
GTTCTGGGCTCAAGGCAAAGGAGACTAGGCAGCTGTTCATGGAGGCAGTTAGCAACATAT
TCCATTTCCTCCCCGTATTCCTGACATCCTTCTTCCTCTTGCACAAGGCAGACAGAGACC
AGTTGTTGTGCCTTGGATGCGTTCATTGTCTTTGCCAATGTTTTATTTGGAGCACTAGAA
TCAGATTTGCTGGTTAAAGGGTAAATGCATACGTAAGAATTTGTTAGATATTCCAAAATT
TCTCTCTGTAGGAATTTTTCTGTTTTGTATAACCACCAAGGAGTGTGAGGGCCTGTTTCC
TCATAGCCTTGCTGACAAAGGATGTGCCAGTCTGAAAGGTGAGATGTAGTATCTCACTGA
AATTTTAATTACAGGGAGTAGATATTTTGAAACTATGTACATTATTAAAAGAAGCTTGAG
AGGGCTGTTCATGTTCTTCTGTTTGAAATGCCTTGGGCCCTAGCCTATTTCGTCATCCAG
CACCACTCCTATCGGAACTGACCCGGGCCTCAGTGAAGTGCCCCATGTTTCGACTTCTCT
GGAAGAATCTTTCTCTTCCCGTCCCTATCATTCTGCCCCCCGGGGACACGGGGGTGCGGG
AGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTTTCACTCTGGGAGTCCTGGTGGTGCAGTGGTTGAGAGCTA
TGGCTCTCTAACCAAAGTTTGGCAGTTCGAATCTACCAGGCACTCCTTGGAAACCCTATG
GGATAGTTCTACCCTGTCCTATAAGGCCGACATGAGTTGAAATTAACCCAGCGGCAAGAG
GTTTGTGTGTGTGTTTTTAATTTCACTCAGCATAATGTTCTCAAAGTTCATCTATGTTGG
AGCATATATCAAAGCTTCATTTCTTTATTACTAAGTCCCTGGGTGGCACAAATGATAAAG
TGCTGGGCTCCTAACTGAAAGGTTGGTGGTTTGAGTCCATCCAGAGGCACCTCGGAAGAA
AGGCCTGTCAGTCTACTTGCTAAAGATCACAACCATTGAAAACTGTGTGGAGCGCAGTTC
TATTCTGACACACAGGGTCGCCAGGAGTCAGAATCGATTTGACGGTAGCTAGTTTGTTTT
TTTTGGTGTGTGTATACTATATTTATATATTTTTCTGTTGGTAGACATTTAGGTTCCTAC
CTTTTGGCTATCTTGAGTAGTGTGCCTCAGTGAACATTGGTGTTGTGTTCCTGCTTTCAG
TTCTTTTGCACATATATCTAGGAGTGGAACAAGCAGACCATGCAGTAATTCTACCTTTAA
CTTTTTGAAGAAGTGCTAAACAGTTTGCTACAGCAGCTGCTCCATTTTATAGTCCCACCA
GCAATGAGTGAGAGTTGCAATTTCTGCATACCCTCACCAAAACTTGTTTCCCATTCTTCT
GGTAGTAAAAGCCAAACTCATTGCCATCAAGTCAATTCTAACTCATAGCAACCCTATAGG
ACAGAGTAGAACTGACCTATAGGGTTTCCAAGGAGCACTTGGCGGATTCAGTTCTGACCT
TTTGGTTAGCAGCCATAGCTCTTAACCACTACACCACCAGGGTTTCCAATAATAGCCATC
CTCGAAAATAATAATAAAAAAAAAATTCATTTGCCATAGGGTTGATTAACTCCTAGTGGG
AGTGAAATGGTATCGAATTGTGGTTTTGGTTTGCATTTCCCTAATGATTAATGACATTGG
TGATTTTTTCCTCTGCTTGTTGATTGTTTGCATGTCTTTGGTGAAATTTCTGTTCGAGTC
ATTTATCCTATTTTTGATTGTCTTTTTTGTTGTTAAGTTATGGGAGTTCTTTATACATTG
AAACTTGTGCGAGCCAGAACTTTGCAGGACTGCCTTGTTTTTCTGGGTCTTGGAAGTTTT
CCACCTTTGACGGGATGTGATCGTACCAATTTTCTTGTCATTTGTTTTAGTGGAAAATAT
TGGAGTTGCCCTTCTCTGACAGGAGTGTGTCATACACAGGTTCCAGCTTTCACAGGTTTT
ACTGTATACTCTGCATATTAAACCTTTATCTAATAATGTCGTTCCCAAGTATTTTCTCCC
GTTCTGTAGGTAAAGATACTTTGTTGATACTGTTTTTTTTTGGTGCGTGAGAATTTTTAA
TTTTGAAGTCTAATTCTTCTGTTTTTTCTTGACCATGTCTGGGTTTGCACATAATTTTTG
GCAAAGTGGGTAAGAATGTGGAATGTTTGTTGGAGTATTTGAAATTTATTCATCGTGCTG
TACATAGACTTTATTTTCAGAAGTATTAATTAGATACTTTAAAGAGAATCTGTAGCAAGT
TGGCTCAGAAAATTCTAGTGATAAATGCACAGTTGGGAGATATAGTAGAAATTAACCGTA
TGTTTCAACAAGTTTTTCTTTATCAGAAAAACAGATTAACTTATATTTAGGTGTTCTGGG
GACTAGCAAGTTATATTTTTCACCTTTGTTCTCTCTTTAGGAGTGTTTCTCAGGAGTTAT
CAGAAACCATCCTCACCATGGTAGCCAATTGCAGTAATGTTATGAACAAGGCCAGACAGC
CTCCACCTGGAGTTATGCCAAAAGGACGCCCTCCCAGTGCTAGCAGCTTAGATGCTATTT
CTCCTGTTCAGGTAATTGAAACCGACAATTCGTACATCTGCTTTTGTTCATAGATTGGAA
TAGAATAAATTTCTACGTCACCATTAGTAATCTACTCGAAAGAAAATTTTGTCTGAATTT
ATTACATTTTAGATAATTGCATGTCTAGCATCTACTTATATTTTAAAGGAGACCCATAAC
TAGGCGTTGTAGTTGAGTTTAGCTTTTAATCATTAAATAGAACATGACTGAGAGGAAAGA
TACGGAACAGCTTACTTAGGTAAATGGTAAGGGTTTCTTTTTAAAAAAGAATTAACTTAG
ATTCTTGAGAAATAAGCACTGCCTTTGAACCTGATGTGTCTTGTTTGTAGCTTCACGGGC
AAAGCAGCAGTGCTAGAGCATAAGGACTTGTTAGAACTGGGGCTCTTCAGCTCTCAACTG
AACTGCTCTTTTAAAAACAAGGTACATTTAAGATACTCCCTGACGCCGACCACCGCCTTC
TCTGGGAGCAACGAGTTCTGCTTCGGTTTCCAGCTGCACTGAATGGCAAATTGGGGATTA
AAAAAAGAAACAGGCGCTTAGTGATTCTTCAGTGGCCACTGTATAAAAGGCATTTTGCTT
ATCAATTTTCTGTAGCCAGGTAGAATGAAGTAGTACCAAAAAGCTTGAAAGTGTAGTTAT
TAGATATTTAAAAAATCTGTTGGCGAGTCACGTATACTGTTGTTTTTATTTTTTTTTTAA
TTTAAGTAAGAGCTGATCTCCAAACTCCAAGATTTTATAATTTTGACTAGATTTATTTCT
TTTGCCTGGAAGATTGATTGCTAATTCCTAATGTTTTTATTGTGTTGAAAGTTACATAAC
TTAGCTTGAGAGGTTCTTTTCCTATTAAAAAAGCCAACTGACAGTTCCAAGGATAACAAC
TGCGCCTTGTTGCTACTAAGTGTTTAGTACTATATATGCAAGGCACTGATCTCAGGTCTT
CTCGAAGTCTGGTAGCCCTCATTTTACAGCTCTGGTACCTGGCAAAGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNACTGTCATCACAGCTTCCAGGTAAGGGGGAGTGAATGGGTGGGAGCAAATGTATTTAA
ATTTCATTGTGCCTTCTTGTATTTTAAGGAGTTTGTAGCCATTGTGATAAGGAAAGCTGC
TTCAACTAAATACCTTTGCAAGAATTGTTTCAACATCCAAAGTTAGGAAGAGAAAAACAC
AGTACTATTCCTGTTAATCCCACCTAATGGAATAAAGAATTAAGGTTATTTGTAGTGGTG
AAGTTAATTTAATTTTTTACCAAATGATAGTATAAACAGTAACATGTTCCTTAATCACAC
ATTTTAAGAAGCTTAGATCAAGAACTCACAGCTTTATGAATTATGCATGGCTGTTATAAT
AAAGGTAGGAAATATTGTACATAACAGATTTCAGCATGTGTTTGGCTTCACTGCACTTTA
CCTACCTTGAAAGTACTAGTAAATCCCTAAAACTTTTTCATATTTTTCGAATATTTTGGA
GTTCGATATTATATTGAAGTAAAGGTTACTTTTTTTTTTTTTGGTTGTACCGACTTGCTT
GTCTTTAGCCATCTGCACCTTTTATCATCAGAATATAAATTAGAGAACTAAACATAAGAA
GTAAAATGCTGTCATAATCTATAATATAGTGAACACTGCTGGTTTGTGATTCTAGCCCTA
ATGGCTCAGTTATTTAAACCAAAGTTACTGTCCTTACTAAGGCTTCCTAGCAAAGTTTTA
ACTATTGTTAGAATCTGTTTGATAAAGTTGAGGGGAATAAAGAAGTCCTGCATTATGGCA
GCAAGATAGTGCATGAAATTGTATACTTTTAGTCATTGAGAAAAGTAGACCAACTCATTT
TGACTATCTTGTAATACGATGGTGTGTGTTTTGAGAATGTATACTTCTTTTGGTGCATTA
ATAACTTAGCAAGAATATAAAGGAACGAATAAGATAATTATATATACTAAAGAAAGTTTG
GCATGCTCCATTCTAATCTTATTATTTGTTGAGATTCTTTGTAAAATTGAATGGACATAG
TAAGGGAGTTAACAAAGATCCTGACTTTTAAAAATAAGTACAAAAAGGACTATTTCTGAG
ATGTGAATAAATTCAAGAATATGAGTAATGATAGGACTTCTGGCTGCCTTCCTTCTCTCT
AGTAGGTGGTCTTGGCACAGGCAGCCTGACTGGTATAGGAACTGGGGCTCTTGGACTCCC
TGCAGTGAATAACGACCCTTTTGTACAGAGAAAACTGGGCACCTCTGGACTGAACCAGCC
TACATTCCAGCAGAGTAAGATGAAACCTTGTAAGTGGTAGTGTTGTCCGTGATTGTGAAG
TGTGACTGATCCATGTACAAATTTTTGATTGTTGTGTCCCGTTTCTTGTACCTGGAGTTA
CAGGAACAAATACATTGATTTAGTATATTATCAGTAGGACCATATGTTGATATACTTAAC
TTCCTAGACCAGACCAGTGGGAATAAATTAATGAATTTGAATTATTAAAATAAAAATGAG
GTATTAATTCACCTTTGCTCCCCACTACTAGAACAAAGTGAAGATGGTACTTTTGAGTTT
AATGAGAGGTGTAGCATTCTTATGGTATGATCATACTAAAAGTAAAGAGTAGGTACAGCA
AAGAGAAAAGAAAGATTATCAGCGATTTAGATACATGTATAGACATCTCGAGCATACCCT
AAAAATTTGTTGTTTCAAGTCAGGAATAGCCAGGAGAATTTCAGATTTGTTTTCAGCCTG
GCAGTTTATAAAATAGTTGACTATATTTTAGTTTATCTTATGGTTATAGCCATATAATGT
ACATGATATAACTTAAAACCAATTTTTAAAGTTTTGCCTCCTTTAGTAATTTTTATAGTT
TTTACGTTAGAGAAGTCATCTTTATAAATCTGTAGGCATAATGGAATTATAAATGATCTT
GTCTTTGGGACTAAATATTCATAGTACAGGGTTTAAAAGTAGTGTTGTCAGCTGACTTGA
AAATACTAGTGTGAAAGGCTCGTCTGAATGTTATGTTTTGTAGCATGCATTGTGTTTTTA
TTGGTCTGTCTTACATTGCATTGAAAATTTTTATGTGTTAAATGTGATTTTTATTATAAA
ATAGTAAAGAATTAACCTTGAGTGAGGTTGCATTAAGGATAAATGTAGTATGAGTTTAAA
CGTTGTAATTAGTCCTGAAGGAAAATATTAGGCAGTTCTGTTAAAATCTTTTATGTCTAT
CCCAAACACTTTTCATATCGAAACTTGACCTTTTAATACTTTCTTCAGTTCCTGTACTTT
TCACTTAAGTTAAAACTTTATTGGTCTTCTGGTTCTATGTGGGGACGCGGTCAAAAGGCT
TGAATTGCCCACTGGTTACTTTTCTGTTTCCAACAGCGGACTTGTCTCAGGTGTGGCCAG
AGGCAAATCAGCACTTTAGTAAAGAGATAGATGATGAAGCAAACAGCTATTTCCAGCGAA
TATATAATCACCCACCACACCCAACCATGTCTGTTGATGAGGTGAGTGTCCAGGATGATC
TAATTATTCACTGTTCAGGCAAATCTTAAAATAAATGACCTTTTCATGTTTTATTTATTT
TTTTGAAATCCAGCTTGAAGTGTTTTGAATATGTCTTTGTATCTCTTAAAACCTTACATT
TCTCTCAAATTGAGTCAACTGTCCCAAAATTGAAGTTTTTCAGGAACATGGGATTTTTGT
TAAATACTTAATAAGTGTTCTATTAAGGATATATAAGGACAGCTTTCAGTAATAGTTAAT
GTGTGTGTTTTGGTTTTTTCCAGGTATTAGAAATGCTACAGAGATTTAAAGACTCTACTA
TAAAAAGAGAACGAGAAGTATTTAACTGTATGCTGAGGAACCTGTTTGAAGAATATCGGT
TTTTCCCCCAGTACCCTGATAAGGAGTTACACATAACAGCTTGCCTATTTGGAGGAATAA
TCGAAAAAGGACTGGTCACATACATGGCCCTAGGTCTGGCCCTGCGATATGTCCTTGAAG
CCTTACGCAAGCCTTTTGGATCCAAAATGTATTATTTCGGGATTGCTGCTTTAGATAGAT
TTAAAAATAGGTAAGTGAGAAGGTTTCCTATGAAGCTTTCCCCTGTCATTATGAAGAATA
ATAACTATCATTTATTAACTTTATTTATAATATATGGCAGGCCTCGTACAAAGCAGTATA
CATGCATTTGTGTTGCAATGACTATATGAAGTAGAAGAATTTAAAAGTTCAGTTTATTGC
AGTAATTGAAGTGGTAGGCAGTTTGTAAACTGAGATTGCAGGATTTTTGTAGTTTGAGGT
ATAATCTGTATACAATAAAAGCCATCCTTTTTAGGTGTGTAGCTTTTTGAACTTTGATAA
ATTTATATAGTTGTGTAGCCAGCACTGCAATCAACATACTGAATGTTTGCCCACCCTCAG
TCCCTGGCCATGATTGATCTGATTTCTACCTAGAGTGTGCCTTTTCTGACGTGTCATATA
AATGAATCATTCAATAGTAGGCTTTTGAGTCTGACATCTTTCACTTAGCATGATCCTTTT
GAGATTCATCCATGTCACTTAAATGTTTTAGTAGGTCAATCCATTCTATTGCTAAACTAT
TCCTTTGTATGGATTAACAAGTTGTTTGTCACCTGTTGATGACACCTGGTGTACATTTGG
GCTTGTTTACAGGTAGTAGTTTTAGTGAGACCGCTGAAAGCTAGTTTAAAACTGGACTTT
TAAAAAACAAAGATAATGTTTCTTCCTGATGTAAAAGGAGTACAGCTCATAACTATTTTC
CCCCTCTACTTCTATGTTCTTCCTTTTGGTATTCTCTTCAAATAAGGTATTTTGTAGGTA
GAATGGGGAAAAGGACCTTGATTAGCATATGGAAGGAAGTTGTTGTGTGTAGCTCTGCTT
CTACTTTTATGTGAAATGATGAAGGGATGAATGAATGATTTTGCTTGCAGATTGAAGGAC
TATCCCCAGTATTGTCAGCACTTGGCTTCTATCAGTCACTTTATGCAATTCCCACATCAT
TTACAGGAGGTAAGTGCCTTCGATATCTAAAATCTTTTTAGTAGTTTGAGGGTTTATGTA
TTGGAAACATTCCTACTGTTTTAATTCAGAGTGTTGAATTTGGGATTTGCTAGGAAAGAC
ATTAAGATTTTTTAATGATTGGCATGAACTAGATAAATATATTGGTTGCTTGTTTTGCAG
CTCAGTAGTGAAAAATAATAAAAAAAATAGAATTCTTAGGTTATCTTTTTTTAACCAGTG
GTTTTGTTTGATTTAATAAAACAGTTTTTATTCTCTTAAAAAGGATTTTGAGTGGGAATT
TTACATTTAAATCAGTAAAATTATTTATCTGCTTTAAATATCAATAAGATGAAATGGTGT
TACGTGTAGTAAAATACAGTCTTCCTAACCAGCTCTTTAGAGTTGCTTGTTGAAAAGAAG
ACAGTCCCTAGGGAAATGGACCTAGGGAAATGATATTTGTAGCTGCCTTCTTGCGTGGTT
ATTCTTGAAATTTAAGGACCATTGTCTTAGTGATTGATTTTAGATTGACAGGTAAACATT
TATACCACTCTCTTAACCTGTGGTCAAAGTCAGCTTAAAGAGAACAAGAAACTTGATTGA
GCTTTATTAGCTTTGTATTTTACACACAGCAGATAAATGGCTTTATAAGATTGTTTTTTA
AGAAATCAGAAAGATCAGAATTTGAACTTACTTGAAATTCTAAATTATAATTTAGTTTGT
GTTTTTTACTTCACTCTGCTGGATTTGTAAAAGAGGCAGAACTATTGTGATGGCTAAACG
TAAGAGACCCTGGTTTGGGAGGTAGTGTATCCATTCAAGACAGGAGGGTGGGGGAGTGGA
TATAGTGCTAAATATTAAGCCAGTACTAGTAAAAACTACATGAGAAAGTAGAACTTTGAA
AAGCTAAGATGGGAGGCCAGAGGCTAACCACACTCAAAAGTTCTAAAGAAGGGTGTTTGG
AATCCGGAGCTGGGAATATACAGCTAGGAAGACTGGAGAGCAGGAGAGATGGTACGGGGG
TAATCATAGAAAATTGTACCAAACACCTAGCATAACAAGATAGGGAAAAATAAAAAAGAG
AGAGATCATTGCTTATACTTATATACTTAGTCATTTTAAAGGGCTGTACTTGGGTCAGAG
ATTGCCCTTCCTATTTAAAAATGTCCTTTTTTTGTTCCTTTTTATTTATTTCTTCTGTTG
TTGTTGAGAATATACATAGCAAAACATACACCAGTTCAACAGTTTCTGCATTTACAGTTC
AGTGACATTGATTGCATTCTTCAAGTTGTACAACCATTCTAACCCTCTTTTTAAGAAAAA
TGTCCTTTCTTTTGTGAAGTTACCACAATTGTAGATGGCTTTAGTTTTGCCAGGTAGGGG
CTGTTGTCATAGAATGAGAAATGCTATGGCAGTCCTTTAATTTGGGGGTGAAGATGGGGA
AGGGAGTTTTATTGGTTTTTTGAGGGGGAAAAGCTTCTAGAATACCTAGTATTACTGTTG
AGTTGGCTTAGCTGTGTACAGTGTTTTATATTAGTTTTGGTAGTTAAGACTTTGTTAGAT
AAAACTTAAACATTGCAGTGTGCCTTTTAGATCATAGGTTTCTCATCTGTGTTCAAAAGA
GAGAGAAAAGTTAGTTTACCATATATATTTTTAAGAATTTTAAGCTTGCATTTGTTAAGG
GATTAAACAAAGCTTACAGATATTTGGGGCTGATATCTTAGAAGTTGTTCAGTTAGATTA
TTTGCCTCATAGATAGTTTTTACATACTAACATTTTAACCTTCTAAGGAGTCCATGGCAC
CCACTTGTGTGTGAGTGCCTGGATGAGGCAAGGAATGAGGAAAATGAACCTAAACAGTGC
TCTGAAATTATTAGTCCCCCTCAGAAAAGTGAGGAGAATATAATTCAAATATTAGAATTT
CTGTTAAAAACTTTTTAAATGTGTTTCCCCTTCCCTACCCTTATAGTATATCGAATATGG
ACAGCAGTCTAGAGATCCTCCTGTGAAAATGCAGGGTTCCATCACAACCCCTGGAAGTAT
TGCACTGGCTCAGGCCCAGGCTCAGGCCCAGGTTCCAGCAAAAGCTCCTCTTGCCGGTCA
GGTTAGCACTATGGTAACCACCTCAACAACCACCACTGTTGCTAAAACGGTTACAGTCAC
CAGGCCAACCGGAGTCAGCTTTAAGAAAGATGTGCCAGTAAGTAGGTCTATCTTCTTCAT
TTTCCAGAATTTGTTATGTTGTGATATATCCAGTAATGAGCATGTATTTTGGTTTTAACT
ATAACACGTGCCTATTAAAGGAAAAGCATAAAGACCAGTATTTCTTCCTTTATGTTTCTG
AGACCTCCTCATATTTCCCAGAGGCAGCCACTATTACTAGTTTATGTATTCTTGCTTGAT
GCTTCCCATGCACAATCATACCATGTGTATTTTTATAATAAAGAGATACATTATAATATC
ATATACATTTTATTTTGGAACTTGCCAAGCAAGCATTTCAACTTGTTTATATTACATGTT
TTATCATTATTATTATTTTTAGCCTTCGATTAATACTACAAATATAGATACATTGCTTGT
GGCCACAGATCAAACTGAGAGAATTGTGGAGCCACCAGAAAATATCCAAGAGAAAATTGC
TTTTATCTTCAACAATCTCTCACAATCAAACATGACACAAAAGGTGAGCATGATTATAAA
TCACTTACAGGTGCTCTTTTTTTTTTATCCCTAACAGTTTAGGGGATTTATTTCTGAAGT
TCTGCATGTTTTTATTTTTAATTTTTATTGTGCTATAAGTGAGAATTTACAAATCAAGTC
AGTCTCTCATACAAAAATTTATATACACCTTGCTATACACTCCTAGTTGCTCTCCCTTTA
ATGAGAAAGCACACTCTTTCTCTCCACCGTCTATTTCTGTGTCCATTCAGCCAGCTTCTG
TCCCCATCTACCTTCTCAACTCCCATCCAGACAGGAGCTGTCCACATGGTCCCATCTGTC
TACTTGATCCAAGAAGCTAATTCTTGACTAGTATCATTTTCTATCCTGTAGTCCAGTCCA
GTCCGTGTCTGAAGAGTTTGTTTTGGGAATGGTTCCTGTTGGGCTGACAGAAGGTCTGGG
GACCGTGACCTTCGAGATCCTTCTAGTCTCAGACCATTAAGTTTGGCGTTTTTAAGAGAA
TTAGAGGTCTGCATCCCACTGGTCTCCTGCTCCCTCAGGGGTTTTCTGTTGTGTTCCTTG
TCAGGGCAGTCATTGGTTGTAGCTGGGCACCATCTGGTTCTTCTGGTCTCAAGCTGATGT
AGTCTCTCGTTTATGCGGCCCTTTCTGTCTCTTGGGCTCTTAATTACCTTGTGTCTTTGG
TATTCTTCATTTTCCTTTGCACCAGGTGGGCTCAGACCAATTGATGCATCTTAGGTGGCT
GCTTGCTAGCTTTTAAGACCCCAGATGCCACTCTCCAAAGTGGGATGCAGAATGTTTTCT
TAATAGATTTTATTATGCCAGTTGACTTAGATGTTGCCTGAAACCATGGTCCTCAAACCC
CTATTCCTGCTATGTTGGCCTTCAAAGCGTTCAGTTTATTCAGGAAACTTCTTTGCTTTT
GGTTTAGTCCAGTTGTGCTGACCTCCCCTGCATTGTGTGTTGTCTTTTCCTTCACCTAAA
ATACTTCTTATCTACTATCTGAAGTGATAGTATTATTAGTGAAAACCCCTCTTTCTCCCT
ACCTCCTTCCCCCCCTCATAACCATCAAAGAACAAAAAGAATAAATTATTTTTTGAGTTC
TTATAATAGTGGTCTTATACAATATTTGTCCTTTTGCAACTGACTATTTTCACTCAGCAT
AATGCCTTCCAGATTCCTCCATGTTATGAAATGTTTCACAGATTCATCGTTGTTCTTTAT
TGATGCATAGTATTCCATTTTGTGAATAAACCATAATTTATATCCATTCATCCGTTGATG
GACATCTTGGTTGCTTCCGTCTTTTTGTTGTTGTAAACAGTGCTACAGTGAACATGGGTG
TGCATATATCTGTTTGTGTAAAGGCTCTTATTTCTCTAGGATCTATTCCAAGGAGTGGGA
TTGCTGGATCATATGGTAGTTCTATTTCTAACTTTTTAAGGACGTGCCAAATCGATTTCC
AAAGTGGTTGTACCATTTTACATTCCCACCAGCAGTGTATGAGTATTCCAGTCCCTCCAC
AACTTTTCCAGCATTTATTATTTTGTGCTTTGGGGATTAATGCCAGCCTTGTTGGAGTGA
GACGGAATCTCATTGTAGTTTTGATTTGCACTTCTCTAATGGCTAATGATCATGGGCATT
TCCTCATGTATCTGTTAGGTACCGAAACGTCTTCTTCAGTGAAGTGTCTGTTCATATCCT
TAGCCCATTTTTTAATTGGGTTATTTGTCTTTTTGTAGCTGAGTTTTTACAGTATCACGT
AGATTTTAGAGATCAGCTGCTGATCGGAAATGTCATAGCTAAAACCTTTTTCCCAGCCTG
TAGATAGTCTTTTACTCTTTTAGTGAAGTCTTTGGATGAGCGTAGGTATTTGATTTTTAG
GAGCTCCCAGTTATCTAGTTTCTCTTCTGGTGTTTGTGCATTGTTAGTAATGTTTTGTGT
ACTGTTTATGCCATGTATTACGGCTCATACCATTGTCCCCTATTTTTCTTCCATAATCTT
TATTGTTTAGATTTTATATTTTAGGTCTGTGATCTATTTTTAGTTTGGTTTTTGTGCATG
GTGTGATGAATGGGTCTTTGTTTTATTTTTTTTTTACAGATGGATAATCTAGCTATGCCC
ACCACCATTTTGTCAAAAAAACTTGTCTTTTCCCCATTTAACTGGACTTTGGGGCCTTTG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GTCTTCACGTCACTGTAGATCTGTTCTAGTATTTATCTTCTTGGGGCTACTGTAAATGTA
TCAGTCGGGGATTTCCTCTTAGATGTTCTTTTTGTTGGTGTAGAGGAATCCAACTGATTT
TTGTATCTTTAATTTGATCCTGACACTCTGCTGAACTATTAGTTCCAGTAGTTTTCTTGA
GGATTCTTCAGGGTTTTCTGTGTATAAGATCATGTCACCTGTAAATAGAGATACTATTAT
TTCTTTCTTACCAATCTGGATGCCCTTTATTTCTTTATCTAGCCTAATTGGTCTGGCTAG
GACCTCCAGCACAATGTTGAATAAAAGTGGTAATAAAGTGCATCCTTGTCTGGTCCCCGA
TCTCAAGGGGAATGGTTTTAGACTCTCTCCATTTAGGATGATGTTGGCTGTTGGCTTTGT
ATAAATGCCCTTTATTGTGTTGAGGAATTTTCCTTCTATTCCTATTTTGGTGAGAGTTTT
TTGTCATGAATGGGTGTTGTACTTTGTCAAATGCCTTTTCTGCATCAATTGATAAGTTCA
TGTGGTTCTTGTCTTTTGTTTTATTTATAGGATGGATTACATTAATTGTTTTTGTAATGT
TGAACCACCCCTGCATAAAAAAAAAATTTTTTTTTTTCGCATACCTGTTATGAATCCCAC
TTGGTCATGGTGAATTATTTTTTTGACATGTTATTGAATTCTATCGGCTAGAATTTTGTT
GAGGATTTTTGCGTCTAAGTTCATGAGGGATATAGGTCTGTAATTTTCTTTTTTTTTGTG
GTGTCTTTACCTGGTTTTGGTGTCAGGGATATTCTGGTTTCATAGAATGAGTTTGGTAAT
AACCCGTCCTTTTCTGTGCTCTGCAAAACCGTTAGCAGCCGTGTTAACTCTTCTCGGAAA
GTTTGTTAGAACTCTGCAGTGGAGCTGTATGGGCCAAGGGTTTTTTGTTGTTGTCGTTGG
GAGCTTTTTTGATTACCTTTTCAATCTATTCTTTTGTTACGGGTTTATTTAGTTGTTCTA
CCTCTGTTAGTTTAGGAAGCTAGTGTGTTTCTAGGAATTCATTTCTTCTAGGTTTTCAAA
TTTGTTAGAGTACAGTTTTTCATAGTAATCTGATATGATTCTTTTAATTTCAGTTGGGTG
TGTTGTGATATTGCCCATCTCATTTCTTATTCTGGTTATTTGCTTCCTCTCCTGTTTTTC
TTTCGTCAGTTTGGCCAATGGTTTATCAATTTTCCTAATTTTTTCGAAGAATCAGCTTTT
GATCGTGTTAACTCTTTCAATTGTTTTTCTGTTCTCTATTTCATTTAATTCTGCTCTAAT
TTTTTTATTTGCTTTCTTCTGGTGCCTGAGGGTTTGTTTTGTTGCTCTCTTATTTGTTCA
AGTTGTATGGATAATTCTTTGAATTTGGCCCTTTCTTTATGTGTGCATTTATTGATACAA
ATTAACCTCTTCGCACTGCTTTAGGTGTGTTCCAGAGGTTCTGATAGGGAAGTGCTTTCA
TTCTCGTTGGATTCTCTGAATTTCTTTATTCCATCCTTTCATGTCTTCTATAATCTAGTC
ATTTTTGATCAAAGTGTTACTCCAGTTTTCAAGTGTTTGATTTCTTTTCACTGCTTTTCT
GTTAACTGATTTTCTACCTTTATGGTGTTATGGGTCAGAGGAAATGCTTAGTAATATTTT
GATGTTTTCGAGTCTGCTACATTCACGATTTATGACTGAATACCTGGGCTATTCCAAGAA
TTGTGCCGGGGTGGCCCTGAAAAAAAAACGATATTTGGGTTGCCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGAA
TTTGGCCCTTTCTTTATGTGTGCATTTATTGATACAAATTAACCTCTTCGCACTGCTTTA
GGTGTGTCCCAGAGGTTCTGATAGGAAGTGCTTTCATTCTCGTTGGATTCTCTGAATTTC
TTTATTCCATCCTTCATGTCTTCTATAATCTAGTCATTTTTGATCAAGGTGTTACTCAGT
TTCCAAGTGTTTGATTTCTTTTCACTGCTTTTTCTGTTACTGATTTCTACTTTTATGGTG
TTATGGTCAGAGAAAATGCTTTGTAATATTTTGATGTTTTCGAGTCTGCTACATCATGTT
TTATGACCTGATACGTGGTCTATTCTAGAGAATGTTCCGTGTGCGCTAGAAAAGAAAGCA
TACTTGGCTGCTGTTGGGTGAAGTATTCTGTATACGTGTATGAGGTCAAGTTGGTTGATT
GTGGCATTTAGATCTTCCATGCCTTTATTGACCTTCTTTCCGGATGTTCTGTCCTTTACC
TAAAGTGGTGTGTTGAAGTCTCCTACGCTAATTGTGGCACTGTCTATCTCAGTTTTCAGT
CCTGTTAGTTTGTTTTATGTTTCTTGGCAGCCCTGTCATTGGGTGCAGAAATATTTAATA
TGGTTATATCCTCCTGGTATATTGTCCCTTTAATCATTATATAGTGTCCTTCCTTATCCT
TTGTGGTGGATTTAACTTTAAAGTCTATTTTGTCAGAAATTAATATTGCTACTCCTCTTC
TTTTTTGCTTGTTGTTTGCTTGATATATTTTTTTCCATCCTTTGAGTTTTAGCTTGTTTG
TGCCCCAGTCTAAGGTGTGTCTCTTGTAGGCAGCATATAGACAGATTGTGTCTTTTTATC
TGCCTGCCACTGTCTCTTTATTGGTGCATTTAGTCCATTTATATTCACTGTAATTATGGA
TAGGTATTTTTTTAAATGAGTTTAGTGTTGTCATTTTGATGTCTTTTTTTGTGTTATTGA
CAGTTTCTTTTTCCCACTTAATTTTTTGTAGTGAGTAGTTTATAGTCTTTTCCTCTTATT
CTTTGTTGTTGATTTTGTTTCTGCTGAGTCTCTGTATTTTTTTCTTATATTTTATTTTGA
TGAATAGGATTGTTAGTCTCCTTAGTGGTTACTTTAATATTTACCCCTATTTTTGTAAGT
TTAAACCTAACTGTTATTTCTTTATATTGCCTTGCCCTCCTCTCCATATGAAAGATCTAT
GACTACATTTCTTAGTCCCTCTTTATTGTTTTAATGTTGTCTTATTTTACATAATGATAT
CGCTGTTTCCCTGTCTTGAGCGGTTTTTTATCTTGATCTATTTTTATGATTTCCTTCTCT
GGGTTGACATCTGATTTCGCTGTTCTGTGTTTTAGCCTTGGGTTGATACCTGATATTACT
GATTCTCTGACCAGAGAACTCCCTTTAGTATTTGTTATAATTTTGGTTTGGTTTTTGTGA
ATTCCCTAAGCTTTTGTTTATTTGGAGATGTCCTAATTTCGCCTTCATGTTTGTGAGACA
GTTTTGCTGGGTATAGGATTCTTGGCTGGCAGTTTTTTTCCTTCAGTGCTTTATATAAGC
CATCCCATTGCCTTCTTGCCTGCATGGTTTGTGCCAAGTAGTCCAAGCTTATTCTTATTG
ACTGTCCTTTGTAGGTGACTTTTTGTTTATCCCTAAAAAAAACCTAGCCACTCTTAAAAT
TCCCTCTTTGTCTTTAGTTTTGGTAAGTTTGATTATATGTCTTGGTGACTTTTGGAAACC
CTGGTGGCGTAGTGGTTAAGTGCTACGGCTGCTAACCAAAAAGGTCAGCAGTTTGAGTCT
ACCAGGCGCTCCTTGGAAACTCTATGGGGGCAGTTCTACTCTGTCCTCTACTGTTGCTAT
GAGTCAGAATCGACTCGATTGGCAACGGGTTTATTTTGGTTTTGGTGACTTTCTTTCAAG
ATCTATCTTACGTGGAGTTTGATGTGCATCTTAAATAGATATCTTCTCATCTTTCGTGAT
ACCAAGGAAAATTTCTGCTAAGAAATCTTCCACAATTCTCTCTTTATTTTCTGTTACCCT
CCCTGTTCCAGTACTCCAGTCCCTTATAGGTTATTTCTCTTGATAGAGTCCCACATGATT
CTTAGGGTTTCTTCTTCTTTTTTTTTTTTAATTCATTTATGTGATTTTTCTTTGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATCCTAGCTTCTTGCTTTGTTTTG
TTTCAATATGCCCACCATAGGTTGTTTGAGTGAGCTAGGTTGATTATTTTTGCCTTTGAA
GCTCTGACATCCTGTCACTGGATGGCTAGAGCTGTTATCAGGTCACTTCCCTTGCATGGA
TTCAGCTCAGTTGTCCATGTCGTTGGTCATCAAGTGTGTGGCACAGGCTCTGTCCTACAG
TCTTAGAGGGGCACGGGTGATTGGTGTAGGTTAGAGGTACCTGGTTGCAGCAGTCTGAAC
CAAGGCAGGGAGCTGACAACCGTCCCCTGAGTTTCTGGAAGGAAAGTGTGTCCATCTTCC
ATAACGCACACAGGTGGATGGGTTCTGCTGATGGACTGTGGGCATCCAGTGCTTTTGGTT
GTGAGGCCTGGGAGGTACTAGTTATCCTTGGACATCTGTCGCTGGTGGCTGGGTGACCTG
AGTAGAGCCACCAGTCCTCAGGCCCCTGATGTGGGCAGGTGAGGACCCCATTTAATAGGC
AAAGTGGTGTCAGACATCAAACACCCACCGCTCCACTGTACAGCTGAAACAGTTGCAGGC
TGCCAGCAATGGTCTGTTCCCCTGAAATAGGCCCACAGAGGCCTGTACAGGGGGGAAAGT
TACTGAAAGTCTATGGATCGTTTATGCCTGGACAGGAGCTGCTTTTGTCCTGAGCTCCAC
AGGGTAGTGGAGCTGGGAGATTATCTTTTCCCCCAACTGTGAATTTATTCCTTCTCCAGG
GCCAGGAGAATGGCTCAGGATGCTCAGCAGGACCTATCTCAGGCCCAGGGAAATAACAGC
CACTGAAGGTGGCTTGATGGGTTGGGGGGCATGGTCAAATATAAGCAAGTACTTAGCGTT
TGCCCAGAGTGCCATTCTTCTCTGGTTCCGGAGGTGTGAGCAGGCTGTGTGGCTTGCTGT
GTCTCCCTGAGGAAACTGTGGCCCAACGCTACCACCAGCCCTGCTACAATTGCTCCAGGA
AATAGTGCCTGAGGGTTCCCAGTGATTCAGGTCTGGCAACTTCTCTCCGCTTCTGTACTG
TCTGTCCCTCCCCCTGCTGCTCAGTCTGTTTTCTGACATTGTCTTTGATGTTCAGGGCTC
CTAGCTTGTCATAAATATAATCATTTCACTTGTTTTTTCCGGCCTTTATTGTAAGAGGGA
TTACTGGAAGGGTCTGATTACTGCACCAACTTGGCCCTTCCTTTGCATCCTTTTTTTAGT
ACTCATTTTAAAGTTAGAGGTAATTGAATCAAAGTGAAGGGAAAGTGGATGGCAAGCTGG
TGTTTGTGGTTTTTATGGATGTTAGTTAGTGCAAGTTTAAAATATATTGTTTTGCAGTGA
GCTATAGAGTCTTTGAGATTAACCACATGATGTCATGGTCGTGGAAGATTTTATCTGCAC
TTCAGCATCTCCTCCTAGAGATCATTCACAGCATTTATTAGGCTGAATAGCTGAGGTAGA
CCTTTGAAAAACTGCCTTAAAATATGCTTGCCCCCTAAGATTATATGCTAGGACGGTGCT
TGGAAATGCAAGTTTTAGTCAATAAGATTAGCCCAAACAAGTGGGTTTTAAGATGTAATG
CAAGTACCGTCTTTCAGAATTCCAGCGTACTTCATTGGGGGAGAAATTCCACTAGTTGCG
GCCTTCAGCATTCTTTTTTTGAAGAGAAGTTTCAAACTTAAAGATGATTTCTAGAGATCA
AAATTTAGGAAAACGTAGTTCTAGTGTTAGACCTGTTAGAATCTTTCGATTAAGTGGAGG
GTTGAGTGAGATGGGGTGAGGGGCTATATGTTTTCTAATTTCAAAGCTGACAGTGACCCG
AGATGTTTCAGTCCTAGTCACCCAATTGAAGAGATGACTCTACTACCTTAGACTAAACAT
ACTTTGGAGCATCCCTCTGATGTGGGGCAAAGACATTATTTACTGATTTAACATCTAATT
AATATTGTAAGGAGCCATTTACTGTCGTATTGCTCACATAAATAAAACCTTTATTATAAT
TATATATTTTTCATGTCATATCGATTGGCTAGGTTGAAGAGCTAAAGGAAACTGTGAAGG
AAGAATTTATGCCTTGGGTTTCACAATACCTGGTTATGAAGAGAGTCAGTATTGAGCCAA
ACTTTCACAGCCTGTATTCAAACTTCCTTGACACGCTGAAGAATCCTGAATTTAACAAGA
TGGTTTTGAATGAGACCTACAGAAACATCAAAGTAGGTGTTGGCTCTTATATTTCCTGTC
ATTACTTCTTTGAGTTTGAAAATACCTGATTGTATAGGTAGTGTGTGTGTTTTGGGGGAG
GGTTTGTTGTTTTCTCTATATGTTGTCTATATAAGATATCTCAAAATTGCTCTAAGCTTT
GTTTTGAATGTAAAACTAAATTTCATGAAGAACTTAATCTTACAGGCATAACCTATATAC
TGTTTACTCTGAAAATAACTATTCTGAGTTTGTTTTCAGCTTTCCTCGCATGGCTTTATA
TCCTTACCACCTGTCGTAGGTACATAAAGTATAACATTGCTTTGCATATTCTAAAACTAT
ATATGACATCACCCTTTGTGTATCTTTTATTAATTGGCTTCCCCCAAACCCCAGATATTG
TTTGCAGTATGCTCTTAGCTTGAGTCCTCCCCCTTTTTTGTTTCAATACAACTTTATAGA
GATTCATTGTATGGATGTATACTGCTAATGGGCATTTAGGTTGTTAATAGTTTTCACTGT
TATAAACAGTGCTAAAGCGAATGTTTTTGTTTGTGTCTTCTGGTATTCACGTGCCCAGTG
TCTCTAGATTTTTAACCTATTTGTGGAATTGTTTTCTAGGATTCTCAGCAATTTATTTTA
AGGTTAAATTTTTAGTGATGAGGTGAAACCTGTTTCATCACATTTAAGTATTTTAATCTC
CAAACCATTACTTATATTTTTTATGAAGAATAACTTTTAGGAAAAAAAAAAAAGCTCAAC
TTAGCATAACCTGTGATTGTTCTTTGTGGAAGAACTTGGCATACTGGCTGGGAACCAGCA
CTATATTTAAACCAATGAATGGAAATTTTCCCCGTTCTTGGTTACGCTGTAGTGCTAAAG
AATTCCTTGGCTCTTCCTCTTGCACAGCTGACTCTGTGCCATTCTGCTGTTGCTGTATGG
AGTTAAGGAACATAACTATGTTCAGCTTCAGTTATCTGATCTGTTTGATACCAGGAGCGA
CTGAGATACGTGAAAGCTTCCAGATACTCTGAAGCGAAAATCTCAAGTCTCTTGTTTTAA
ACAAAAATTTAAGCATGGCCATAAATTAATTAGGTGTGTGTGTTGCTCAAAGCACTCTTC
TGTGATGGTTCGTTTCCCCCTTAGGAAAACAAGAACTGGAGAATTAAGAGAAATAACATA
AATCAAACTTTATGAAATGGATTGGGTTTTTTAGACATAGGAAAAGAAGTGTGTAAGCAA
TGTTATACCATATTTCACAAAGCTGACTTAGTTGTTGCCAGAGATGTATAACGACCTGGA
TAATGCATAAAGATTGCAGTTGGTGGCCTTATTGTGTTCTGCTGTATGCCTGCTGCCATA
AAGGACTTACAAGCGTAGCTGTAGTCTTCATTTGAATTTAACTGATTAGCTTTACAAAGA
GATTTGAAGTTGGATTTCTGCTTCAAACCTAGCTAAAGTTATCAGAGTTTTAAAATATTT
TTTCTCTGGGAAAAATATAACTTTTGAAATTTATACCATGAATTTGCATCGCCTGTTTTA
AAAAATAAAATGCAAAGACTCATTTGTTTAAAGTAAAAGTGTTACTGTTGGGTAATGAAC
ACAGAGCAAAATAATATTGCTATAATATATGGAGTAGACTACTTTGTGGCATGTTCTCAG
AATTGATGGGCTTCTTGGGTGACATCCTTTTTATCTGTAAAGAAGGGTAGGGGATTTTCT
CAAACATTTGGTAGAGTACGTTCTTTCATAATCTCACTTTCATACCTCTCTTTACTCCTA
CACTATTTTAGGTGCTCCTGACATCTGATAAAGCTGCAGCCAACTTCTCAGATCGTTCTT
TGCTGAAGAACTTGGGACATTGGCTTGGAATGATCACACTAGCTAAAAATAAACCCATCC
TACACACTGTAAGTTTCAGCTGAATGCTCATACAAAATTTGAAACTGTTTACATAGCATA
GTATGTCTGAAATTCTTGACTTTGGGGCCATTTTCATTGTTAAACGGTTCTTATGAGAGT
TTGGCACGTTTTTAATCCCTAATTGCATGCTCTGAGTACCGTACCATAAAGAAAAAGAGG
ATAAAGAAAAGCCAGCAAAATGTAGTTGTCACCTTCCTTCTTTTTAGGAAATCTTAAGTC
AAATGTACATTGATCCCTATTTCTGGGTTGAGCTTGGCAAGATTCCTTTCTTTGGGTACC
TTGTGAGTAGTTTTGTAACATATTCTCAGCTTAAAAAGTATTTTTCTTGTTCTAGGACTT
GGATGTAAAATCTTTGCTGCTAGAGGCTTATGTTAAAGGACAGCAAGAATTGCTCTATGT
AGTGCCCTTTGTTGCCAAAGTTTTAGAGTCTAGCATTCGTAGTGTGGTGAGTAGATTTTA
ATATTTTATTGATTTGTAAGAGTTGATTTGTTTTAGCACAGGATCAGGAGATTATATCTT
TACTTATTATAAACACACAGCCAGGTTTCCTTAGTGGAACTTAGATTTCCAATTTGTGAA
GCCAGGTAAAATAGTAAGACTCTGGTTCTAATGAGTGGCTTTGGGTTTTGGTATAGATAG
GAAGGCTTAGAGTTTTTGTCATGGTCACATAGGTATAAGTACTTAAATGTTTTAAATAAC
CCATTTATTTAAATGTCTAAATAATCCAAATTAAAGGGGATTTTTGAACAGCTCAACATA
ATAGCTTTCCTTTAGGTGTTCAGGCCACCAAACCCCTGGACAATGGCAATTATGAATGTA
TTAGCTGAACTACATCAGGAACATGACTTAAAGGTAAATTTGTTGCTTCTTTATTCCTTG
GAACATTTTCTGCCTGCATATTATTAAAAATTACAGTAAAGACAGTATTTTAGGGAATGC
ATGATAATAATTGGGTGAGAATAGAGTACATTAGGAATAAAGCTAAGACTTTTCTTTTTA
AAATTCTTATCAACTATTGGAATTACGCAGTTGAACTTGAAGTTCGAGATCGAGGTCCTC
TGTAAGAACCTTGCATTAGACATCAATGAACTAAAACCTGGCAACCTCCTGAAGGATAAA
GATCGCCTAAAGAACTTGGATGAACAGCTCTCTGCTCCAAAGAAAGATGTCAAGCAGCCA
GAAGAACTTCCTCCCATCACAACCACAAGTAAGTGTGATTAGTTAATCCCTTCCCTTACC
AGAATGTTCTCTTAAATGGTACATCTCCATGTATACAGCTAGTTTATAGTTGTTCTACAT
TTTATGTTGCTAAAACTATAATTTTTGGTGAGCCTCCTAAATTAAGAGTGATGTTCGCTG
TTATTCATGCATTCTGGCATTACGTATGGTATTCTTAACTAAATGTCAGTTGTTTATATC
ACAGCTAGGCAGGGTTATCTCTTAAGTAGGTTTGAGGCTTCAGAAACCAGTTGCATGGCA
TGTTCACCTGTGCTGTTTCTGAACCTGGGTTTGGCCAGACCAGGTAGACCTCTCAGGGGG
AATGGGTTATGTGAACTGAATTGAGAGGGTTGGGATGAGAGGTATGATTAGAATAAACTT
GCTTTTCTTTCTTTCCCAGCCCTCAGTTTCTGAAAATCTCCAGGTGAAATCAGGGAATAA
CCTAGGTTAAGAATAAACTTCTGTAATATAGGCTATTCCTACAAGGCCTGGGCCTGCTAA
TGTGGCATTACCCCTCATTGATTTCTGTGCTGTGGGGCACTGCCATGTACATAGTTTTAC
ATGCTTTGCCCAAACCTCTGTTCTAGTAACACAATTTCCCTTGTGATAATTTAGGGTGGG
AAGGAAATAACCTGTGATCCAATTAGTAATCCAGTTGGTTTGCATTAAATATTACCACTT
GATACCCAGTTAAATTATGTAGTAAAGCCAAGAAATGTGTTCTTTTTAGCTCTTATTTTA
TGATTTTATATTTAGCAACTTCTACAACACCAGCTACCAGCACCACCTGTACAGCCACTG
TTCCACCACAGCCACAGTATAGCTACCATGACATCAATGTGTATTCCCTCGCAGGCCTGG
CACCGCACATTACTCTAAACCCAACGGTAAGTAAGTGCCCTCACTTCCATGGCCCCAGTT
CCTAATTTGTGACAAGGGAACTGTTTGGTCACCTTCCCTTCTCATTTCCCCTTCCCTCTG
GTGTCCTAGGTTGTAGGCATTTGTTGCAGAGAACAGGGATCAAGAAATACTGTGTAGTAC
AGTTGGCTTTATTTTTTTCCTTCCCTGAAAATACTAATTGTAACTGGACATCATTAATAT
TGACTCCTCATATACAAATCTGTGATATTAAAAATTAAGTCAGCTACATTAAAACCAGTC
TCTAAAAATTCCTTATGCAAGTCAGAATATCCTTAGTGTGTACCAGAACTTTTTGTGGTT
TATTTTCCTCATCATGTCACCTCAGCCTTATATTCAGCCACTTTTTTGGGCAGTTAGCTG
GAACTGAGCAGGTCTTTGTGTGTGTATATAAAATTTCCAGGTTAAGGTCTTGAAGCAGGA
CTTCGCACTTTTAGTTAAGTTGTCGTGGCTTGGTTCTGGGAAGCAGTCTGGTCTAAGCTT
CCCATCATTCCTTTTTCCTATATTTAAAGGTATATTTATGCTATAGAATCAGGTTGGTAA
TTTATTGTTTATCTTCAATTTATTTAATCTGGATTCAAGTACATGGTGTTTTCATGATGT
CTGCAGTTTAGAAAGTAAAATGCTCACGAGTACAGGGCTGACATTAATACACTGAACTTT
TTTTTTTTTTTGGAAGGATTTTAAAGAGATTATTTTATTTTAACCTGGCCTTTTCATTTT
TTAATATACAGCTGTAGTGCTTAGTTTCTGAACTAATCCTAGATGTAAAAATTGTGGTTC
TCCTTCGTATTACTCTGTAATCTGATTACTTTTATGTGTTCATCATGAGTATTTTTAACA
CTTTCTACCTTTAAGTTCTAAACAAATTTAATAAGTTAAAGGGACCAATGTGAGTATTAA
GGCATAGTTTTTTAGGAGTGCTTGAGCCACGAATTTGGACCAAGCAGGAAGTAGGTAATG
CATCTCGTGGTGAAGACTTTGCTCATTAAATCTGAAATTTTAAAAAAATCTAAGACATGT
CTATTATCCTATATCCAGGGTGTACATAATACTTTTTCCTCTGTATAGCCCATTTCCTAA
GTTCTTTTCATTGGTTAATTTTAACTCGAAATTGGCAAGTTAATGGTTAACCTTGAAATA
ATTGCAAAATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTTCAC
TTTCTCAACGAGCTGCTGACTTGTTTGCCCCCACCTAGATTCATTGTTCCAGACCCATCC
ACAGTTAAAGCAGTGTGTTCAGTCAAGCAATTGAACGGGCTGTGCAAGAGCTGGTCCATC
CTGTGGTGGATAGGTCAATTAAGATTGCCATGACTACTTGTGAGCAAATAGTCAGAGAAG
AGATTTTGCCCTGGATTCTGAGAGAATCCCGAATGCGAATAGCAGCCCATCATATGATGC
GGAACCTGACGGCTGGGATGGCCATGATTACTTGCAGGGAACCTTTGCTTATGAGCATAT
CCACCAACCTGAAGAACAGTTTTGCCTCGGCCCTTCGCGTAAGTTGATTATTTCCTTGGT
AGTACAAAACTCACTACTGCATGTCTGCTAGAGTTTCTTTTTCTTGGTCTGTAGTAGTAG
GCAGTAGCACTTATTCTAATAAGCACCTTATTTGTTTGACGTCTTCCTTCCTCTTAGATT
GTAAATTTTATAAGGTGAAGGATCATGCCTGTTTTTTCCTCCCTGTTACATGCTCAACAT
ACAGGGCTTGGCAGATAGTAGTTACCCATATATTTGTTGCTTTGAAGAAACGAGCATTTT
TTAGCATTGAAAATTATTTAAATGACTTTGTATGTGCACGACAAACAGACTCTCTAAGTA
ACTCAGTTATTAGTTTTGATTCTCAGATGTCTTGGTTAATAATGCCTTTGTCAACTATTA
TTTTCGCATTGTTCACCATCTTAACCTGATAAGATGCTTAGGGGCAAGTGGTATTCTAAT
TTTACAAATGAGGAAATTGATTGTTAGACTATTTTAAGGGTTATAGCTAANNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTAATGCATGGCAGGTGTAACCATCTGA
AGCTATCTATGGAAACCCTTATGCCTCTTTTTTTTTTTTTTTTTTTTTAAAATAGACTGC
ATCCCCACAGCAAAGGGAAATGATGGATCAGGCGGCTGCTCAGTTAGCTCAGGACAATTG
TGAATTAGCTTGCTGTTTTATTCAGAAGACTGCAGTAGAAAAAGCAGGCCCTGAGATGGA
CAAGAGATTAGCAACTGTAAGTGTTTAGCATTTGCTTTTTAAGCATTGTTTTTTTTCTGT
TTAAGAAAGTGCCTCATAACAAGAACCTCAGTGATTTCTTTTGTTTGCAGGAATTTGAGC
TGAGAAAACATGCCAGGCAAGAAGGGCGAAGGTACTGTGATCCTGTTGTATTAACATACC
AAGCTGAGCGGATGCCAGAGCAAATCAGACTGAAAGTGAGCATTTGGGCTTCTTTCTGTC
TGCCCACCCCATCCCTGTTTTTTTTTTTTTTCTAATGTTCTTATAGCTTGAAGCTTCTCA
CCAGGATAATACAGTTAAATGTTTCCGAGAAGCAGCTCACCTCAGTTGTATTTCATTAAA
GACTGCCTGTGGAGCAGGTATGGAAATAGCTTAGATTTCTTAGATTTCCCCCACAAAGTT
GATGAAATGCTACTGAAAAGAGCTCATGTACCTGTTAGTTATTTTTATGTTTCCCAGCTT
GGGGTTTCCCTAGCCTCATTTTCTGCTGTTTGTCTTTTTAGTGCTAGTTGTTTACTGTCC
TAACAGGGTAGTGAGAAATCCAGTAACTTTTGCCAGCTTCAAAGGAGAATTACACTGGCA
TAGTCCAATTTGAGGCATTTTCCAGCAAAAAAAATAAATATATAAATGAAGGTGTTTGTG
ACAGGATTCAGGGTAACGAGCAGTGCTCTTTCTGAACTCTTCTGCCTGTGCGAACATTCA
TGCTGTTGTTTTTCATATTGTAATGAACTGTCTGGTGTGGGTCTTCTCAGAACCACTGTG
ATACTCCCATGAAAATTTTCCACTTTTCAAAAAAAGCTTCCTTTGATTGTGGAGCGAATA
TTCTTAAAATAGGCTTTCTTCTTCCAAGGTTGGTGGTGTGGACCCAAAACAGCTGGCTGT
TTATGAAGAGTTTGCACGCAATGTGCCTGGCTTTTTGCCTACAAATGACTTAAGTCAGCC
CACAGGATTTTTAGCTCAGCCCATGAAGGTAAATACTTGCCTTGGATTAAGTGTTTTATA
GTTTAATTGGAATGTTTTACCAGTTAATGTATTATTTGTTTTCAGGGACTTTAAGCTACA
AGGGAAAAAAAACATACCCACAGTTGTTGAGTGTAGTTATTCTTTGTATCAGATCAGCAC
GACAGACAGTGGGTTTTTTTTTTTTTTTTTTAATAAATCCATGAGGTTGATTTAACTCTT
CTGTTTGGCCTAATTAGAGGAATTTATATGGCATCCTCATGGTCCCCCCCCCCCCCTTTT
TATTTTACACAAAGAATTTTGGGGAAAAAAGTTTCCTCCCAGCCATTCAAGAGTAAATTG
ATGACCTGGTGCCCTATCACCCCTGAGTCCTTTGGTCTGTGCTGTCTTTCCTACAAAGAC
ATTCTCCTACTTAACCACAGTAAACCACTGAAATCAGGAAATTAGCACAGTACATTACTA
CCATCTTTTTTTTTTAATCCTTAGTTAGATCTCATTCAGATTTCGCCAGTAATGACTTTT
ATAGTAAAAAGACGTAGTTCAGAACCATGCGTTAATTTACTTGTCATATTTTTAAATCTC
CCTCAATTTTTCATGACCCTGACACTTGAAGCTTATGGATAGATGAGTTATTTTCTAGAA
CAGCCTGATGTGTTTGTCTGATTTTTTTCACATGACCGGAGTCAAGTAATGCATCTTTGA
TGGTAATATCACGGAAGAGATGCTGCTGTGTTCTTATTATATCAGGCTTTGGCAGTGGAA
CTGAGTACTGTACTTTCCATGGTTTGGAATATTGTAAGTTGTAAAGGGCTTACATAGTGC
CACAAATGCCCTCAGTCTGTTTCACTAGTGATGGTGCTCTTTTTAGTCACTTGATTACGG
CGGTGTCTTCCAGGCTTCCCATTGTCATGTGAAACCCTCCTTTCCCCCATGCCTGCCTTC
CACTGCCTCACCTAATGGTGTTAAGGCTGAATAGTTCAGGGAGGAGTATGGAAGAACCAC
ATCATGTTTTGATGAAAAAAGTAAATACGAAGGTAAACAAACCAATAGGCATGTGCCAAT
TAAAAAAACATTAAAATTTTTTTTTTTTTGCTTATCTCTTTTTATTGTCATCCTTCTCAA
AAATAGCAAGCTTGGGCAACAGATGATGTAGCTCAGATTTATGATAAGTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGCTGTGA
TGTTCCATATACAAAAATTTTAGATGTTTTAAATGAAATCTCTCTGTTTTCTAGGCTTTG
AGACCAAAGTCTGAATTTAACGGACTACCTGTGTTTATTTCTGATTGTTTTGAAACTTTT
ATACTGATTTGCACGTGGCTCTGAAGGTGTTCTTAATTTGTGCTAACTCTGTATGGAATA
AAATGGGCCCTTTGTTTTATCTGATACAGTATGGTTAAGCCTATATAAATACAAAAATAC
TGACTTTTTCTAGGTGCCTAATTGAGTGTCGGGATGAATATAAATATAATGTGGAGGCTG
TGGAGTTGCTGATTCGGAATCATCTGGTTAATATGCAGCAGTATGACCTTCACCTAGCTC
AGGTATGAAAAGAATTTACTTAAAAAGAAATAGGGACTCTCTTAGTTGGGAAGTATGTTA
GCTGTAAGTATTGCCATTCTTACATTGTGCTTTCTGTATTGCCAGTCAATGGAGAATGGT
TTAAACTACATGGCGGTGGCATTTGCTATGCAATTGGTAAAAATCCTGCTGGTGGATGAA
AGGAGTGTTGCCCATGTTACTGAGGCAGATCTGTTCCACACCATCGAAACCCTTATGAGG
ATTAATGCTCACTCCAGAGGCAATGCTCCAGAAGGGTGAGGATGAAATCCCTGTGTGTTC
AGCAGTCTCCTGAAATGAAAGTACAGACTTACTAACATTTCCTGTTATAACTGCTTTATC
TACACCATATGGGAAGCTTTAGTGAGGCCTAATATTGCCCCTTGAAGTATGAAAGCTTAA
CTAACTGCCCCAGCTACCCGATGTAGAGCGATGCATGCAGTATTGCATACTCTGACTTGG
TGTCTAAGCCCTGTGTTTAAGCCCTGGCTTGGCCACTTAAAGTTTCTGTGATTTTAGGCA
AGTGACTTATCCTCCCTATACCTCAGTTTCTTGTATAAATTGGAAAAAAATACTTCTGTT
GAGAATTAAGAGAAATAACTTTTAAGAAATCAACAGCACATAGCAGGCATGCAGTGACAT
TTCTTGACTCTAAACATCACCTTCATTTCAACAGGCAAATTTTTTTGTCTAGAAGTGGCT
TAACTGAGGTCAGTTATTTGCATAATATTCTCATAAGTAAGCAGACATGAAGAGACCATG
AAAGCAGCAAAGCACAAGGATAAACCCCTTGCCAATGAGTCGATTCTGACTCATAGGACC
TTATGTGACAGGTAATAACTGTCCCATAGGGTTTCCAAGGCTGTAACATTTATGGAAGCA
GGCTGCCACATCTTTCTCTTATGGAGCAGCTGGTGGGTTCAAACTGCCAACCTTTTGGTT
AGCAGGTACGCGCTTAACCGCTGTGTCACCAGAGTTTCTTAAGCACAAGGATAGTTTTGT
GTAAACATGGAAATGGTAAAGTAAAATGATTATCATTTTGAGGTTTCTGTTATATAAAGA
AATTGACCTACTGTATGTCTGTGAAATCACAACCATGAGTAGACTGATTTTCACTCTGTA
TTTATTGTACTAGATTGCCCCAGCTGATGGAAGTAGTGCGATCCAACTATGAAGCAATGA
TTGATCGTGCTCATGGAGGGCCTAACTTTATGATGCATTCTGGGATCTCTCAAGCCTCAG
AGTACGATGATCCTCCAGGCCTGAGGGAAAAGGCAGAGTATCTTCTAAGGGAATGGGTGA
ATCTCTACCATTCAGCAGCAGCTGGCCGTGACAGTACCAAAGCTTTCTCTGCGTTTGTTG
GACAGGTAGAGCTTTTGGAAAGAAAGGTGCTTTTTATTCAACATAAGTAGGGTGTGATGC
CTCCAGTATTAAAGCTCAGTATTATATACCTGTGGTCAGACAGTTACCTCCATACTCATG
CAAACCAAAAGTGTCATCATCCTTTCTCTGTTAAATTGATCCAGCCTATTTGTTTTCTCA
TTGTTGATTACTAAGCAGTAAAATCGGTATTCCCCATCCATTATAGTTATATTTATCCCA
TCTGTGTTTTTTCTTTCCAGCTGTCACAGCTTCAAAATACAATGGATAATGAATAATGAA
ATTACCAAATGAATGTAGTAATTTTACTAGCTTGATACCCAGTAGGGATAGGGTTATGGG
CTAATCAATAAGAAATCTTCTCACAGTCAAAACAAAACAAGCAAACAAAAAGAGTGAAAT
ATTTAAATGATGGAGCATTTTATTTTATTTTCTAAATTATGTAGCTTATCTACTTAAAGG
AAACCCTGGTGGCGTAGTGGTTAAGAGCTACGGCGTGGACCAAAAAGGTCGGCAGTTCGA
ATCCACCAGGCACTCCTTGGAAACCCTGTAGGGTGGTCTACTCTTTCCTATAGGGTCCTA
TGAGTCAGAATCGACTTAATGGCAGTGGTTTGGGGTTTTTTTTTTCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACTGGCTGCCTCCAGGCACTGTG
AGGGACTAAGGCCAGTAAGTCAGTGTGTCCTGATCATAATGTCACTTGATGGGAACGGCA
CTCTTCCTGAACTGGCCTTACAGTCTCTTCAGTAGCACTGTTACATTTGTTGAGGGGAGG
GAGATATCTGCTTATTTTTTCAGATTGACCATCAGATATCTCCAGACAGACACCAAAAGC
TTAGGTGTGCCACCAAAGAAAGATTACAGATTAGGTCCAATTTCAGATAAATGACAATTG
AATGGGAAGAGATGATTGGAATTTAAAATTTAAATCAGATTTACTTTTCAAAGATGAATG
CTACTTAGTAAGTCATACTAAGTAAAGCTGTCCCCTAAAAGAATCCAGGGAAGTACAAAA
CACACACTGTCAAAAAGCTAATGTCTATAGTTTGATTTCTGATTTGGATGGAAGAAATTG
TGAAATCAATTGGTTTTTGTGAGCATTTATATTTCATGGGTATGGATGTGGCACCTGTCT
CAGCTCTTCTTGCTGGCTTATTTGCTCTCATGCTTTCTCTCTGTGTGAAAAAGATAACGT
GTTATTCTTCTCTGTTGCCCTTTGCAAAAGCTCTTTTGGGAATTTGTTTTCTTTCTTGTT
GGAGTCCTGATTCCTTCCTCTCCGTTAATTTTTTTTTAGATTGCCTACTAATTCAGCTGT
TTCCTTGCTTATCAAGGGACAGTTAAATCGTTTTACAATTTTTAAGATAACGCTCTGGAT
TTCTTTTCTGGGCTTGGTTTCTTTGCTTAGTAAGTGCCGACTGCCATCTCCCTCTGCAGG
CTTAACAATTGTTTCACCTTTTTTTTTTTTTTTCAGTGTGGGGGTGTATTAGCCAAGTAA
CTTTCCTGCTCAAGTTTACTTTTAGATCAAATGTCATATAATTTGTAGACACTCATTTTA
AATAAACTCGCCCTCTCAACTTTATTTAAAATTAATGTAACAATTTATTGCATTAAAATA
GCTGGATATGATCTGTGGGTATTTTTATTTAGTGCCTACATCTTGTATAAATTATTATTT
GATTTTGAGGGTTAAGCTAGTTAGAGTTCCAAAAATTTCCACCCAGTTTTATTATCGGTT
GAGTCAGTTGGTGAAAATTATCTTAAGTTCTGTGAGACAGTAAAATGTATGTAATGTAGT
TTCCTTCTTGTGGGAAAGACACATTGTCCAGGATGTCTTAATGTGACCTAGTGGGTTACT
GTAAGTCGGTTTAACTCATACAGTTTAATTTCTGAATTGTTTGGCTATGGACTCCTGTTC
AAAATTGCCATGTTTTTATCTTTTTCTCATTTTCCATCTTCTCTATTCTCCATTAAATTT
AAAAAAAGAGGAACTCTGTACAGCTCCTTAGTGGGGAAGTCATTCTACTAATGACATCTT
TTTTACAAAGTGAGAATTATAAATGTGAATAGAAACACGTAGAGAATACCTCTTAAGCAT
GAATATCAAAGCTGTAAGAATTTTATTCATGTGTATTATCTCATTGACTCTCTTTTATGT
TATGTTCCCATGGTAGATGCACCAGCAAGGAATCCTGAAGACTGATGACCTCATAACAAG
GTTCTTTCGTCTGTGTACAGAAATGTGTGTTGAAATCAGTTACCGCGCTCAGGCTGAGCA
GCAGCACAATCCTGCTGCCAATCCCACCATGATCCGAGCCAAGTGCTATCACAACCTGGA
TGCCTTTGTCCGACTCATTGCACTGCTAGTGAAGCACTCAGGGGAGGCCACCAACACTGT
CACAAAGATCAATCTGCTGAACAAGGTCTGAAATCCTTTGTTTCCTTAGTCACAGTACAC
TTGAAGTCTGTATCAGTGGTTCTCAACCCTACCCAGGCCCAAGCCCCTCCCAGAAACATT
TTGTAGCATCCCCTTTTCTGTCCTGAAATTAAATTTATAGATAATATGCAAACATAACTA
CCAAGTTTAAGAAAAATAGTGCCTTAACTGAAATACAAAAATAAAAACAAAATAATTCAT
AATGTGTTTCAGTGTGTTAATGTTAGTTTATGAGTACACTTGAAGACGTTCAGTTAGTAC
GTGGTTTGTCACCTGTACACAGATAAGCTGGGAATGGGATGGCTAGAACTGTCCACCAAT
ACCAGTAGATTGGCGTGAGTGACATTGTAGTTGTTGACTTGAAATTTCTGAAAGGGAACA
AAGTACAGTTTTCTCTTAATTTACACACTATTTGCAATCCTAGAAAATTTGAATATGTTA
AAACAATGAAAAGTGTGTAAAAATGCACTTAGATTTTGGAATCAGGTAATTATAAATGGG
CTTATAACCATTTGTCACTTGTCAACTTCATGTCAGACCAGAAAAATAAGATAATTCGAT
TGTGGTAGCATGGTAAAATGTGAAGGACCATTGTTGATTTCTAGAACTTTAGAAAAACCA
GTGGACGTTTATGGAGACATTTGTCTGGTCCAAGGACATTAAAATTCAAAGTAAACATTG
CAGGCCAAATCAGATCAACGTTTGGTCCCTTTGGTCGCCAGTGTACAGTTTTTTATTCAA
CTGGTATGTACTGTTTAATGTGGGGCGTAGGAACGCAGGGTAAAAAGCGTGACTTGACTG
TGTTAAGTGAATTATCTTCATGACTATAAGCTAAAATTATTGTGGTCTACAGGTTCTTGG
TATAGTAGTGGGAGTTCTTCTACAGGATCATGATGTTCGGCAAAGTGAATTTCAGCAGCT
TCCCTACCATCGAATCTTTATTATGCTGCTCTTGGAACTCAATGCACCGGAGCATGTTTT
GGAAACCATTAATTTCCAGACACTTACAGCTTTCTGGTGAGTATTGTTGGTTTTGATAGA
GATTTCCTTTTAAGGGTTACTGGTTTAGTGTAATAAAATTTGAGAAATAGAACTCTTGTG
GATTTGAGGCATATTGATTTGTACGACAGCTTGCATGTTGTCTACTTACATTGCATTCAT
TCAAGTTATATTTAAGTTGAACGGTGCTTCTGACTAAGGGTTTGTTTGTTTTTCTTTCAG
CAATACATTCCACATCTTGAGGCCTACAAAAGCTCCTGGTTTTGTGTATGCCTGGCTTGA
ACTAATCTCCCACCGGATATTTATTGCGAGAATGCTAGCACATACACCACAGCAGAAGGT
GTGGCTGCAGTTTATCTCCTACTGATGAAGACTTATAACTAGCTGGGGCTTGTTAGCACT
GCCTGCAGATTTCTCTTAGTCATTTAGTAGCGATTGTTAACTTCTTCCGAGCTTAGTTAG
GAATTCTTCTATTTAATACTGAGTCAGGTGACGGAGAAAAGCTTAAACAAATACAGGTAG
TCCCTGACTTATGACGTATTTGAGTTACGCTGAACCATACTTAACCATCTTTTTTTTTTT
TCTGTACCTCTTATCATTAGTAATACGTTGCAGCACTCAATTTGCTGATGTTACCATTCT
CAGATGTTTAATTTTATGATTTACTGTTCAGAACACTGCTGGATTTATAAAGATACTGAT
AATAAAAGGCAGTAATTATGAAAACTTAAAAAATATTTGACTTACATCAGAATTGAACCC
TGTTGTAAGCAGGGAACTTACCAGTACTTGACTGCTCTGCCTGAAAGCCATTCCTCAGTG
ATTAAGATGTCACTTTCCAAGTTTGTTATAGGACACCTATGTCAGTCACTTAAGAGTTTT
GTTAAAAAGTTCAAGCCTTTGGGTGCTTTCTTAGACACCTGAAATAAGTATCTGAGAAAT
GAGGTCCTGGAACCTGCTGGTTTTTTACAGGGGATCCCTGATGCCAAAGGCTTTCTAACA
GTAAGTTGAGAGTCACTGGGCTGCTTTGTTTGAAGAAATTAGGATCAAGTTCTTAGTCTT
TTTGGGAGTACAGCACAGTTAATATGAGAAGTTTCTCTCCAGTCTTGAAATAGCAAATGA
GTAGAAAGTACCCTGATTTGGCCCTTTAGATTAGAGCCCTGGTAGCACAGTTGTTTAAAG
CTGTGGCTGCTAACCAAAAGATTGACAGTTCGAACTCAGCAGCCACTCATTGGAAAACCT
GTGGGGCAGTTCTACTCTCTTAAAGAGTCGCTATTAGTTGGAATCTACTCAACGGCAATG
GGTTTTATTTTTAATCAGAAGAAAATGTGATTACCATGTGTTGGAGTCGTCTTGGCCAAA
AAAAAAAAACTGGTGAATTAACTCTCAAAGTTATGCCAGAATGAACATAATTGATATGAT
TGGTGAACAGTGAGCAGGCCAAGTTTGGCTGAAAATAGAGTATTCATTTTATAATTTCAT
ATTATAAACTGCTAGGAGTTGGGAGTGGGGAAAAAAATGGCTGAGATCCAGGACTTGATT
AAAAGAAGGAATTAAAAAACAACAACAAAAACCCCAGTTGTTATCAGTCTCTTGGTTTTC
TGTTCTATGTGGAATTTCCTCAGCCCCCTTGCCCCCCCGCCCCCATTTTTTTGTTGTTAA
ATTTTGCTGCAGGCATAAGGATGGACATGGCCTGGAATTTCTGGAGCCAGTTTAAAATAT
CCTATCTCCATAATTATACTCATTCCTTTTTAATGCAAATCAGTCATTAATAGAGGTACT
TTGGTCAGTATTCTCTAGTTACATTCGTATGAAGTAAATAGTAATCAAGTCACAGTGTAG
CTGGTTGGGCAACTTTTTTGATGGCCAAAAACAACAGCTGAGTATAATATGGCTCATGAA
TATTTTTTCCTTTCAGGGATGGCCTATGTATGCACAGCTACTGATTGATTTATTCAAATA
TTTAGCACCTTTCCTTAGAAATGTGGAACTCACCAAACCTATGCAAATCCTCTATAAGGT
AATTAAATTTGAATTTATAAAGTAAAGTAACTTAAGTGAAAAAATTTTGAGAAACTTTTA
ACTGGGAGTTGCAAATTTAATTTTTTGTTTTCATTACTAAGCTTTTTATTAAAGTGTAAC
GAACATTCAGAGAAGTGCAAAAACCAAACATACTTGCATAATCAGTATCCATATAATAGG
GTATCCACGTGCTCAACTTTAGTAGATACTACAGTTCTCCAAAGTGTGTACCAGTTTCAC
ATCCAGCAGCATATGAGTTACTGTTTCTTCATGTCCTTTCCACACTTGTTATTATCTGTT
TTTCATTTAGCCATTCTGGCAGTTATGGATTTAATTTGCACTTCTTAGGTTTTCGTTTTC
CTCCTCTTTAATTTCTGATCTTTTTTCCTACTTCATTTGGTATTCATTAGCTGTTCTTTT
TTTTCCCACTTCTGCTGATAGAAGTGTACATCATTTTTTTTCCTTTTTGTTTTGCCTTTT
CTAGTGTATGCATTTAAGGCTAGAAACTTCGGAAGCCTAAATTTTAATGATTTTTACATG
TAAGTATTTAGATACGTCGAAGCGTAAAGTCTTTGAGTCTATCAAAAGCAAAAGTAAAGA
GTTTTTTTTGAGGGACCGTAACGATTTGAATCAGGTAGCACACAGGAAGAAATTACAGAA
TTCTTTCTGGAGATAAAGTTGAGCTTTTATATACAAAGTCAGGCATGAGTAATCCCACAA
AGGTTTCAGAAACAGCTCTTTCTTCATATCAGTTAATCCTATCTCCTTCCAGAAGACCAT
CAGTATAAAACATTCTTTCCAAGGACATTGCATTTGCCTCGTTTCCTGGAACATTCTAAG
CACTTATGTTGCTTTTTTGTCTTCTCCCCTGCTTACTCAGAGTCATCTGGGTTAATCTGC
TATTGAGAGCCTTGTTGTCACCATTTTGGCCTTGATGCAAGCCTCAGTTTGATATTAGAA
ACTACCTATCATAACCCCCCTTTGATCAAGAATTTCTGTAGAAATTCTTAGATCACAAAA
ACCACTCACTATAAGAACACTTTCTTCTACATGGTATTTTAGTTGTACTGTAACATAGGG
TCACTGTGAGTCCAAATCGGTTCAACAGCAGTGGGTTTTGGTTTTTGTAACATAAATGGC
TGCTTTCGAGCTTTTAAGACCCCAGACACTACTACACTTTTATTCAGTAGCCAGGCACCA
TCTTGTATCTTCACCATGCCATTCATTGCTTAGTCCCTCTGCTTCTCGTGATCTGATGGT
AAGGGGTGCATGGAGTAGACAGGCTGAAATTTTTGGAGCAACATCTCAGCAATATAAAAG
GTGAGAGTGCTAGAGCATAAGCTTGGAAGTTCCAGAAACTTGAATTTCCTCAAGATACAT
AATTCTTTGCATAACTTTGCGTCTGGCAGTATGACTGCAAAAGTTACATACCTAATCCCT
AATACATTTAACAAGTCCTGTAACTAACATTATAATGTCAAAAGAATTCATCCAGTCTGT
AATAATCATATTCAATAAACACTGCTTTTGGGTAACCAACTAAAGATACCAAAAAAGGAG
AAGACATTACTAGAAAGAGAAGTATAAAACTTAAATGGACTTTCATGTTGAATAAAATTA
CTAAGGAACGAGACCAGAAGTATGGAGTAATGCCGACAGCATAAGGATAGCTACAGTTAT
AAAGCAAAGTCCAAAAGTTCAGCAAGATGCATGGAGTCTTGTTCTGTGATCTTGGGATTA
CCTGTCTACATCAAATGTCATCTGCTTCTAGCCTCCAGAGCATCTCAGGGTGGTTTTTAG
TTCCATGGAGGACTGGTTGGTCTACAGAGGCAGCTTGGCCTTCTTCAGTTTTGATAGATG
GATTCAGGGTTTGACTCCTACTTTTGATGGCCCACAGGTTGGTGAGGAGGACTAGGTATG
GTCCTTTTCAGTGGGGTTCTAATGGGTCCTTTAATTAGTGTGTTTTCTAATATATGTGTG
GGTGTGTGTGTGTGTATATATACATATACTCTCCCAGGGTAAGGTTAGGCAGATTTTGCA
AGTCTGGATTTTGGTCATCAAGGCTTCTTTAAGCTGTGACCGTATTTTAACAGTTCAGGT
TGAACAATGTGTTGTCAGTATGGGCAAAATAAGGGAGGACCATGGGCTTTCCAGTAATTA
TTCCATAAAATAGAACATTAAACATCAGCAGTATTCTCATAGAAACCTTATAGTAATTCT
TTTAGTTCACTCAGTTGTATGTAGTTAATTTTGGTTCCATGCAATTCGGGATCAGTAGCA
GGCTGAAAATCCTGTCAGCTTCTATATTAGAGTTCCAGAAATATTTAGTTTATTTTTGTT
GAAATATTTTAGTAAAACATTTTCAGGAAATTGGCAAAGTAAAACTTAGCTGCAGATGTC
AACTTTAAAATGTCTGTGGTTAACTTATAACAACAATAATCCTTAAAGGTGAAAAGACCT
GATGGGAATTAACTACAAAAGTAATGCAAATCTAAATAAAGTCAATTTTAAAAAATTAGA
CAAAAATGTCTCTAAACATGGTAATTAACCTTATTTTGAAAGCACTTCAGATAGAATAAT
ACTAAATAGTATATACTGAAATTATCAAGTCTCTAGACATTTTGAATAGTAGTAAAAACT
TTACAGGTAAACTGTGAATTCTACAGTTAATACCACTGGCCTAGATAATGCTACTTTTTA
AATTAAAGAAATAGTTTCCAAGTCATTACTTTAAAAAAAAAAAGACTGCAATTATGACTA
TACTTTTTCTAATATAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTTAACAAAACCCATCT
CGCATACTCAGTCTATCCTAGTTAGCAAAAAGATCTGGAAACTGTTTTTAAGCTGACATA
CTACTCTAAAACATATAAACTTTTGTCGGAACAAATTTACTTGCATTAGTTTCTGGGAAT
AGTAGGAGTATTGAACTTATATAAGCAATTATTTATAAACCTTTAAATAAAAGCTCTTTA
AAGGGTTATTATAATCTAAGTTAATAATACCATCCGGAGGTAGGAAATTATTATATTTTC
ATAATCCTGTCATTGGCACGCTTTATAGGATCCTTTAGAGAAAAAAAATTAGAATTATTT
GTCCTTTTTTAAGGCTTTGTTTTATCAGTCAAAATAATCTATCCTTTTTCAGTGTACTTT
TCAAATAGACTGACTTATATCAAAGTTTCTCAGCTACTAAAAGCCCAGGTGCAAGACGTA
GTTTTCTTGGAAGAGGTAAGAACTGAGCTTTTAAATCGCTCCGTGAAAAACACCAGCCAT
GGCCTTCAACCTGATACAGAAACTCAGATACCGAGCTCTAGACTAGAGGCAGACTTTCAG
AACAAAATGAAACAGAAAAACTACATAAACTCACTGATCTGTGAGTCCAGCTCAGAAACC
AGGTTTATACAATACTACATACATCCCAACCTAGTTTCTTAAAAATGTATACAGGTTTCC
CTCGCTATCTGAAAGTAGAGCCGTCCTGTGAAATCTTTCTTAAGCAGAACTGGCATAAAG
CAAAAGAAGCAGTTACCATTAATTTATATGGGAAACATTTTTTAGTATTCCAGACCCAAA
AATAACCTACCAAATCATACCAGGTAACACATATAGTAAAAGCTGAGATGCTGCCTGTAG
TTCCCGGGAAGGAGCTTGGTACCACTCTTGATCAGGGTGCACGCTACCTCCAAACGACTC
ACTGCAAAACAAACACTGAACGCTATTTCTGCCTTTTTTCGTAAAAGCGAAAATCCTCTT
CGAAGTTCCTTTGGTTAGAACAGGTACTAATGTCGGTCTTGTAAAAGTGAAGTGGCATAA
AGCGAACTTTCAAAAAGCGGGGGATACCTGTATAGCAATTTTTGGATGAGACTGATTAGA
AAAACACATTAATTTTGCCAGAGCCTCAGGTGGAGAGATTTTATTCAGACCATTTGATTA
AAGCTGATCATTAAAATTCTCTGACGACAGCACAAATGCAGACTCATTGAACCTTAATTG
TAACATGGGGCCTTTGGTCCTCCCTGGTGACAGAAGCACCTAGGCTTAATCCTCAGTCTT
ATTTCTGAAAGTCATAAGGTCTGGACAAAGTTGGCAGAACCGTCGGTCATTTGTGGAGCC
ACACCTCCACCATTTCAAGTGCAAGTAGCACAGGTCCAGCCTGATTGCCTGGCAACAAGA
AGACAATCCTCCCATTTTAATTTTCCTATTATCATTGCAGCTGCGGCTATGTTGCTGTTT
GGCTATCTTAACAGGGACAGTTATCAGCACATTCTAGAGAGAGCCTCCTAAGGTCTCTTC
AGGGCTGCTCGACACTGCTATTTTGAAGCATTTTTTTCTTTGTTTCTCTTTCTTTGCACT
GGGTGTTCTCAGTGCTGGGGACCTAGAAAGCTCTTATATGGGAGTCTAAATTTTCCCAGT
TTTGTGAGCCTTCCATTTCTTGTTTGTTTGTGGTTTTTCATTCTCAAATTAGAGGCACCT
CCCTCTTTTTGATAGCATTGGTGGAGGTCTGCGTTAAGGATGGGTTTTATGTGTGTGTGT
GTGTGGCTTACGGAGTCTGGGGTTCCCTTGGGAACAAAGTTGAAACTCCAGGCAATCAAC
TTAGATCCTCCAATGATGAGGGAGTCAGTCTCTGCAGAAACAAATCCAAACAGACTTGTA
GAAATACAGAGTGGAACTAAATTCACTTACGTGTATGAAGGCACCAGATCCTTCAATAAG
ACTCAGGGGCTTTTTTTACTCAAAAAGAAGTGGAGCTCAAATTCAAGAGGTTATTTATCT
GGGGATGACTCCTGAGATGCTGTGGAGACAGTGAGCCCCAAAATGGTTCTGTTGGCACTG
TAGCCCGGTCCTCAGTTCTTTGGGATCACTGACAGTAATGCACCTTCAAATCCCACAACT
CTGATACCATAAATAACAAAAGTCTCTGAGTCTATTGAAAGCAAAAGTAAAGAGTTTTAT
TGGGAATGTAACAATTTGAATTGGGGTAGGAAGAATTACAAAAAGCTCCTTTCTGAACAT
TTTATACACAAAGTTAGGCATGACTAATCCCACAGACATTTCAAAAATAGCCTTTTCTTC
TTATCAGTTAATCCTATCTCCTTCCAGAAGACCGTCTGTGCAAAACATTCCTTCTGAAGA
CCTTGCACTTGCGTTCTGTTTCCTGGAACATTCTAAGCACATACATTACTTTGCTGTCTT
CCTCCTCTGCTTACTTAGAGTGATCTGGATTAACCTTTTATTGAGAGCCTAGTCGGCCAT
CTTGGCCTTGCTAAGAGCCTCAATTTGATTTTAGGAACTCCAAGGTCCAGATAAATCATC
TGTGATAGTGTTGGTTAAACCCTATCGCGTTTTTTTTGTTATTGAAGTATAATTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATAGAAAGCACTCTGCAATGCATCTGC
TACCCATGACTGGTGGGAAAAGACACACACGTACCAATCATGGCGCTCAAGAACCCTCCC
CCCCCCCAGTTTTGTGATAACCATGTATTCCCACATAGTATTTCTCAAAGTCCATATTGC
CAACCAAAAATGTAAAGATACTCCATGACTGAGCATGCTTCCATTAATGAAAACACATGG
CATTTAAAAAACAAAAAAGCAGAAAATGATAGAGCCTTGAAAGGTTTTGTATTTCTTGAA
CTAAATTTTTCGGCTGTGTTTTCCACAGAAAGCACTTATTATGTGAATTATACAATCCTG
TGTGTGGTCCAGCTGTGTGTTAGCGTTTCAACCTAATTGCCATGCTTTGATTTAAAACAT
ACTGTCAACTCCAGTGGTTGGATGGGATTAAATGGACTATAAATTTTACTGGTTCAGTTC
ATCAGAAACAGTGCTGTAGTCTTGGGAGAGGCATCCAGGGAATGGACTCTCTGATTTTCT
CTTAGGAATAAACCACTGACAGTCATTGCCTTCTCTTCCCCAAGATTTTTCTAAATAAGT
GGATTCTGATTTAATTTGCTGTGTGGAATGACTTGAAGTTGTCCAGTCTTCCCATACCAC
GCCATCACAACTTTCTCCCTCTCTAGGTCTTTAAAAATTGGGATTGTGCCATATGTTGAC
CTCACAAACGTTATAGTAAAGTTGTGGCATGTGTACAGTGATAGTACCTATTATATTAAA
GCTTTGGCTTCCTGAGGAAAATCCTGATTCTGTTAGGCTGTAACNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCCC
ACCCATCTATAAGTTATTAGTATGTTTTTTATTTGCTTACTGTATCCTAGCTTCTTGCTT
TGTTTTGTTTCAATATGCCCAGATAGGTTGTTTGAGTGAGCTAGGTTGATTATTTTTGCC
TTTGAAGCTCTGACATCCTGTCACTGGATGGCTAGAGCTGTTATCAGGTCACTTCCCTTG
CATGGATTCAGCTCAGTCTCCATGTCGTTGGTCATCAAGTGTGTGGCACAGGCTCTGTCC
TACAGTCTTAGAGGGGCACGGGTGATTGGTGTAGGTTAGAGGTACCTGGTTGCAGCAGTC
TGAACCAAGGCAGGGAGCTGACAACCGTCCCCTGAGTTTCTGGAAGGAAAGTGTGTCCAT
CTTCCATAACGCACACAGGTGGATGGGTTCTGCTGATGGACTGTGGGCATCCAGTGCTTT
TGGTTGTGAGGCCTGGGAGGTACTAGTTATCCTTGGACATCTGTCGCTGGTGGCTGGGTG
ACCTGAGTAGAGCCACCAGTCCTCAGGCCCCTGATGTGGGCAGGTGAGGACCCCATTTAA
TAGGCAAAGTGGTGTCAGACATCAAACACCCACCGCTCCACTGTACAGCTGAAACAGTTG
CAGGCTGCCAGCAATGGTCTGTTCCCCTGAAATAGGCCCACAGAGGCCTGTACAGGGGGG
AAAGTTACTGAAAGTCTATGGATCGTTTATGCCTGGACAGGAGCTGCTTTTGTCCTGAGC
TCCACAGGGTAGTGGAGCTGGGAGATTATCTTTTCCCCCAACTGTGAATTTATTCCTTCT
CCAGGGCCAGGAGAATGGCTCAGGATGCTCAGCAGGACCTATCTCAGGCCCAGGGAAATA
ACAGCCACTGAAGGTGGCTTGATGGTGGGGGGCATGGTCAAATATAAGCAAGTACTTAGC
GTTTGCCCAGAGTGCCATTCTTCTCTGGTTCCGGAGGTGTGAGCAGGCTGTGTGGCTTGC
TGTGTCTCCCTGAGGAAACTGTGGCCCAACGCTACCACCAGCCCTGCTACAATTGCTCCA
GGAAATAGTGCCTGAGGGTTCCCAGTGATTCAGGTCTGGCAACTTCTCTCCGCTTCTGTA
CTGTCTGTCCCTCCCCCTGCTGCTCAGTCTGTTTTCTGACATTGTCTTTGATGTTCAGGG
CTCCTAGCTTGTCATAAATATAATCATTTCACTTGTTTTTTCCGGCCTTTATTGTAAGAG
GGATTACTGGAAGGGTCTGATTTATGCACCAACTTGGCCCTTCCTTTGCATCCTTTTTTT
AGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTTGCTGGCTTATTTGCTCTCATGCTTTCTCTCTGTGTGAAAAAGA
TAACGTGTTATTCTTCTCTGTTGCCCTTTGCAAAAGCTCTTTTGGGAATTTGTTTTCTTT
CTTGTTGGAGTCCTGATTCCTTCCTCTCCGTTAATTTTTTTTTAGATTGCCTACTAATTC
AGCTGTTTCCTTGCTTATCAAGGGACAGTTAAATCGTTTTACAATTTTTAAGATAACGCT
CTGGATTTCTTTTCTGGGCTTGGTTTCTTTGCTTAGTAAGTGCCGACTGCCATCTCCCTC
TGCAGGCTTAACAATTGTTTCACCTTTTTTTTTTTTTTTCAGTGTGGGGGTGTATTAGCC
AAGTAACTTTCCTGCTCAAGTTTACTTTTAGATCAAATGTCATATAATTTGTAGACACTC
ATTTTAAATAAACTCGCCCTCTCAACTTTATTTAAAATTAATGTAACAATTTATTGCATT
AAAATAGCTGGATATGATCTGTGGGTATTTTTATTTAGTGCCTACATCTTGTATAAATTA
TTATTTGATTTTGAGGGTTAAGCTAGTTAGAGTTCCAAAAATTTCCACCCAGTTTTATTA
TCGGTTGAGTCAGTTGGTGAAAATTATCTTAAGTTCTGTGAGACAGTAAAATGTATGTAA
TGTAGTTTCCTTCTTGTGGGAAAGACACATTGTCCTTCAATGTCTTAATGTGACCTAGTG
GGTTACTGTAAGTCGGTTAACTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGCCCTCCTAATTCCCACACTTCGATACCATAAATAACAAAAG
TCTTGAGTCTATGAAAGCAAAAGTAAGATTTTTATTGGATGTAACAATTTGAATTGGTAT
GAAGATTTTACAAAAGCTTCCTTTCTGAACATTTTATACACAAAGTTAGGCATGACTAAT
CCCACAGACATTTCAAAAATAGCCTTTTCTTCTTATCAGTTAATCCTATCTCCTTCCAGA
AGACCGTCTGTGCAAAACATTCCTTCTGAAGACCTTGCACTTGCGTTCTGTTTCCTGGAA
CATTCTAAGCACATACATTACTTTGCTGTCTTCCTCCTCTGCTTACTTAGAGTGATCTGG
ATTAACCTTTTATTGAGAGCCTAGTCGGCCATCTTGGCCTTGCTAAGAGCCTCAATTTGA
TTTTAGGAACTCCTTATCAAGATAAATCATCTGTGATAGTGTTGGTTAAAACCTGTAACA
GTTTTTTTTGTTATTGAAGTATACTTTGCCTTTTTTATTTGAGTCAAATTCATAATAGGA
AAAACTTTACTCCTGTTTTATTAGTGTGGAAACAGCTAATATTTTTCTTTTTCTTTTTTT
AAAAACAGGGCACTTTAAGAGTGCTGCTGGTTCTTCTGCATGATTTCCCAGAGTTCCTTT
GTGATTACCATTATGGGTTCTGTGATGTGATCCCACCTAATTGTATCCAGCTAAGAAATC
TGATCCTGAGTGCCTTCCCAAGAAACATGAGGCTCCCAGACCCATTCACTCCTAATCTGA
AGGTAAAGATGCAGCTAGCTCAAGGAAGTTTTAATTCCTACTACTTCAGCCCTTTCTTTG
TTAAGTGGGTCCCTTAAATCCCCCTCCCCAATTTTATTTTATTAGATGGTAAGTGTTTTG
TTATGGGGGAGCAATCATGTTTGTTATTTCTACCAGGCATGACATTGCAGCTCCTAAATT
TGGCTCTCAGTATTTATGTAATTGCTGTTTTTATCTTAATCTTTGTCTTAAACTCAGTTA
TATTTATAGAACCTCAGCCTAGCTGTTGGGCCAGGCATTTGCTGAGTGACCTCTGTATGG
CAGAGAGTTGCAGAACAAACAGGCCTTTGTAATACCCCTACATTGCTGTTTCAGAGATGA
TTTTTCAATGCTTGTATTTTATTTAAATTGTTAAAGTAACTGACAGAAGGGACTCCTTAA
AATCAAACTACCCTAACATGGCTACTATAATTTTTAATGTATTTTCTACTCTTTTCTTTC
ACATGAATTTCTTTAAGTACCAAGTATGTGATGTCTTCTTTGTTGTGCTGGGCTTCTTTT
AAAGACTGGGCTCTTGATGAGTAAGAAATCTCATCTTGGACTCCTATTTTGAAATCCTAG
TCTAGAAGAAATAATCAGTTAATGGTGCAAACTAGACCTCTCCAGAAATGATACTTATCC
TACTTTATTTTAGATAAGTAATATATACAGAAGGAGCCCTGGTAGTGCAATGGTTAAGTG
CTCAGCTGCTAACCGAAAGAAAGGTGGGCGTTTTGAACCCACCAGTGGCCCTGTGGGAAA
AAAGACCTGGCAATCTGCTCCCATAAAGATTACAGCCTAGGAAACTCTATGCACCAGTTC
TACTCTGTGATACAGGGTTGTTATGAGTCAGAATCAATGCAACAGCACACAACGACATTA
CATATAGAATGAGAGGTTTCTTTTATTTTCTGTTTAGATTCTTACAGTAATGACAGCCAG
TGCTCCCCCCCCATTAAAAAAATTGAGCTAAAGACATATCGGACCAATAAAAATATGGCT
AACTCTACTCTTAAAGACCTTTGTGATGTGTATAGCTTTAGCGGTAAAAAGAGCACTCTT
ACCACTTCCGGTGAATGCACATTTTGATATCAGCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAACAAATATGGTTCCCATACGAGTCC
CCTTAATACAGGCTCATGTTACATGCTTTTGTTAACCTGTCTTTTTCCTGTTTCGGCACC
TTTTTTGCCAGGCAACATGTTAAATGCTAAGTTCATAAAGATTAATGAATGGGACTGTCT
CTACCTGGTCTGCAGAAAATTCACAGTATAACTTCTATTGTAGGTTGCCTGGTTGAGCTA
CATTTCTTTTGATGCTCTATGTTCATTCTTATATAGTCTTCATTTTAGCACGGATAAACT
TTAGAAAGACAACTACTTTTAACTTTGCCGTGGATTCTTGAGAGGCTGATTAATCTTGAG
TATAAATACTGTGTCCTGTTTGTAGAAGGGATTTGAGACATCTTAAAATCAAGATTGAGA
CCATTAAGTTCAAGAGCCCAGAAATAAAAGGAAGGCAGCCTTTAGGGGAGAAGTGTTGTT
AACACCCACTGTGATAACCTCACAAACGTGAGTAATACCATGTAGAGGCAGCCAAGCCTA
GTTAAGATAGTACATATTTATTCCGATATATTTTAGCCTAATGGTTCTCGATGTGTGGTC
TGAGAACGCTTGGAGGTGTCTCCAAGGCCCTTTTAGGAAGGCTGTGAAGTCACGATATTT
TCATGATGGTGAGACAGCATATTTGCCTTTTTTGCTGCCATGCTATGACAGGTGTTACAG
TGGGGTTCTCCAGAGCTACAGGAAACGTGACACTGCAGCTGAGTGACTGAAGGCAGAAGC
AGAAATGAGAATACAGCTGTATTCTATTAAGCTAGACATTGAAGGAATTCTGCAAAAAGT
CAAACGATGTCACTCATCATGAAAATATTTTTTATTAACTTTTTATATTAACGTAGTGGG
ACCCATTTTTTCTTTAAAATGGAACTTTTTTGAAATCTTAATTCTAATGTGGAAATATAG
AAATATAACCCACAAAAACAAAAAATTCTTTGGGGTCCTGAGACCAAAAATTCGAGAACC
TCTGTTTTAGACCAGAAAAAATTCCTTTGAAAGCCTGTATAGAAATCCAAACCCTAGCCA
GTGAGAACTGTTTGTTGGCCTTTCAAAGGCCTCACTCAGCTGCTTGTTCTTCATTTCTAG
GTCGGTATCTCTTCTTGAATGCAATTGCGAATCAGCTACGGTACCCAAATAGTCACACAC
ATTACTTCAGCTGCACCATGCTGTACCTTTTTGCAGAGGCCAACACTGAAGCTATCCAGG
AACAGATCACAAGGTAAGAGAGAAACTAGTTTAAGTGCTTCTTAAATGGTGTCTTCCCCC
TCCTCCTCCCATTACAAATTGAGTGTTTTTTCCATGCATTCAGTGTTCACTGAGCATCTG
TGTTCAGTAATGTTTGATGTGCAGTATGGTTGTGAATAAAATAAACATGGTTTCTGCTCT
CCTGATTCTTAGTCTGATACTGGACACAAAAAATCACAAATAGAGAATTACAAGTCATGA
TCATTGCTGGAAATACAAAAGTTGACAGTAAAAGGCAGCATATTTTAACTGAGGGCATCA
CTCTGAGGTGGTGGTCAAATTTAATTAACCAGGGTCTCAAATCATGCAGGCTTTTTAAAA
GACTATGTTAGGGATTAAGGAGCTTGGAATTTACCTCATTGCCACTGGGTTAAAGGTTTT
GAAGCAGGAGAACTAAGATCATCATCATATTCATTTACTTAACAGTAGTTAAGAATCTGT
TGCAGATTGCGTTCACAGCATCGGAGATGAGGCAGTGGGTAGACTGTAGTGTGATTACAT
ACAACTATACTTAAAATACTGAGAACATACTTTTGCCCGTGTACTTTCACCTCATATTAG
TACCTGTGGTACTAAGTATGGTATTCCTTGGATTTATGTACCAAAGTTTAACTAGTATTT
TATTATTAGATGTTTAGATGCTAGTGTCCTACCTTTGTGAATATGTATAAAGCTGCAGTG
AACTTCCTTGTACTTAAGTCTTTGTTCATGTGCTTCATTATTTCCTTAGGGTAGATTTTG
AAGTACAGTTGGTAGGTCAAACAATGTATTGCCACTCAGAAAATTTACACTGGTTTTCAT
AGGCACTAGCAGTGTTTGAATTCTTGTTTCCTATTTCCTCACTTTTATTGGGTATTCATT
CTTTTAAGTGATTACTTTCTATATGCTGTGCATGTACTTGGTGGGTTTTTTTCTCTCCAT
CTCATTCTCAACCACTCTGAGAGACAGATAAGTTATCCTCACCTTATGCTAGTAGTCTTC
TAGGTTTCCATAAGGGAAAAGCCAGGATTGAAACACAGGTGTTCTAATTTCACAATCTGT
CTACATTAACCATGCCGTGTATAGAAATTAATCCACTGTCTTTAGTAAAAGCAAGCAGCT
TTTGCATGTGGTTTTATAATCAGGGATGAGTTAGGAAAAAAGCAGTAGAGGAGTGGTCAT
GAATTTGTATGTCTCTCTGTGCATTAACTTTTTCTCTCCCTTCTCCAGGGTTCTCTTGGA
ACGGTTGATTGTAAATAGGCCACATCCTTGGGGTCTTCTCATTACTTTCATTGAGCTGAT
TAAAAATCCAGCGTTTAAGTTCTGGAACCACGAGTTTGTACACTGTGCCCCAGAAATTGA
AAAGTGAGTTACAAGTTAATTATGTAGGAATGGGACAGGAAAATGAGGTTCATTCGCTGT
CTCCAGCTTGGGTTGGTGATGAAGGCAATAGTTAAGGCAGATGGGAAGCTAGATAGGAAG
TACGTATTGCTAGGTCTGAAGTTTTCTCACAAATAAAATTTTGTCTCCACTTTTCAGGTT
ATTCCAGTCGGTCGCACAGTGCTGTATGGGACAGAAGCAAGCTCAGCAAGTAATGGAAGG
GACAGGTGCCAGTTAGATGGAACTGCATCTCTGTTGTAAGCTTGTCAGCCAGGAGGGCCC
ATCGCACCGAGTTTATAAACTGACGGAAGAATCCTCTGGGTCCTCCTGACTTTTCCAGCC
CTTTGGTTCTCGGGTATCTGGCCCCTGTACTGTTGGGGTCAGCCTCCTGTCTATGTGGGC
ACGTTCCAAAGTTTAAATGCATTTTTTTGACTCTTGGCCAAAATTTAGAAGATGCTGTGA
ATATCATTTTGAACTTGTGTAAATATATGAAACAGAAAACCTTTGTCTGGAACTTCTTGG
GTTTGTGCAAAACGTGTCCAAGGCAAGTGGATAAACTGGTACCTACCCAGCATACAACAG
AGGCAGCTGCTGATGCCGTGCACTTGTCTGGGGACATAGCTCCGTGTCTCCTGACGTTCC
TGGTATCCCAAAGAATAACGAAAAGCCAGTTTAAATATTACGTAACTTATTTTTTTTTTT
AATGTGGACAGGGGAGCTTGAAGACAACCACGGTGTTGAAAATGTGGACATGCAGGAATT
TGGTATGCCAGGGAATGTGGTGAGGGGCTCAAGATTAAGGTGCTGTGGTTTTTTGTTTGG
CCTCTTCCCTGGCCCCAATCTAAAACTGACTGTGCAGGGAGAGCAACAGTTTTACCAGCT
TCTTGTCTTTCCTGGAGAGGATACCCCTTGAGCCTTTGAAATAGTTCTTTTTATAAAGGG
AAACTGGACCAGGTGTAAAGCTCCCCCTTCTTTCCTAATACTTGTAAATTATGGGGGAAA
GAAAGGGAACCAGACCGTATGAACTGCCTTTCCCCATTACCACTGAATGGCCATATGAGT
TTAACAACAAAAAAGTAAAAAGGACCAATACAGCTCCTTTTGTAAGGATTCTGAATGTTT
TGTAAATGTATTGGTCCGTGTGTTGTATTTTGTAGTCTTTCTAGTTTCCTGGGGCGTTAG
CATCCCCACTTCTTGTAGGTGTACGCACACTGTAACAGTAAAGTCATGTCGCGCAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1102, 37862..37969, 38551..38649, 38922..38990, 39079..39133, 39788..39991, 41035..41203, 42981..43107, 43244..43354, 67859..68029, 69299..69426, 69527..69767, 72303..72422, 73176..73298, 73490..73641, 78340..78490, 79620..79821, 80942..81088, 82176..82300, 82583..82869, 83750..83828, 85786..86016, 86362..86502, 96752..96931, 98711..98827, 99175..99285, 99615..99692, 99870..100047, 100815..100945, 102278..102280, 102283..102319, 102321..102412, 102415..102441, 102443..102577, 103255..103395, 103490..103594, 104248..104367, 105486..105677, 106283..106425, 107293..107401, 107505..107674, 108553..108784, 136775..137023, 137124..137287, 137388..137505, 137606..137707, 142328..142501, 144657..144806, 144907..145087, 147240..147372, 148608..148742, 148917..148995
1001..1102, 37862..37969, 38551..38649, 38922..38990, 39079..39133, 39788..39991, 41035..41203, 42981..43107, 43244..43354, 67859..68029, 69299..69426, 69527..69767, 72303..72422, 73176..73298, 73490..73641, 78340..78490, 79620..79821, 80942..81088, 82176..82300, 82583..82869, 83750..83828, 85786..86016, 86362..86502, 96752..96931, 98711..98827, 99175..99285, 99615..99692, 99870..100047, 100815..100945, 102278..102280, 102283..102319, 102321..102412, 102415..102441, 102443..102577, 103255..103395, 103490..103594, 104248..104367, 105486..105677, 106283..106425, 107293..107401, 107505..107674, 108553..108784, 136775..137023, 137124..137287, 137388..137505, 137606..137707, 142328..142501, 144657..144806, 144907..145087, 147240..147372, 148608..148742, 148917..148992
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved