Loxodonta_africana Locus AP1G1
snOPY snoRNA Orthological Gene Database
Loxodonta_africana AP1G1
Loxodonta_africana
AP1G1
GeneScaffold_7475
SNORD71
27297..27382
44404
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACATTAAGGAGGAATCTTTCTG
AAAGTGAATGAAGGACACCCAGTGTACTAGATGACTACTATTTAATAAGAAAGATGTTTT
AATCTGGCAGTTGGTCTTCTCTTCTAATCTCTCGTGTATTTTGTTGAGTTGAGCTTGATT
GGGATCACATATGTCTGATGTTTTGTTGACCTATGTTGAGTTTTACAGCAGTTGAACAAA
AAATATCTATGTTATTTAGGATTGGGCATACCAAAGGAAAATCCATTGCCCCCAACAGCA
GTGGAACAAAAAATATCTATGTTATTTAGGATTGGGCGTACCAAAGGAAAATCCATTGCC
CCAACAGCAGTTGAACAAAAAATATCTATGTTATTTAGGATTGGGCGTACCAAAGGAAAA
TCCATTGCCCCATGTATTACAGGATAGAACTGCTTCATAGGGTTTTCTTGGCAGTGATCT
TAATAGAAGCAGATCACCAGGCCTTTCTTCCATGGTGCTGCAGGGTAGGTTCGGGCCACC
AACCTTTAGATTTCTAGACAAGTGCAAACTGTTTGTGTCACCTAGGGACCTAGATTGAGC
ATAGGTCTTTCCGTATAATTTTAAGAATTGAGTAAAGATTTGAATTGAATTGGTTCCTGA
GATATTTTTATGTTAGTGATAGATTTACATATTGATGTATTTTTTGTCTCATTTTGCTTA
GTTTGATACTTAGTCCTTTACATTTTTGTTTGTGGCCTTTCTAGAAATTTACAGAGTTGA
CGGGGTTTGTAAATTATACCTTTGCTGAAACGTTATGTCACTGGATTTAGCAAGTCTTGA
ATTCTTAAAAAAAAATCAAAGTTTATACGCGAAGTGTATGAATGGTTTTGGTAGTAAAAA
ATCTGAACCATCTCTATTTAATGTCTTCCCATATCCAGAGGATGCCAGCCCCCATCAGAT
TGCGGGAGCTGATCCGGACCATCCGGACAGCCCGAACCCAAGCCGAAGAACGAGAAATGA
TCCAGAAAGAATGTGCTGCAATCCGGTCATCTTTTAGAGAAGAAGATAATACATACCGTT
GTCGGAATGTGGCAAAATTGCTATATATGCACATGCTGGGCTACCCTGCTCACTTTGGAC
AGGTAGGATGGACTAAGACCACATCCAGCAAGGGTTCTCTTGTTTGAATGGTATTGTAGC
TCAGAAGGTGTCAATATTTTTCTGGCAGGGAGGTACTTGATAGCCCTGGAGACTGATGAT
CGTTGTGGGACTGAGGGTAGGATTGAGAGAGCAAACTGCAGACCTGGGAAAGTGTGATAT
TACCATCAACTTTCCTTTCTGTTGAGAATCGCTTATTATCAGGATCAGAAGACTGTTTTG
GTAGTAGCAACTAGCTTACTTAAAATTAACCAGGATTGACCAGTAGATTGTGACTCATCT
GTGTCAGAATGCCTGGACTTCAATGGTTATTCAAGAAATATTTGCTAAATGTTTTCTTAA
TTATTTTCTCTGTGCACAAGATCATTTAGAGAAACTCACAACAGATGTTTCTAAGTTAAA
GAAATTAGATGCTTGCCAAGTAGTAGCATCTAAGGATTTTGTACTAATTACCTCATGGCT
TGATTGCTGCAACAGCTTCCTTGCAGGTATCCCTACCCATTTTCCTGTGCTTTGAACATG
GTATGTTTGGTGATAAATGCTTTCTTCTTTCCTTATTTGATCTTGATAAGGGGGATTGAG
TCTCAGAGGGAAAATGGGCCACTTTTATTTCTTACTAATGCTGTTAAATTTTATTTCACT
TAAATTTAAGAATAATACGCTAAATTGTCTTTTAAGGAAAATACGCTGCAAAATTAAAAG
GAAGGATGTGCAGCACTAGGTACAACAAGAAAATAGCNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAACTTA
AACACAGTGCAGAAATAAAGCTGATTATCTAAAGTGGATAGACTATAGCAGTAGAAAACT
GGTATCTTAGAGGCCAGATTCTTCCACGGATGTGTTTTGTTTCTCCAGTACAGTATTTAA
AATTGTTCTGAATTTTCTGCCATCATATAAAAACCAGGGAACTTCTCATAGAAATCTAGA
CTTCTAGGTAGAAACTTGTAGTCAGAAAATTTGACAACATTGGGTCTACATTTCACATGG
CAGTGGTAGGCTGGTGACTACTTCGTCAATTCTAACTTGGCCTACGATAGTCTTCCCTTC
CATCGATAAGGTATGGCATTCCGCTTTTTTAGGTTCCCTAAAGTTTTACAGTGCTCTTCA
TAAGGTCTTACACGTCTTTGGTGAAATAGGTTTATAGGTTCCTTGGAGCTCTTGTTTTTA
TTGTAAATTTTTTTTTTTTTTTTTTGTAATTACTAATCACGTTGCAGATATATAGAGAAA
TATAATTGATTTTTGTGTACAGGCAGTCCCCAGGTTATGAACAAGATCCATTCCTAACAG
TGTCTGTCTTTAAGTCGAATTTGTAGTTAAGCTGGAACAGGTGCATAATGTTTCTCACTT
AGCCTTATAAGGGTCCTTATTTAGCCTTACTTTCTTTTTTCCTGTAAGAAAAGGCTCAGC
TAGAAGGCTTTTTAGTGATTTAAAGGCTGAACATGCAGCAAGTGAAGGTGATTGTGATGA
AAAATTTGTCATGAGTAGGGGTTTGTTCAGTCCTTTCAAAGTGAGGGCAAATTTACTTAA
CATTAAAGGGCAAGTACAAGTTGTCCCTGAAGGCAGGTTGGATGTTGATAACCCAGGAAC
TTAACTGTGTTTATCCACCTAGCCACATTGCTGAACTCAGTTCTAGGAGTCTGAGAGTCT
ATCTGTAGACTCTTATTGTTTCCATAGAGACAGTACTGTTGTCTGCATAACTTTTTCTTA
GTACCCTGTACATGTAATGCAGTATTGAAAAATGGTGATTGTAGGCATCCTTGTCTTAGT
GAAACCTTAAAGAAATGCTCCTGCAAATTATGGTTATATATGATGACTGCTATAGAGTTT
ATTTTCTTAAAATAATATTTTATTATGTTTTTGGTGAGTGTTTACAGAAGTTTTAACAGG
TTTCTACACAGATTGTTCAGTGGATTGCTATAGGTCTTAGGTAGACCTCCGTTTATCACA
TTAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCTGTATAGATTTTATGTTAC
CAGGCTACAATAGTAGTAAAACCATTACAAGAAACCTTGTTCTTTATATTCCCACTAATA
ATGTCCTCACACTGTTAGGAGAATATTTTATCTTTGCTCATCTAGTAGGTTAAAAAGTAG
CATCTCACATCAGTTGGTCTCAGCCCACCTGGAGCAAAGGAGAATGAAGAACACCAAAGA
CACAAGTTAAAGGTGAGCCCAAGAGACAGAAAGGGCCACATAAACCAGAGACTACATCAG
CCTGAGACCAGAAGAACTAGGTGGTGCCCACCTACCACCAATGACTACCCTGACAGGGAA
CACAACAGAGAATCCCTGCTGGAGTGAGAGAACAGTGGGATGCCGATCTCAAGTTCTCAT
AAAAAGACCAGGCAATGGTTTGAATGAGGCTAGAGGGACTTGGTCCCTGGACCCTTTGTT
AGCCAAAGACTGGAACCATTCCCAAAGCCAGCTCTTCAGACAGGGATTGGACTGGATGAT
AAGACAGAAAATGATAGTGGTGAGGAGTGAGCTACTTGGCTCAAGTAGACACATGAGACT
ATGTGGGCAGCTCCTGTCTGGAGGCGAGATGAGAAGGCAGAGGGGGACAGGAGCTGGTTG
AATGGACACGAGGAATACAGGGTGGAGATGAACAGCGTGCTGTCTCGTTAGGGGTAGAAC
AGCTAGGAGTACATAGCAAGGTGTGTATAAGTTTTTGTTATGAGAGACTGATGTGATTTG
TAAACTTTGACTTAAAGCACAATTTAAAAAAAAAAGGAGTAAAGTAATTTGAGGTCGTTA
CCCAAGGGGCAAACACAGTTGATTACTATTTTTCCTCTGTACTTTAAGTAACGCAAGAGT
GTAGAGTTTTATTTTTAATGATTGCTGCTCAAAATAGGTGTCCACCCCCCTCACCCATTC
CTTCTTTGTAGTTTGTTTCTCTTAACTTTTATCTTTTTTTCCCCAACTTTTGAAAACTTT
GATAGCATTCTTAAAGATAAAACATGATCCATTCTCAAGTTGCAGGACACGTAAGTGTAA
AGTGTAATCGGAGTTAATCCCTTCACTGGAGGATGTTTATCAGATGCCATTTCCACTTAC
ATTATCTTAAATTTTCCCTCAAATTTGCAACCTTCTAGAAACAAATACTTTTTCTTGAAG
CAGAGTCAAAGTACACATGGGGAATATTATAAGGAGTTAATTTAGTGTTCGTTCCTTTAC
ATTTTTGGTTTTCTTTTTGCTGTTTAACTTTTAGGTAAGTTTTAAGCAAGTGTCACAAAA
AGCAAAAAACAACAAATTGTATTCAGTAGTCACTGTTGACTTTTGGAAACCCTGGTGGCG
TAGAGGTTAAGAGCTATGGCTGCTAACCTAAAGGTCGTCAGTTCAGATCCACCTGGCGCT
CCTTGGAAACTATGGGGGCAGCTCTACTCTGTCCCGTAGGGTCGCTAACTCTAAGGCAAT
GGGTTTGGTTTTTTTTTTCGATGACCTTTAGTCTGATTGTCTTAAAACTTGACCCTAAAA
ATAAAAATAATACTAATGCGTAAAAGTATCTTGTATTCATTGGGTCATTTTAATAAGACA
TTTTTGTAAAATTTATTTTCATAATGTCTGATGTTTGCCAAGAGCAGAATTCTATAAGGA
GGATGAAAACTTCAATGATGTCTGATTTTTATATTATTTTCTTTCAGTTCTTAAGTGGGA
AGATTTAAAAATCTTCAGTTTGAAAAAGTAAGATTTTTCTAACAGTTTAGCTCCTGATTT
TCTCATTCACCTAATTCAGGGGTAATTTTTCTGCTGGGCATTGTAAGAATAATGTTCATC
AGCTTCTATTTTAAAAATTGTTATTTAAATTTAAATTGAATGTAGGAGGAAGGGAATGGT
TGTTAATAATCTTTTTCAATCAAGGCATTTAAGTTTTCCTTTTTGATCCTGGTTATCCTT
CTGCCTTAGAGGTTTCTTTAACATGTTCATGGTAGTATGGTCGGTCATTCAGCTGCCTTT
AGGTTTTTTAAATGCAGGTTCATTGGGAGGACAGATTTTAAATAGCTTGCAACAGCTTTA
ATTTGAAACTGTTTTACTTTACACAACTTCACTTTCTAACTTCTTAGGCAAATTGATATG
AAAAATAGTCTCACATTCCTTTGCTCCCTCTGTATACAGATCTCCATTTGAACCCCTTTC
CTTGGAATGTAGTGATTCCAAAGAGTTTCAGAAACTCTTCTTGGAGAGTCTGACTTGTGT
ATGCCCTTTGAAAACCACTGCTCTCGGGGGAATGCTTGGCCTCTTCTGTCTCTGTCAAGG
TGGAATGATTAGTATATCAAAGTGATTGTGATTTCAAGAAAGGCTAAATAGAGAGACAAA
CAAACTATTTAATATTACCTCAAGGACTCTTAAGCACTGAGGAGTTATTTCTAATAATTA
TATAAAGAGGAAATCATATAAAACATTTTAGATTAATTCCATTACTAAGTTTTCTCTGGG
TATATAATTTTTCCCCCTGTATTTGATTCCTAAATCCTCATCTTTTCCATAGTACTTGGT
TCAGTCCCTAAATGTAGCACTTTCCACATTATATTAAATTTAGTTATTGTGCATCTTTTC
TTCAACTGTACATTCCCAGTGTTTAGGACAGTATTTGCACTTTGATGTATTACCAGTTAG
TATAGTTGTTACTGAGTTTTTTGATATTTGACATAGGAACCAGACCTTAATACATACGTA
AGTTAGGTGCTCATTTAATGTAACCTGGGGATGAAATTAGGCATTTGATTTATTAGAGGG
TTATTATAATAATAACCCTCTATTAGTTTGTGTTTGTATGAGTCTGTAGAACTTAAGTAA
AATTCACGGATTATTTGGATGACAAATACCACAGGACCTTGACTAGAACGTCTACTGTAG
AACGTGATTACCATTATCAAGATACCCAAAGGTCTGAAGTTTTCGTCTTTTTATTAGGTA
ATTTGATGATAGATTTATGTCTATTTAATCATCTGTGGATTCTGGGTTGAAAATACTGCT
TTTCTAGATGGTGGTAGCAATTTTTTTATTTCTTTCTTTCATTTTTGCAGTTGGAGTGCC
TCAAGCTTATTGCCTCTCAAAAATTCACAGACAAACGTATTGGCTATTTAGGGGCAATGC
TGCTGCTAGATGAAAGGCAAGATGTCCATCTCCTCATGACCAACTGTATCAAGAAGTAAG
TGTTAGCTTTCCTTTTTACTAACAGCTACTTCGCTTTTCGGTCTTTTATAATATGACATC
AAGAGCTTTTAATTACTGACATATTTATTGTCCAGAATGTATTTGAATTGCCCTTGGCTC
AGAAGCTCATTTGTAAACAGGCTAAGCAAAGGGCTAAAACATTTGTAGGGTATAATCTTA
TGTCTTCAGGCATAAGAACACAATTTAGCAATGAAATAAACATTTAAGCCTTTCTTTCTT
TTTTTTTTTTTTTTAGTAAAGAAAAGGCATTGCTAAAATCTGGGCTTTCTTGTATTTTCT
CTAGGACTTTGGATACCATGAATAATGACACTGCATGTTTATTAAAGAATTACCAGTGTG
TATTATGAGTAAATACTCATGTAAAGTAAAAAGAGAAAAGTCTTGCTTGCCAGCAGTCTA
ATGCATCTGAGATTTCAGTTACCTGCAGTTTTACTTAGTCCTGTGAACTTTGTGTATAGT
CTTTTTTTCTCATATTGGCTGCCTTACTGATATACTAGTCTAGTCATGTTTGTTTAATTT
GCTTATAAACTGAGGAATGCTTACCATTTGGAGAACTTAAGAGGACCCAAACAGGGAAAT
TAATTCTTCCCAGCATCCCTCACATGGGAATTTTCTGTTAGAAAGCTATGGAAGTTTTGA
TGGCCATAAGTGTTAAAGGTACCATGTGGTTTGTTTTAGCTTGTCAGCTTAATCTCCTTT
TTAGATTTCTTTTTCTTTCATTTGCGTATTTCTGTACTTGACAGAAAGTATAAGCGAGGA
GATATAGTTTAGCAGATTTGCAGGTATTGCAAACATACTTGTGGAAAATAAATGTTCTAC
TTTAGATTTTTCTAATGAGTAATGAAAAATTCCAAAATGACAAATATGATTTGATTGTAA
TTGTAAGTGTATCATTTTCTTACATTGGATCTGTGAACTTAATTTTGGGAGAATTCTTGC
TTTTTGGCCTTGAAATAAATATTATTAGAGTACCAAGTTGATTCATTTGTCAGATACTTA
ATTGCATGCCTGCTATGTGCCCAGAGCTGTTCTAGGTACTGAAGATGGAGAGTGAACAAA
ATGTATAGAAATTTTTGCTGTCATGGAGTTTGCATTCTTGATATTCAGTGATTCTTTTGT
TCTGTTATTCTCGGACATGCCTATAAGAGAGTTCCTTTAATTCTTGTGCTTACATGCTCT
GTTGCTCTTACTACTCCAGCTTTCAATCACGTGTGGATAATTTGGCAGTTCTGCCTAGCA
GCAAATTCGTATTAGAGAGTTAATACCAAACTTAAGCATAGATTTGGAGCTTGATAAAAA
TTGAAGAGTGAGGGACAAGGGTAAAGAAGAAACCTTTGCGTTTAATTTTAATGAGGCCCA
GCTAAGTCCCCACTGAGTTTAGGAGAGAGCTACATTTTCAATTCAAGTCATTGGGGATTG
ATCGGGCACTTCATTCCAAACGTAGTTAAAGGACTTTGGATCATTCAGATTTTTTTTTTT
CAGTGTGCTTTAAGGGAAAGTTAACAAATCAAGTCAGTCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGTCTCAGACTATTAAGTC
TGGTCTTTTTAGGAGAATTTGAGATCTACATCCCATTATTCCCCCGCTCCATCAGGAGAT
TCTCTGTTGTGTTCCCTGTCAGGGCAGTCATCGGATGAGTAGCTGGGCACCATCTAGTTC
TTTTGGTCTTGGGCTGATGTTGTCTCTGGTTTATGTGGTCAGGTATTTTTTTGTTATTTA
TTTTGGTATTACAGAACATCCTTGTCCAGCAGTTTTTATGCTTAACAGTGAATGTTTGCC
TCACTTGTTTGTTGGCCTAGAAAAACTCTAAGACATTAAAGATCATGGAATTAAATCTTT
AAAAATTGTATCTAATGTTTTAAGAGCTTTCATTGTGTAAATATCCTTAATCATTGAAAA
GTGAATGAAAACGCAAGTAAATATTCTTGGAAACTAGGAGCCTAAATGGTAAAGTCATAG
TTAACACTCAAGCTTCATCTTTTAAAAAATACAATTTTATTATAGTGAAATATATGTAAT
GAAAAATTGCCATTTTATTCATCAAGTGTACAATTCAGTGACATTATACTTATCATGTTG
TACAACCATTGTCACTATTTCCAAAAGTTTTCAGCACCTCATACAGAAATTGAGTACCCC
ATAAGAAATAATTCCCCATTGTCCTCTTCCACCAGCTCCTGGTAACTCTAATTAACTTTT
GTCTCTTATGCATATGTCTGTTTTAGATCTTTCATATAAGTGGACTCATATAATATTTGT
TCTTTTATATCCAACTTATTTCACTTAACATAATCTTTTCATGGTTCATCCGTGTTGTAA
TATGTATCAGAACGTCATTTCTCTTTATGGCTGAATAATATTCCATTGTATAGATATGCC
ACATTTTATTTACCCATTCATCTGTTGATGGACACTTGGTTGTTTCCACCTGTTGGCTGT
TATGGATAATGCTGCAGTGATTCCGTCCCTACCTTCAGTTCTTTTGGACGTATACCTAGG
AGTGGAGTTGCGGGGTCATACGGTAATTCTGTGTTTGGCGTTTTGAGGAATCGCCAGTTT
TCCTCAAGCCTCATTTTAACAGTAATTTTTACCTTAAAATTTTCAAATTGGTGAAAAGTA
GCAAACCTGGCTAATTTATACCTTAACCCTTTCCTTTATTCATTCTGTGGGAGGACTAAA
TAATTTATTTATTCATTTAAAAAACTACTAATGAACGAACATATTACATGCTAGCATAAA
TGATGTTTTTTTATGAAAAAATAAACTATTTTTCAAAACAAAAGAAATTTAGGGAGAATT
CACTTAAAAACTACTAATGAACCTATTACATGCTAGCATAAATGACATTTTTTTATGGAA
AAAAAAAAAAACTTTTTTCCAGAACACAAAAATTCAGTGAGAAGAGCGGCATTATTTTAC
ATTTTTGTAAATCTCTTTCATGTCTAGCCTAATGGAAGACAAATACCTGCTTGTGCATTC
AGTTTCTTGTGTAATGTTGTTTTGATGGAAGTATATGGGGAAAATCCAGCCTAACACAGA
TAATGTAGATGGAAGAGTATTTTAATAAGCTTTTGTCAATAATAGTAGTTATTTTTTGAT
ACTATACCAAAACTAGGGAAATGGTAGTTCCTTAAAGTTTAGTTACAATGTGGAATTTGA
AATCATACCAGTGAACTTTTGGTACCTTGTTATAAACGTTACAACTTATTACTCTGTCTT
GTACTTTCAGTTAATATTTTACTTATGTGTGGTTTTGTAGTATTATGCCTAGGTTGTTTG
GAAAATATTAGTTCACTGAATTCAATACAGATTTTCCAAGGATTCGTACATTTCATTATA
TAAGAACCGTAAAACTAAACTCATTGCTGTCAAGTCAATTCCGACTCACGGCGACTATAT
AGGACAAAGCAGAACTCCCTCATAGGGTTTCCAGGGAGCAGCTGATGGATTCAAACTGCC
AACCTTTTGGTTAGCAGCTGAGCTCTTAACCACTGCACCACCAGGGCTCTTGTTTCATTA
TAGAATATAAAAAAAAATCATACTGGTTAATATCTCTAGTGATCTCATCAGAATAGTTTG
TAAGTATTGCCAAACTGGCAAGCTTTTGCAGTGCCATTTTACCAAAGTTCAAATTATCAG
TCGAAAGCTTAGATTTTATCATTGGTAACAAATATCGTCAGTTGTTGTTTTTGAAGTGAC
AGGCTTACTTGGCTCATTTTACTGAAAATGTCTACAGACACCCAAATCGTAACCGTAGTT
GTCTATCAGTTATTTTTTCAAGCAAAAATAATGTTCCATGATAACAGCAGCTAGTTTATA
GTTCAGCTTGCAGATTAAACAATTGCACAAGTGCTTTTCCCTGAGACAGCAGTATGCAGC
AGCAATATGTTAGTGCGCTTCCCCTTTTGTTACACAGAATATTAGAAAGATGTAGTCAAG
AGTTGAGTTTTGATAAAACTAATAGTTTTTACTGCTCTGTAAAGGACAGTCTTAAATGAA
ATTGCTTTTTTTTTTTTTTTAACTCTGGTAGTAGATACAATGAATATAGTACAGTTTGGT
GCTACTGCCTTGATTCATGCTAATGCGCCAACAATTTTTCCCATCATTGCTTTTGTATCA
CTAATGCCAATGCTAGTACAGTTGACAAATGTCCTAGTATTATGAAAATAGTTTGGAACT
CATGGACCTTCTGAAACAGCCTTGGGATCCCCTAGAGATCTGTCAACCATACTTTTGAGA
ATCCCTAGACCAAAGGTAACTAAAAATGTTTCAGAGCTGGTAGAAGTAGCATAATTTGTA
TAATAATTCCACTTCTGAATAGCAAGACTTGATTATAATAGATAGATGAGCTTACCAGTT
CACGCTTTTAATACATACTTCTCTGAAAATAGACTTCATGGATGATTTGGAAAGAGGATT
ATGTGCAATGATCAGTGCCTGTTAGAAATAGGATTTTGTGTCTCTATACCATAATATACT
GGAATTCATTGTAAATATCCAGTGTAGTTTGTTAAAGGTGTTAGTTCACTTTTATAGTAA
GGAATAGTCACTAATGTTTTACTTTTTTGAATAAATAAATGTAAAAATTATTTAGTGTAA
CATCAGAGTTAATAGTATAACATAAGACCAAGGTTTCAGGATGTAACTAAGTTTTTGTTG
TCATGTCTAGGCATCTGAGATGCTCTGGCTAGTGTCAGATATTACGTTTTCTGATTTTTT
TTTTTTAAAGGGTTTTGGTTAATGTGTATCTAATTTTTTTGTAGTAAGTAATAAAACACA
TTAGAAATCTTCTAAGGATGTAGTTTTGCTTTATATTTCTGTTACTGCTAGTTTTTATTG
TCAGTGGTTTGCTGAGTTTTCTAAAGTGTGCGGTCTTTAACACCCAGCAGATCACATGTT
GTCCAGTTTCTATTGCTTTAGTATTTCGAAACATTGGGTTTTATGTCTGTAGGAGGGACT
GTCGGTTTACTGTATTGGTAATTTATAATAAAGTTGGAATAAACATTTTTGGCAAGAATA
ATCCTATTATTTTCATTATTGGAGAAATCTTGAGCTATTCTGAGCTAAATCATTAGATTG
TGAAGCTTCTTCATGGGGCACAGCAGGCGGAGCATGTTCATCTCTACCTTCTTCCTTTTT
GCAGCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGATACCTGCGAACAAAATTAAATTCTTCCTTTAACTGTTAATTAGTTCTTT
CTCCTAAAGATGGTGTGGGTTGCCCTTGTTCAGAAGCACATTATTCAATTAAATAAGATA
TTCCCATAGATTAGGAAAAATATCTATCTCTAAGTACAAGATGGTAGGAATCAGAAATCT
TTTCTCGTTGATGTAACTTTTGTAGTATTTGATGCCAACCAATAGTCATAATGGTTACTT
TTGGGGAGTAGAGGGTAACCAAAATCTTTGAATGTAGCCCTCTTTCCAATGAACAAGTTT
TTAGACCATCTTTTCTTGAGTAGAGACTAGTTAAGTATCTTTCAAACGATTTTCTCGATG
TCGTCAGAGTAGTGAGTGAATTGGGGGTGGTCTAGGTACTATTAAACATAACAGCAGATT
TGTAGCTACTTCAGTATAAATATTTCAATTGTATGATGTTTTATGTCTTTTGGTCATCTT
GCTTAGTAGAATGATTATCACATATTGATCATCTTACCTAGTTTTTACTTTCCCAAAACT
CCATATAAGTTAGGTTTAACTTGCTTGATAAATTCATATTAACCGTGATCTAGTATAGAA
AAGTTTTGTGCGTTTGCTTAGCAATATATGAAGAAAGGGACAGGTAAGCTAGATGTTAAC
ATAAATGTGATAGTATAAACTGGAAAGCCCTGACAAGTTAGTAAACCTCTTTCTTTTTAA
TTTTTCTAGTAGATGAAGTAGTTGACGAGCTTTCTTTTTTTAAGATTTGTTTCCCTGGCT
TAATTAAAAATAAAATCTTTTGTTTTATTTATTTATTTTTTAATAGGCAGCACTGTGTGC
TGTTCATGTCATCAGGAAGGTTCCTGAACTTATGGAGATGTTTTTACCAGCAACAAAAAA
TTTATTGAATGAGAAGAACCATGGTAATGTGATTTGGAGGCACTCATGAAGTACTGAGGG
AGAAAGGGGGTAAAGAGAAGAGGCTTCAGGCACTGTTGGCCTTTTGTCTTCACACAGTAG
AATTGCCTTTCTAATGTGCTTAGACGGTTTTCCTTCAGGTCTGGTCACCCAAATCTCTCT
TCTCTGATGTCCTAGTTTTATAATTAGAGATTGGTATCTTCATATTAAACCTTGTCTCTC
ATCTCTGGTCTTTTCCTATATTTAAAAGGACTATATTAAGTTACTAATTTTTTTTTAATA
TTCAGTGTAATGTACAAATGATCCCAGCTTTGATTTTCATGTGTGTAGAACCCTTTGATT
TCCTGGCTATTTTATAACAAAAATAAAATAAAATATTTCTTCGTTGTCTTCGTAATAGGA
GTATAAGATTTGTGAAAATTATTTTAGGCTACTTGTAACAAGAATTTGTAGTGAGTACTC
AGATCTATTTATATAAAACTTAAGAGAAATTAAATGGAATATGACTGTTCATTCCCCAAC
ATTTTTTTCTTATTTTGAAGTAATGAAACAAGTTCTGAGTAAAGAAAATTCATGTATCCT
AAATGTTAAGAGAAAAAAATGGTAAGGTATATTTAATTGTGATTGATTCAGTGCTCTGCA
TGGAAGGCTCAAAATATACTTATTGAACAAATGCATTGTTTAGGGCACTTATTTTTTACT
TAATGAAAAATCTTGTGAGGATTTTCTCACTGACTCTGTAATAAACAAATTTACTTTGTC
ATTCACAATTACTTTGGATTTTTGATACCCTTTTTCCTGGAAATTTAAAAATCTTATTAA
GATTTTTGCCACTTGAATTACCTTTCAGAACTCAAGTAATAGCTTATTAAGTGTGGAGCA
GATGGTACCTAGCTCATATTGACCATGAGCATGTCTTTATGGATATTCTCAGACGGAGAG
GCTCATGTATTCGTTGTCACTTTTTAGTAGTTATTTTGGTTACATACTTGTTAAAAAATA
TCCTGATTTTACTGACTTGACCAGTATTAAATCAATAGGCTTTTATTTAAAGTACCTTTT
TTGTATTCACTTCAATGCTTACATCCTTTGAGGAATTAAAAAGCGAAAGTAGCAACATCC
TTTTGGGATTGACCTTCAGGAACTCAAAGTCCTGTTTTATCAGTTGAATAATATAACCTT
GTTTTTAGTTTTCATTTTATCTTTTATTTAAGGTGTCCTTCACACATCCGTAGTCCTCCT
CACAGAAATGTGTGAGCGAAGCCCAGACATGCTTGCACATTTTAGAAAGGTAGGTGTTAT
TCTGTATGCCTAAATCTTTCTTGATTGAAAAATGATTTTCCTGAAAAAGGACATTTTCTT
ACTTATGAATTTTCTTTTGAGAGCAAGCTATGGAGCTGAATAGAAGACTGGCGGGCTGTT
TCATATTTAGATGGGGCGGGGTAGCCCGATATAGGCATATAAGAACTGGCAGTAGAATAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNAGGCTTTAATAGCAGTTCCTTTTTTTTTTTTTTTTGCCTTTTTTTCC
CCTTAGATGTTTATGTCTTGATTAAATTATTGTAAAATAGTATGAGACCCGTATCTGTCC
CTAATGCTTGCTTTGTATGTTTTGTTCCTGTTGTCTGTTTGGAATCCTGCTGTATGTTAG
AATGAAAAGGTAAGAATTAACCCTCTTTTAGATGGTGCATGCTACTAGCATTAGGTCCTC
AGTGGCTTTTGTGTATTCATCTACAATGTGGCTTTTAAAAATATACTAATGCTGAAGTTT
TGATTAATACTATTGAGTTATTTGTTCTAGTATTTTTGGCTAACTCCCTAATCCAGTTTT
GTCTTGTCACTTAAACTCGTGACTCCAAAGTCAGCCTTGGATTTCAGTTGCAGCCTTTCC
TAAATTGTAAGCCTCCTTCTCTGCCTGTCTTTTATCTTCACTTGAGAAACTTTGAGCAGT
TTCCCAGTGGCTTTGGTGATGGCAGTTCCAGATCAGTCTGGAGCCTTGACACAAAACACT
GCTTCTTTTTGAAGGAGACTTTTTAGAGCCACATGTGGGTAACCTCATACTTAAATAAGC
TTTGTATGTACTTTCTGAGCTTTCAGTTTAAACTTAGAGCTTTTGTTTCTTCCATACCTG
CACTTTATCTTGCCTAGAAGTTTGGGAATATTAAAAGGATTTGAGGTAGAGTAGTGGGCA
CCAACTGATTTTCATGGCTGCAGCCTTTCCCTTGTCATCTTATTTTGTTTGTCCTGTCAT
CAGTTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGTTTCTGCATTTTAGTAGCCAAGGAAAAA
GGACTTCTCCAAGAATAAACCAGATTTAAAGAAATATTAGGGATATGTATAGTAAAGAAA
AGCAGGCCATTGGGAAGTTTGCAAGGTGAGCTGCTTTTTGTGCAGAGCTTGGTAACCGGA
TGGTCTCAGTTTTATTACAGCATTTTAAAGCAGTTTAAAAAATTATATTATTCTCAACAT
CAATATAAATCTGCCCACACAGTTGACAGATTTAATGAGAATTCTGTTTAGAATTTACAG
TTTTCCATGGCTTAGATTTGTTTTAATCTTGGAGTTGTCCAGATTAGATTTTTGTTTTGA
TAATTTTTGAATCATTTAATTCTGAAGTGTTATGGCCAAATTTGTGAAATTTACACAGAT
TATGTTCTCTTGTATTTAGAAGTGGCCTGAATGTTGTGAATGTTTTGAGTGCATGCCTTG
GGTATAGCCTGGCTTTTTTTTTGTTTGTTTGTTTGAATTTTGGTCCCCTTTTTTTTTTTT
AGATTTGGGGTGTGGGGAGGGGACAGAGTCTGAATACAATTAGAAAAAATAACTAAGTTG
CACCAGTGTTGGGGCTTTTAGATTGCCTCCTAAAGAGGTGGAATTCAGTTCACTTTGGAT
ACTTCTTTACTTAATTTCAGGCCACTAGAATTGTTTATATAACTAAATTGAGTTTTCAGT
TGGAGACTGGAAAAGTTCTTATTGTGGGAAACATTTTGGAGTAGGGTTTTAACATCAAGT
GATTGATCAACAGAAATTAAATGAATGCTAATATTTAAAGCATTTATGTATTTAGCTTGG
CAATAAAATTGCCTGCTATGTACTATGACTCCAGTGGACAAAATGGAGGAATGACAAGAA
GGGAATTCTGACCATACAGAACATGTAGTCTCATTGGTAAGATAAGAAAACAGGCAACAA
ATCAGTGAAATTAAATTTTACTGAAAATTATGTCATAGGATTAAGCATAGGGAAAGGAAA
TTATTCATGTCCCTGGTATCTTCTTAAAGTAAAAGGTGAAAAAATTTTTATGTATCTTTT
CCACTTGGAAAAGTGGAGATATCATAAGCTTTTGTATTCCCTGTTGTTTGTTGAAAAAGG
ACATAATTGGTCCTCACTCATTAAGAGGGGAAAGATTTTTTTCTCTATTTGAGGTAGTAT
GCTATAGTTTTAAAGTAAGATTACCAGTTGTATTTTATTTGTGATAACATTTTATATCTA
AATGTTTGGATGTATAAAACTGAATGTGTTTATGCCACTTAAGTATGTCAAATTTCTGCA
GAAGTAGAAACGCATAGATACTTGTTTTATTTGGTCTCCATAGACTTTCTGACCCGCTGT
TAATTTGTAATATCATTGCATCTATAACTCTGACATAAAAGTCAAGTTTGTTTTTATCCA
GATAAAATACATTGTTTCTTGAGCTCTTTGGCGTAAGTGCTCCTAAGTTACAGTTATCAA
AATCAACAATATACTAGTATATTTTATCAGTAGAATTTGCTTGGACTCAGACTCTTGTAC
CCTTTTTCTAAACCAAAGGACCTGCTTATTCACGAGGCATTCTTTGATATTTACTGGTTT
TTGATGCATCTTTGTTTTCTGCAGCTTGTGCCCCAACTAGTCCGAATTCTAAAGAACCTC
ATCATGTCCGGATATTCACCAGAACATGATGTTTCTGGTATCAGCGACCCCTTTTTGCAG
GTGAGGTTGAAAGGAAAGATTTGGATAAATATAATATGAATTTAATATCTTTTCAATAGA
CCGTTTTCTTCCTTAAGTTTGTGTTGGGTAGAAATTGGTAATTAACTGACTAATTATGTA
ATAACAAATAGTGACACGATTCTATTTAGATTAATAGAATAAATTTATAGTTGTAATCCA
AACCCAATAGTCAGTAATAGTATTATATACTACACAGACAGACTTATCAATATAATGTAG
CTCTGTTTTATTCTTTAGCTGTGGAGTGGCAAAATGGGGGCTATCTGACTTCATTAAGAC
CTGTTGTTGTGTGCTGTCTATTTGATTTCAACTCACAGTGGCTTGTTCTGACTCATAGGA
GCCCTAATAGCACAATGATTAAAGCACTCTGCTGCTAACCAAAAGGTCGGCATCTTGAAC
CCAGCAGCTACTCCGCAGGGGAAAAGACGTGGTGATCTGTTCCCATAAAGATTTCAGCCT
AGGAAATGTTATGGGGTAGTTCTGTCTTATCCTATAGGTTCTCGATGAGTCGAAAATGAG
TGATAAAGACATAGAAACATTTATAGTCTCTCTAGAGATAATGTTTAAAATTCTTCTGTT
AGACTTTTGGCCATCTTTAATGAAATCTAAGGCTTTGTTGAAATTATTTGCGTTTCATAC
CAAGCAAGGTTCCTTTGTGCCAGTCAAAATTTGTTGATGCTTCTCATATTTTGCACATTA
GGTACGAATTTTGCGGTTATTAAGAATTTTAGGACGAAATGATGACGACTCAAGTGAAGC
TATGAATGATATATTAGCACAGGTGAGTGGACCAAACTTGCATCATGTTAAATATTCATT
TTAATATAGAAGGGAGTAGAATGGTTGTGATTATATTGGACAGATTGTTTTCTCATTGGT
GGCTGCGGTCACAAACTGTCTCTTGTTAACCCTGGATTTTTTTGAAGCCTTGTTCTATCA
CTAATATACTGCACTCTGTCTTTTCAGGTTGCCACTAATACAGAGACTAGTAAAAATGTA
GGAAATGCTATTCTTTATGAAACAGTTTTGACTATCATGGATATTAAGTCAGAGAGTGGA
CTGCGAGTAAGTCTTTTTAAGTCTTTTTCCCCGTAAACATTTCATTTAGAATGATTGACT
TGAACTTTAGCCCTTTGGAATTAGATTCCATTTCAAAATTGACTTTAGGATGTACGGCGC
TAAGTTTTTTATTATCTGAAGTATCATTTCCTCCCTTTGAATGTTTAAAAATGATGTTTA
TACGTTTGGAAGATCCTAGATGTAGTTAGTATGTAAATATTGTTGAGTGAAGGAAAAACA
TTTCAGAATAAAAAAAAAAAAAGCCAGAGTTTGAATTGTATTCATTGCTTCAAACAAGAC
ATCATATTTGAGTTAGTTTGTTTTTATTTAGGATGTAAACACATAGAGTAAGAAACCCAA
ACAGTACAAAAAGTACAAAGGGAAAAAAATTTCTGACTTGTAGTTTTCGTGTGTAGATCC
TAAATTCTTCTCAATCATTTGGTTAAGAAAATACTATTACCATTTTCTAATGTATTTTTC
CAGAGATGTTTTACCCATATTTGAACGTCTCTGTACATGTGTATTTATTCTTCTCTTTCC
CACTTTTGGTCAATTTTTTGTTAGAAATAATTTTAGACTTACAGAAAAGTTGCAAAAATA
GTTCAGAAAGTTCCCATATACCCTTCACCCCGCTTCCCATAATCTCAGTGTTTTGCAAAA
CTATAGTGTAATTATCAAAACTAAGCAAATTAATATTGGTACCATACTGTTAATTAAATT
ACAGACTTTATTCAGATTTCCTCACTTTTTCTGCTAATATCCTTTCTCTGTTCCAGGAGC
CAATCCATGATCGCATTTTATATTTAATTGTCATGTCTCCTTAGTCTCGCCTATTCTGTG
ACAGTTTCTTAGTCTTTCCTGATCTTTCATAACTCTGATACTTTGAAGAGTACTGGTCAG
TTACTTTATAGAATGTCCCCAGTTTTGGTCTGCCTGGTGTTTTCTTACAGTGAGACAAGA
GTATACAGAAAGAATGTGTCCTTCTCAGTGTATCATATCGGGGGTTCAGCTGTCTATTTG
TCTCACTACTGGTGATGATAACCTTGACTATTTTGGTTAAGGTGATGTTTGCTGTGTCTC
TCTACGGTAAAGTTACTTTTTTTTTTTTTCTTTGTAATTAGAAATATTTTGAGAGAGACA
CTTTGAGACTGTGCAAATATGTTCTCTTCAAACTTATCCTCACTAATTTTAGCNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNAGTCAGGAAACAATGTAAATACTAATTTTCCTGGATTTTTAACCTATGC
TATTTCTCTTTAGGTCCTAGCCATAAATATCCTGGGTCGTTTCTTATTGAACAATGACAA
AAATATTAGGTAAGTCAATTAAACAGTATCTTGGGTATTATAAACTCAAGTGTTTTCGAG
AAATGACTTTGTTCAGTTTCACACATCCATTGATTGACACATCTAGAACTTCAACCTAGG
ATTTCTGTTTTTAGTCTAGTCTTAAAACTACTGTTTTTTAAAGAATTTGAGGATTTGCCT
CATGGCTTTTTACTCCTATTTATACCGTAAATCAGGTGTTGGCAAACTTGTTCTGTAAAG
GGCCAGATGGTAAATATTTTAGGTTTTATGGGCCACAGGGTCTCTGTGGTGACTACTCCG
TTTTGCCCCTATAGCATGAAAGCAGTCATAGATAATATGTGGCTGTGTTCAAGTAAACTT
GATGTATAAAAACAGCAGCTGGCTGGATTTTGACCCCTATCCAAAATTAAGAAGGGAAAA
AAATACAACATTTTAGGGAGCAAATCTGGAAAATATTTGTGAACTCCAGCTAGTTTTTTT
TTTAGGTGGATGATTCAATCAGTACTACCTTTTATTTTGTTGTTTTCCTGTATGTAATAT
GTCCAGCCTGGTTGCGTAGTAGTTAAGAGTTCGGCTGCTAACCGAAAAGTCGGCAGTTCA
AATTCACCAGGTGCTTCTTGGAAACCCTATGGAGCAGTTCTGCTGTGTCCCATAAGGTCG
CTATGAGTCAGAATCGACTTGATGGCAATGGGTTTCTTTGGTTTTTGCGCTTGTTTCGTC
CTTAATCTGGAGAAAATTTTCTTTCTTACCACATTAGGCATAAAAAAGTGCAAATAATCA
TTGTGAATTATCTTCAAAATTGAATTTTTAAAAAGGCAGTTTTGGTGCGAGTATCAACTA
AAAGACTAAAAATGCAAGTGGTAAAATTGAAATCATTTTCCTATTGCATTTTGGTGCTAA
GGCAGCCCAAGAAGGCATGTTATACTGTGTGATTATCATGCTTTACTATTTGGAAGAATT
TGAAAGAAGTGAATCACCACTTTTAGAAGTTTAAATGAACTTGACTGAATGTGAGTCTAA
GTCCAGGGCTTCTCCTGGTCGTCACTACTTTAGTGTATTGTATCACTTCTACCTTTAAAA
TATTACCTTTGTACTCAGTATCTTTTTCTATTAAATATTTGAAAATGTGCACTTTACTGT
AGTCATTAGGCATTTTCTTTGTTATTATTTAGTCAGAGGAAAACTCTCTTGAATTTTAAG
TTTAAATGCTGTTACTTTGCAACATTGTTTCACCCAGATACGTAGCTCTCACGTCTTTGT
TGAAAACCGTGCAGACAGATCATAATGCCGTGCAGAGGCACAGAAGCACAATTGTGGACT
GTCTAAAAGATTTGGATGTTTCAATAAAACGGTAACAAACTTTGTATCTTTATCAGTCTA
GTGTTTTCCTTACATGAAGTGAGGGAAACATTATTGATAGTTCTGTGCCCCTCCCACCTG
ATGCTTTGTAATAGTTTTGAGAGCCAGAATGGTAACATTTGTGCAGTTAGTCACTATGTT
CACAGATGAACTCTGCCTGCAGTCTGAATCCCTTTTTAAAAAAGGGAATTGGCAGGGAGA
AGTTTAGGTCAATTAAGGATGTCAGTAAGAAATATTGAAATGTATCCTGGGTTCATTGTT
ACATATAACACATGCAAATGAGCCAGACTGAAGTTTACTTAAGAGGTACTGTATTTTTGT
GTGCTGGAGGATGAAAATAAGGAGTGATCCATCGGCTAAGTGTCTTATCACAATGCTGAA
ACTCGAATTGCTGACAGCACACATGTTCTCACAGTACTTATGTCCCAGGATACCAGAGTT
AGCTGTGTTTCTTAGAACAGGACGTCTAGAACTACAGTTAGTCAGCAGATAGCACTTTGA
AAAGGCATATATTTCTTCTCCCCGGAGTATTTTTTTGGCTTCTTCTCTTGGAAGAACTTC
ACATATTTGTAAAACCTTGGCTAGAGTTGGCCTCAGTGAACTTTTTGGTTGTAAAACGTG
AATGATCAAATCCAGAGCAAATTAAATTCAAAATGATCTCTGAAACCATTCATTTAAACA
TTTGAGTTCCTTTCATTTGCAAAAAACAGGTGCTAAGCACTTGCGCAATATAGAGATAAA
GAAGACCCAAACTCAGTGATTGTAACTTTTATGTAGTGCTTTGCAAAGGGTTTTATTAGA
CTCTCTCAGTTGGTTCAGAGGAAGCCTGTGAGAGAAACTAGGCAATTACTTCTGTCCCCA
TTTAACAAACAGATTAGTTAAAATGAAGTCCCAAAGGGATCAAATAACTTACCAAAATCT
TACCCCTTGTGTATGGGATAGAACTCAGACCTTTGCCTTCTATTGTGTTGTTTCTCTATA
GATCCTACAGGGCTTGGCATTGGAAAGATAAAACCTATGTCTCGTTGACAGACAGGCTGT
GTAACAAAGTACGAGCTCATACTCAGGCTGTCTTATTTCAAATCCTGGCTCTCCTTTAAT
AGATGTATGACTTGGTCAGGTTACATAACTTTATAGTGCCTCAGTTGCCTCTTGTGTAAA
ATTTGGATAGTACACCTCCACTTAAATAGGGTCGTGTGAGATTAATTGAATAAATATAAT
ACAGTACTTAAACACTAAGTGTTAGCTGTTATTCAGGAAGGATTGGCTTTTTGCTGATTA
TGTATTAGCTAATGAAAGTATTTTCTGCTTACTAAATTGGTTGTTTTGGAAGTCAGGGTA
TATACCATACCTGAAATTATTGATCCAAATGTAAAGATGCGTATAGTAGCCCCGTAACTT
TTATATGTTAAACATTTCCATTTTTGTCTTGGTTGCCAAATTTGATCAGCAGTTATGAAA
ACTGTATGTACCTCATAAGATAAGCCCCTTTTCCCTTTTCCTAGCCTTCATTTTCTCTTT
CAGTTTTTTAAATTCTAATTTTCTGCTCAACCTTTTGATGTAAGCTATGTTACATTATAT
TTGGACGGAAGTAGGGTATAATAAAAGTAGAGTTTGCTGACTTAATATGTCACATTTTTA
AGGAACAATGCAGAGAGGTACTCTCATTGGGTAATAATCTTGTTGCCTCTCTTTTTTGAG
CCTCTTAAACATTAGAATTTCAGCCTTGTGGAATGGACTACTGAGCCAAACTACATTTTT
GGTCTTTAATAGTGTATCTCTTTAGGGATTTTTTTGGGGGAAAAAAAGAGTTGAATGAAA
AGTCAAAATATTAAAACTAACTTTGATTACATCAGACTATATCTACTTGGTTATCTTGTG
TGCAAAGGTAGGGGCCACAGAATTGTGCAGGAGCATGAACACATCTGCCAGAGCTTATTG
TTCACAGAGAGCATACCTGGGTCTCTGTTTCATTCCCACTGTAACTATCAACTGTTTTTC
CCACCCTGCAAGGCGTGCAATGGAATTGAGTTTCGCCCTGGTAAATGGGAATAATGTCCG
AGGCATGATGAAGGAATTACTTTATTTTCTGGATTCGTGTGAGCCAGAGTTTAAAGCAGA
CTGTGCATCTGGATCTTTCTTGCTGCAGAAAAGTAAGATTTAATTTTTAACTTTACTGGT
CAAAGATGTTTGGAACTTTTTGAAGACATTTTTAAAACATGGGGGAAATGCTGTAAACAT
GTTCAGAACACATTGACATTTATTTCTAGCTCCCAACTATAGGTTAGCTTTGAGAAGACC
AATTATAGCTAGCATTTTAAAAATATGCTATGACCAAAAAACCAAAAAAAACCTCACTTT
TATAAAATCGCCTCCTTTATCTGTTCTTTAACCTCTTATCTGTGGTATTTTTTTTTGTGA
AAGGAATAGAAAGATTAAAGTGTCAGAATTTTAGTAAAACTTTAAGGAGGAAGTACCTCA
GGGTTTCAGTAGTAGGGTTATTCTTTTTTGTCTTTCCACTCTGAGTTTAAGAGAATGAGT
TCCTAGTCCTAGAGTTGCCTGGGCCTGGGGATAGTCCCTTTTCTTCTCTCTTTTTCTCTG
TCTTTCCTTGCTCTGGGTGTTTTATTTATTTCTCGAGAAACTGGAGACAGAGTCCCATTT
CTCAGCTCAGTAACTGCTGTTGCAGTATTATATGAAACATCTGAGTTTGATTATGTATTA
TTTCATCACTCTTTGAAATGGGTAATCCCTTGGCTAGATGTGAAGGTGAAATGTTTCCAA
ATATAATCGCTTAACCAAGGAACCTAAGAAAGACTAGGAAGGAATTTTCAAATGTGAGCA
CAACATAGTTTATAGGTCCTAATTTTTTCACCCTGTGCTGTTGTTTTCTTAGGTATGCAC
CTTCCAAACGGTGGCATATAGACACAATTATGCGTGTTTTAACAACGGTAAGTAGCTTTT
TTCAGTCAACATATACCTAAGTGCTGGGGATGTACTGATAAATGAGGCAGACAAAGCCCT
TGTTCTCATTTGCATTCTAATGGGGGAGATAAGAAATTCCTATAATGTCAGGTAGAGATA
AGTGCTAATAAGAAAACTAAAGCAGCATAAGGGAATATAATGATGGCAGGATAGGGTGGG
ATACAGGGCGACTGGCCAAATACTTTAGATAGCGTAGTCGGGGCAGGCCTTTCAGAGGAG
GTAACATTTGAGGAGACCTTAACAAAGTCAGGAGCCAGCCATGCAAAAACATGGGGGAAA
GATTGTACTAATTAGAGGGAACAGCAAATGTGAAGGCCCTGAGGTGGGAATAAGCTTGGC
TTGCTTGGAGAGCAACAAGAAGGAAAGTGAAGGTAGTAGAGTGAGAGAGGAGAGATTGGT
AGGACTGAGGTGAGAGAGAGAAGCAGAAGTCAGATTATATAGGGCCTCATAGGAGTTTGG
ATTTTATTTTGAATATAATAGGAAGCCTTTCGGAAGGTTTTGAATGACAATTTTTTCTAG
ATTTAGAATTACTTTGTTTTTGAAGGTAGCCTTTCTCTGATAACTTAGAGAATTTTGGAG
CTTCTCTATCATTCCATTAATAGATAGGGGTTAGAGATTTAAGAGTAAAAATGTAGTGGC
ATAAAAAAAAAAACATAAGTGTATCTAATCATGTATGTAGAAGTAATATTTTAAAGGAAA
ATATTCACAAATTTGACTACATAAAACTTAAAAATTTATATAGCAAAAGAAAAAATCTAC
AAAGTCAAAAGACAAATGACGACTAGAGGGAAAACATTTGTAATATATGAAATATATGAC
AGCATATTAATATTTTTAATCTATAAATACTTAACAAGTAATAATAAAAACCAAGCACTC
TAATGGAAAATTTGCCAAGGACACTTGAACAGGCATTTCACAAAAGTAGAAGGAATTGGC
TAATCAACATTTGAAAAATACTGTCACTAGTAAAGAACTACTAAGTAAAATAAAAGTGAG
GTATTGTTTTCTACTCATCTTTTTAATCTTATTCCTAATGTTGGTTAGGAAATAAACAGG
TACTTTTCATGGGGATGTAAAATGGTGCCATCCTGCTGGGATACAGTTTGGTAGCATGTA
GTAAAACTCTTAAAGTTTATGTCTTTTGATTCACTAATTCAGATTTTAGGACTTTCTCTG
GAAAAATAAAAGGAGAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
TTCATCCCATCTTGTTTGTAATAGGGGAAAACAGGAACACATCTAGAAATCTCCCAGTGG
GGATTGGTTAAATAAATGATGAAACATCTGTAGGTGGGAATGATAGATACCATTAAAATT
ACGAAGTATATGTATTTGTTGATGTGTTGCAGATTTCTGGTTTATTCCATTGTGATTTGA
GATCATAGCTTCAGTGATTTTTGTTCTTTTAAATTTGTTAAAATGTGTTTAATGGCCCAG
AATATGATGTGGTCTGTATTGGTGAATGTTGCATGTGAACTTGAGAAGCATGTGTATTCT
GCTCTTGTTGGATAAAGTATTCTTATTGTAAATGTCAATTAGATCATGTTGATACTTTCC
CCTATTTAAAGCACTCTGTTTGCTCTGGATAGGGAAGAATGTAAATATCTAACTGACATT
ACAGATTGCCTGCTTCTTGGTTTCTCACCTTCCCCATTTTTTATCATTTGCTCAAACATC
TTCTGTTCTTGTGTTTCTTAACAAAATAGGCATCCCAGTCACCTGTTTTGTTATTGTTTT
TTTTTCCTCCTTTCCAAAATATGCATGGATAGGCCTGATCTCTCTCTTGTAAATCAGACC
CATTGCTCTGTCCAGTAATGGTAGATTGACCAAGTTGACTAATAGTAGCCATGGATTCCA
CTGTTTGTATGTCTGATCAAGCCTAGATAGTTATCATATGCTCTAATAAGGCCAAGATTT
AGTTTCCCCGTAGGTTAAGTAGCTTTACTTTGTTCCCTGGTTACAGACTGCAACCACTAG
TTTGTGGAATTGTATTCTACTAGTCAGAAAAAGGAGCCCTAGTGGTGCCAGTGGTTAAGT
GTTCAGCTGCTAACCATAAAGGTTGGCAGTTCAAATCCACCAGCCGCTCCTTGGAAACTC
TGTGGCGCAGGCCTGCTCTGTCCTGTAGGGTTGCAATGAATCAGAATTGATTCGCAGGCA
ATGGGTTTGGTTTTTTTAGTCAGAGGAAGAGGGTGTTAAAGAGACCAAGTTAAAAAAAAA
AAAAAGGATAATTAAATACACATTGTCTTCTATTCGTAGGACTAATGGTTGGTTCTGTAG
CATTAATAAACAGTAGTTTTTAAAAGAACAGTGTGATCTTTTAAATAAACTCAAGTTTCT
TTTTTTAAAGTTACTGGTTATTTAGTAACCCTCCTCCCTCCATTCCCCAGAGTAACATGT
CACTATAACTAGCCCACATGATATTAACACCAGTGTTGGGGGATTGAATGGGAGGAGAAA
GGTGGTTGGTTACACTATGTTTTACTATAATTTAGTCTTGGTGAATATACTTCTTGAATT
TTTGAAATTTTAGGCATTATCTGTTTTTAGTATAAAAGGTCTTTCTTGAGATTTTAAACC
TTTTGTATTTTACTTTTGACAAAGAGAAGATATTTTTTATATAAAATTAAAAAATTTTAA
ATACTCATTCACCTCAATGAGACCTTGAAGTTTGAGCTGCTTATGAACCTAATAATTGGA
ACCAGCTTTATCTTCGAGGGGGTTTTGTTGTAGTCTCCTCAACAACAATAAGAATTGCTA
ACATTTATTATCATTGGTCCATGTTTCTAGGGGTAAACTGTCTGCATTTTCTTTTAGGCA
GGAAGTTATGTTCGTGATGATGCAGTCCCCAATCTGATCCAGTTAATAACCAATAGTGTG
GAGATTCATGCCTATACCGTCCAGCGCTTATATAAAGCAATTCTGGGTGATTATTCTCAA
GTAGGTCCTTCATTTGCTTTTCTTTCTGCTTTAGCGGGAAAATTGCCCTTTCATTTCCTA
GGATGTCCTATTCTAACACTCTAGATGTGCCTTGGTTTTGACCTTTGTGATTAGATGACC
TGTGACTTGCATTAAGTATTTTTGAAAGAACTAAAGTTCTTTACAAATGGTAACTTCCTT
TTGACAGCAACCTTTGGTACAAGTAGCTGCATGGTGTATAGGTGAATATGGAGATCTTCT
TATATCTGGCCAGTGTGAAGAAGAAGAACCTATACAGGTACCCATTGTTACTCTTGGTTA
AGGAGGGGAACAGATAGTGTTTTTGGCTGTAGGGGAGTAGTGTTGAATGGGAAGTTGCAG
TTAATTCCTTGAAGACTTTTTAAAAGGAGTAATTCCAGAATTATCTTGGAAAATCTTTTA
CCTTTTGAGATGGAACTTTTTAGACCACTGTGAGATTTTTTAACTACCTTAGGAACCTCT
CTACCACCCTCCCCCTCCCCTGAACTGAATTATATTGTTTCTCTTACTCTCTGGCTGATG
AACAAGAAGAAATAGACATCTGTCCATATTCCCTTTCGCTTATTAGTGCAAGTTGTGGCA
ACCCTTAAACTCCATATATCTTTTCTTTTTTTTTACTTCTTCCTCTTAAAGTTATAACAT
GCCTGTCAGCCCCTAATTGGCATTTTCCACTCTTTTTATCTCCCTCCTATCTGCTCTGAT
TGGTGGAGCTTTGCAGCTTGGACAGTTACTGTGGCAAAGCACAGGAGTGTGTTAGACACT
TTTGTAGTAGAAGGATTGTCTTCTGGGTGGCATGCTGTGACTTGGTTTCAGATTTAGATG
CTTACCTGTTCCCATCCAGTCTACATGGTCTCTTTTTATCCCTCCCCAGGTAACAGAGGA
TGAAGTGTTGGATATTTTAGAAAGTGTCCTAATCTCTAATATGTCCACCTCTGTAACACG
AGGGTATGCCCTCACTGCCATTATGAAGCTTTCTACTCGATTCACCTGTACNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGATATAGACAAAAGTAGAGCAATAGTAAAATGAATTTGCATGTATCTGT
TGCCCTGTGATACAATCATCAATTCATGTTTAATGCTGTTTCATCTATAGTTTGCTCCCT
CTCATCACCCCCTCCCCCACCTTCATACCCCCCTGCCATGGATTATTTTGAAGATGAAAC
CTTGTGTTTTTAAAATCAGATTTCTGTTGCATTTTTTTTTTTTCTTAAAGTAGAGAAGTT
ATTTTCCTGTGTAAGGGTTCTGATTTATTTATATTTTGAAATGTCTTCATAAGGAAGAAA
ATCATGACGGTTTTGGGGGCTGAAATCTTCAGGGTCTGCTTTTCACTCTGTTCAGTAAAG
TCAATTCTTGGGTCAGTTATCCAGCCAAGTATATTTAGGGCAAAGTTAGTTCTCTTACAT
TTTCTATTTCACTTTTTGATGTCAGGTCTTGTGAAAATGGTGTTTTTGACTCGCTGTTTA
AATTGAGAACTTTGGGGTCAACGTTCTGATGCTCTGACCCTTTTTTTTTTTTTTAAATAA
AGGCTTATTGAGATTATTAAGAGATGAGCAGTACAAATTTTTTCTTTTGTGACAAAGTGA
TAGTTGGTACTTTCGCTTAGCAAATGTTAGAGTATGGGAGGCTTAATAGACAAAATCCTA
GCATTACAATTAGAATACTATAATGGTGTTGGTGAATGGCATCAGAAGAATGGATGAATG
AGAAAAGGTTTTGATTTTGAAAAATTCTGTAAATTAACAAGAAAAGATGACATTTTCGAA
ATTTTAACCAGAAAACTCTGATTTAAATGTTATTCTCTCGGGTTGTTTATGAATTTTCTT
TTGCATATTTGATTTGATTTTTCATTTATTCCCATAGCCGAATTAAGAAAGTGGTTTCTA
TCTATGGAAGCAGCATCGATGTGGAACTCCAGCAGAGGGCAGTAGAATATAATGCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGAGTTTTAT
TTCTCAAGCTAAATAATTTCTTTCATGTCTCATCATTATTAACATTTTGGTGTATTTTAT
TTGATTTGTTTTCCCGTGGTATGAAGTATCTTCTTTTTTTGAAAATTTATTGTTTTTTGT
TCTTGTTGAAAACATACGTAGCAGAACATACACCAGTTCAATACTTTCTACATGTACAAT
TCATTGACATTTATTACATTCTTGAAGTTGTGCAAACATTCTCACCTTCCTCTCCTGAAT
TGTTCCTCCCCCATTACCATAAACTTATTGTCCCATAAGCTTTCTGTCTAACCTTTCAAG
TTGCTGTTGTCAATTTGATCTTATATAAATAGTTCTTTAAAAGAGCACAATGCTCAAAGC
AGACATACTTTACTAATTAAGCTAAATGCAGTATCTCCCTGACTGGAGACTGTCAATACC
TATTGATTCACCTTTCTTTCATCCCAGACTCTCTACCACTGAAATATATGTGTTGGGATT
TAGGCAGATAGTTTGTCCATTCAAGATTTCTTGCCTATCCCTAATCCTGCTGGAAAGTTA
GGTTGTGTATGTATTCTTGTAATCCAGCCTCTATTTTAGTGTGTGTGTGTTAGAGAGTAA
AGAGGGGAGATTAACTCCATGTTTGGGTTCAGCACAGTTTCCGTAATTGTTTTGGGTAGG
GAATCTAGGTTAACTGCACAGAATTTAACCACTTCAGGTTCTTCCAGGTCTGCCCTGCTT
GAGAGAATGCCAGTCATGGAAAAAGTAACCACGAAATGGCCCTACTGAGATTGTGCAGAC
AAATGGCGAGACAGAACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNAGAGTATCACTGTAGCATATAATTTCTACTCTTAATTAATG
GCAGTATAAAGTATAACTGAAAAGGTAAATGACTCCTTTAAAAGTATAATGGAGAATTAA
CGGTGTGCGTGACCTCGAGTAGAAAATAGCTGTACGATAATGGTGCTGGGTGGTCATCTA
GACTCATTATGACAGGCTATATTAATTTTTTCCTAATACAGCAGCCAGAGCTTGTGGTTT
TTAATCTGTGGCTTAACAGAATTTCAAAATATTACTTGTCGTGTACCTTCAAATCACTCA
GAGATGGTCAGTTTCAAATCCTCAGATGCCAAAGGTATACTGAATATAAGAAACAAAAAC
AGTCCCAGTCTATCTATCGATGAGGTGCTTCACTTAACATATTAGCATTTCCCAGATTAG
TACATACTCTTCATAATTTTAATTTTGAATGGCTGTCTACTTTTTTACCAAAAAGTTCAT
ACCATTATTTCCTCAGTTTCTTACTGTTAGGCATTTTGTTTCTGGATTTTTCTTACCATA
AATAATGTCTCAACGAATATCATCATCACATCATTTTGTCCTTATGTTGGATTACTTACT
TAGACTAAATTACTTAACCTTTCTGAATGTGTTTAAAATAAGGATAATAAATATTTACTT
CATAGGGTCTTTGTGAATGGTGGCTCATTCAGTAATGATGTATAGTAGGGACTTGGCAAA
TGTAATTTACCTTTTCCCCAATGTAGTTTCACTGTATGTGACTATTATAATTTTAAGAAA
GGTTTTTCCTAATTGGTATAAAATTGGCCCTATTAATTTTTATGTCTTTGGTTACATGGA
ATGTTTAATATTTATCCATATATTTGCATTATATATGTTTCCTTTTGTATGTTTCTTTTG
TATCCTTAACATGTTTATCATGAGGTAAATGAGCTCCTTGTTTTAGCTCCTTGTACTTCA
CTTAGCCAACTTCTACCATCCTTGCTAAGTTTTGGAATTTTTTTTCCCCCTAGTGGTATT
TCTTTTTTGAAAGATATTCTAGTCTTCCTTTATTTCATGCTTTTTAAAAATGATATATTT
TCACTTAATTTTTATAAACAGTTTGAAATTTGACCTTAAAATGTGTTTTTTTAATTTTAC
TGAATTTTCTTATCCCTCTTCTTAGAGTCATGGTTTCTCTTAGTTTATGGTCATGCTCTG
TAACTTGTCTTCTGTTGTTTAATCCTCTACTTGTTCTTACTTGGAAGGATCAAATAAGAA
TGGTAATCTGTTTCTTTCTCCAATAGCACTCCATACCTCCCCTTGTGGGGGTGTGTATGT
GTGTGTGTTTGTAAATTTTATTATGCAGTATTTAACATCTACAAAATTGAATATATGCTT
TGATCTACCTAGCCTGTAAAATAAAACATTATTAGGAGAGTTGATGTTACCTGTGTACTT
CCCCCATCATCCCCTTCCCTCTTGACCTCAGAGGTAACTACTGTCTGTCCTAGAGAACCC
TTGGTTTTTACCATTTCCGTGTATTTCTTGATACTTTTACTATATTTGTATATCTTATCT
CGAACAATGTTTAGTATCATTTTGTCAGTTTTTGTCTTTATATAAATGATATCCAACTGA
TTGTTCTTTTGTACCTTGGTGTTTTTTTGTGGAACGATTTATTTGTGAATAATTAGTGTT
AAATGTATTTCTAATGCTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNGGTGGGCATTTTGGTTGTTTTTAATACTTTGATGTTAGAAACCACTCTTGTTTTGAAC
ACTTTTTTGTACATGTCTCCTTGTGTACGTATGTAAGAATTAATCAAAAGGATTCTGAAG
AAAGGCAATGGTTCTCCACTGGGGAGATTTTGCCTCTCAGGGGAGATTTGGCAATGTCTG
GAGACGTTTTTGGTTGTCACAACTAGAAGTATACTACTGACATCAAGAGGGTAGAGGCCA
GGGATGCTGTTAAACATCCTACAATGCACAGAACAGACCCCTAATTCCCCCGCAACAAAA
AAATTTCTACCTTAAAATGTCATTAATGTTGAGGTTGAGGAACCCTGGTTTAAGGGTCTT
CTCATATTCAATTCTACTGTTGCCAAATTTTTCTCCAGCTTGGCTGAACCAGTTTACATT
ATAAGAGCACAGCTTAAAAGTTTCCATTGCTTCCTATTCTTAACAATACCTCGTATTATC
AGACCTTGGAATTTTTGCCATTCTGATGAATGTGAAGTGATCTTGTTGTAGTTTCAAATT
CCATTTCCTTCATTACGGTAATATTTTTTTTTTTTATAAGGTTCCCTTTTCATTCTTTTT
CAGTGAATTGCTTGTTCATATCTCTTGTCCCTTTTTAATTGGGTTATCTTTTTCTTATTG
ACTTATTTAAAAGATATAGTTCTGGACACTCATCCGTTCTTTATCATGTAGCAAACAGTT
TCTTCTGCGTGTGGATTCTCTTTTTACTTTTTTGTAGTATTTTTTTTAATGANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
GATCTTCCGTGGAAATGTTTCTTGTAGGTGCTCCAGCTGTTGCTCCTGCCCCTGCCTCAG
TCCCACAAATATCCCAGCCCCCCTTCTTGTTGGATGGGCTTTCATCACAGCCTCTCTTCA
ATGACATCACTTCAGGTAGGATTACCATTGTTACCCTCATTCCATGGAACATTGAGCAAT
GGTGGTGGTTATTGAAGAAAGAAGTAATAATTCTGCAAGCATTAGGCTCAATACAATTAG
ACTGATTATCCTGTGGTTTCCCAGGCATCCCCTCCATCACAGCATACAGTAAGAATGGCC
TGAAGATAGAATTTACCTTTGAACGGTCAAACACCAACCCCAGTGTCACAGTGATAACGA
TACAGGCCTCCAACAGCACAGAGCTAGACATGACGGACTTTGTTTTCCAGGCTGCAGTAC
CAAAGGTACTATAATGTCTTCTTTGCCTTTTTCTTTTGATTAAAGATTGGCTGATTTTTT
ACATGTGTTTGATAAGGGATGTATTTTAATGTTTAGAGATTAAACTAAATTTTCAGATTT
AACCCAAACTAATGATATTTTAACTAGCATGGTTCATTGAAACATGTTACTTTTACTGAA
TAATTTTTACTTGGTCACAAATATTTTTATAGTTAGAATTATAAGAAAAAGAAAGGAAAT
TCTAGTGGTTAATTAGAGAACAAAATTCTACCAAAAGGTGGTCAGCTAACGCTCAGGACA
TCGAGGATAGTTTGGGTTCAGTAAAACAGTGGTAAAGACCTAAGAAAGTGTAAAATCCAC
CATACAATTAAAGTTAATTAGATGAGGGACTTTGTCTATCTGGTATTCTCTTCTAGTTAG
TCACTAGATCAGAATTAAAATTTTTCATCTCTTGATACAGAAGTGATAGAAACATTCTTC
CTCATTGACATCTAGTTCGTTATTGATACAGTGCTTATTTTCATGAATTAGGGTTTTATT
TATACAAAGTCTTAGTTTAAGGAATAAACATAAATATTTGTTTATTTTGAATAAACAAAA
TTTAGAATTAAGGATCAGCTAAGTTTTTCGGTAAAAGACCACATAGTATTTTAGGCTGTA
CGGTTTCTGTTGCATCTACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTTTTCGGTAAAAGACCACATAGTATTTAGCTGTA
CGATTCTGTTGCATCTACTCACTCTGTCATAGTACAATGCAAAAGCAGTTATACTCACTA
TATAAATGAATGAGCATGTCTCTGTTCCAATAAAACTTTATTTACAAAAACAGGTGGTAG
GCCACCCCTGTTTTAAACTAAACTAACCCAGTTTTTGCAATGATACATGAAGTATGACAT
TCAGTTAACACACTTTTGGCACTTGAAGCTATCTTCCTTTATCACTGCCTTTGTAACCTT
TTTTGCTTGTACACTTTAGAAGCTAGAGTAGTATAGATGTTTTAGAAGCTTTAGAATGAA
GTGGTTAAGAATGTGAGCTTTGGAACCATTCTGTTTGGATTCCAGTACTATTTGTATGAC
CTTACGTAAATTAATTAACTTTTATGCCTCGGTTTCTTCACTTACGAAGGGATAATGATA
CTTCATAAGGTTTCTGTTTTCAGCACTTCCCATGTGTTTAGTACTCAATAAATGTTCGCT
GTAGTAACTTAGGGTTTTATGTTTATTACTTCAGGCTACTGTTTTAGTAGCATATCATCT
CTGCTAGTAAGCCATGGCCTTATCCTTGGTGCTGTATTTGCACAGTGCCTGTTTATATAT
CATAATGATGTATCTTGAACTTAAAATTGCATATTTCATAGCTCCTACTATGCACTCTTT
TCACTTTTTAATATCTCTGAAATTGCGGTGCATTTTAAAATTGATAGCTTGTCATAGTTT
AATTGACAGCATTCTCAAAAACCAAAAAAAACCAAACCCATTGCCATCGAGTTGATTCCG
ACTCATAGCAACCCTATAGGACAGAGTAGAACTGCTCCCACATTGTTTCCAAGGAGCACC
TGGCAGATTTGTACTGCCAACCTTTTGGTTAGCAGCCATAGCACTTAACCGCTATGCCAC
CAGGGTTTCCACAGCATTCTCAGTAGTACGTAAATAATGGTGTGAATTACAGTTGATGAC
ATCTTATCTTTAATGAAATATAGCATAATTAGTAATGTTTTAGCTTACATACTGTGTCTT
GATAGTAGGATTATATTGTTGTTGTTAGTTGCTGTGGAGTTAATTCCGACTCAAAGCAAC
CCCGTGTGTACTGAATAGAACTGCTCCGCGAGTTTTTTTTGTTTTTTAATATTTTATTGT
ATTTTTGGTGAAGGTATTGTAACAAAACAGGTTCCCATTCAACAATTTGTACACATAATG
TTCAGTGACATTTGTTATATTCTTAATATTGTGTCAACATTCACGTTTCTGTTGTAATTC
CACTCCCCAACATTCTCACCCATGATATTGAGTAACTGTTGCCAATTTGGTATCGTATAG
ATAATTCTTAAAAGGTACTCAAGGGTGACATGCTTTACTTTTTGAGCTAACAGGTGACTT
CAGGGGATAGTTTTAAGCCAAAAATAGGTGCTTATTTTAAACCACAGGTACTCCTTTTTC
ACCTGCATAGTTGATGAGAATTACTATCAAGTGAAGTTGCTAGCACAAGAATTGTTCACC
TTTTGAAAAGTGGATGGCTAAAGTTCATTCTGCCAGAAAGGGGAGAGTGGCTCATTGCTA
GTTTTCACGATCAAAGACCTAACAATGGGTTTTACAGGCACCGTAAAGTGACAGCCCACA
TACTATGAACTGCTGATATCTGGAAAACAAATAGAACTAAGTAGTAGGCAAATCTCTTAC
TTCAACCATCATCTGCGTGTCTTAACTTTTAAAAAAAAATTTGACATCTCTGATGTGGTT
ATTAAGTTTATTACTTTTTCTGAAGAGTGCTCTTTTTCCCCTCTAGACATTCCAGCTGCA
GCTTCTGTCACCTAGCAGCAGCATTGTCCCTGCATTTAATACAGGGACCATCACACAAGT
CATTAAAGTTCTGAACCCTCAGAAGGTGAGTAGCACATTTGAAGTCAATATCTGTTGCAA
GATGTAAGCATGCCTTATGAAATAAAATTCTGCTTTGTTTCTCTGGGTTTTTCTGACTTA
CAAAGAGATCTGTGAAAATGTCTGGTCCAGCCTCCTTGTTTTGGATAAAAACTGAGCCCA
GAGATATTAAATGACTTAATGGCATTTTATTAAAATGTACCTTTAAATATGTTGTGTTTA
TTAAGTATGCATAGCAAAAGTGGTGGCATTTTTATAAAGCAGCCAAATGAAAAATAGCTT
TAGAAACTGAAATAAAATTAAGCAATATTTTTATTATATCTTCTGAAAGAGATAAATTAG
CTCCTGTAAATAGTAATCAATTGCCTGATTTCCAGTTTTTGAAGACGGTTCACAAAATTT
CTTCACATTGAAAGATTTCTAGTAGTTTCCCATAAATACCAGTATGATTTCTTCTTGTAA
CAATTTGCTTTTCCTTTGCTCTATTCACTGTGGTTGCAGCATTTGTCTGTAGAACATGCA
CAAATTACTTTGACAATCCAATACACAGAGTAAAAATTTTCTTAGTGCATTAATATTTGA
AATCTGCTACATAGAGTGAAGATTATTTATAATTGAGTTCTCTTAAAACAACTGCTGCTA
CCTGTAAGTTAACTTTTTTTTTTGCCTTGGGAGTGAAACAAACGTATGTCTGTTAGCATT
TACTATAGGTTTTGCAGACAAGGCAGTAATACATATTAATGTAGAACATAANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1201, 10670..10794, 16204..16345, 17926..18022, 19232..19308, 22404..22499, 23221..23301, 23487..23585, 25573..25628, 26857..26970, 28992..29109, 29112..29131, 29872..29926, 32877..32999, 33187..33276, 33889..34016, 35017..35121, 35927..35971, 35973..36015, 36118..36171, 36272..36398, 39747..39854, 39984..40144, 43306..43404
1001..1201, 10670..10794, 16204..16345, 17926..18022, 19232..19308, 22404..22499, 23221..23301, 23487..23585, 25573..25628, 26857..26970, 28992..29109, 29112..29131, 29872..29926, 32877..32999, 33187..33276, 33889..34016, 35017..35121, 35927..35971, 35973..36015, 36118..36171, 36272..36398, 39747..39854, 39984..40144, 43306..43404
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved