Loxodonta_africana Locus RPL30
snOPY snoRNA Orthological Gene Database
Loxodonta_africana RPL30
Loxodonta_africana
RPL30
GeneScaffold_4673
SNORA72
3466..3597
4873
GCACAGGTCCTCACATATACTAGCTATTTATTTATCTGCTTATTTATTTTGGTTCCCCA
TCTCTCCCATTCTCCAGGACAAGACGACAGTAGGGAAACCACACGCGAAGCTGCTTACCT
ACTGGTCTGGTTATACACTGGGCGCGGGGGGGGGGGGGCCGGGGGGCGGTGGTGTTTTCA
GAGCCCAATATTTTGCATGCCCCGTCACTGGGCATTTATACAAAGGTCTAACGTTCACAG
AAAAAAGATTTTTTTTAACCGGACCGGTTTATTGCTGTCTGTGCAAATTCGGCTTACAAG
TGCACACTGAAACAACCGCAAGAGGCAAGTCTGAGGAGAGACCTCAGGGCGTCACCGTTC
TCCGAGGGACCTGAAACTTGAGTGAGCGCAGGGGAGTGGACGCAGCTGCTTCTGCTCGGC
AGGACTGATCACCGGGGAAACCCGGGATTCCAGCAGAATGCTCCCAAAGTCTTCCCAAGA
CGAGCCTTCCGGCAAGGATGAGATCAGCTGCGTTACACAACAGTGGTCGCAGCTGCGGCC
ACTTCTTAGCGCCCCTCCATTGCAACCACAGCCGGTTTCTGCAATCCCGCCCGGTCCGAG
GTTCCTACGCCCGCAGCTCAGAGCAGCAGAGCCACACAGCGAGGAGAGGCTTGAGGCTGG
CACCTGTAGCAAGCCAACAACACAGCCACCACCCCAACTAGCGGTAACAGTAGCAACCAG
AAGCTACCCTCCACTTCTAACCCCGCCCCTTCCGCACTCGATTTACTTCCGCTTCCGGTC
CCAGTGTCCCTGCTCAGCCGTGAAGAGCTTTGCATTGTGGGAGTTCCTTCTTTTCTCCCT
CCCCGGCCATCTTGGCGGCTGCTCTTGGTGAGTGGGCTCCACCAAGGCTCGGTTTAAGCA
CTGTGGAGAGCATTGTGCCGTTTGGGTTCCGGATCCTAAACTTCTTGTGTTGTCCTCTGT
ATGTTTTAGATTGGGGGCCGCCCCACACCTAAGGCAGGAGGATGGTGGCCGCAAAGAAGA
CGGTGAGTGAGGCGGGCCAGGGCCCGAGGTGGATTCACGTGGAGAGATGAGGCCCGGACG
GGCGGGCAAATCTGGGCACACCGGGGAGACAGCATGTCCGCTGGCATTTGGAGGGCCCCA
GAGGGAACCCGACAGACCCTTTCAGTGACTTGGGACCTTCGACTTCGGTGGCTTTATTAG
GGGCTCAGGCTTCCGGAAAGCTGGATCCACTTGAGCTGGTTGCAGACGAGGCATTCAGGT
CCGTGTTAAATGTTTGCTTTGTTTGTAGAAAAAGTCGCTGGAGTCGATCAACTCTAGGCT
CCAACTCGTTATGAAAAGTGGGAAGTACGTTCTGGGGTACAAGCAGACTCTGAAGATGAT
CAGGCAAGGCAAAGCGAAACTGGTCATCCTCGCCAACAACTGCCCGGCCTTGAGGTAATC
GAAGGAACATGAGTGTGTCGCCTTGCTGGCGGCAGATTTATCGTGAGCGAATATCCAGGA
GTGTAAACTTGTCATCTGGGTAGCTTGAAATCGGTTTTATGTAAAACTTGTTTCGTAAGC
AGGCACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTTGATTTTTCTATGGTAATGCA
TAACCTGCTTAAAGCATCATATCAGGTGTCTGTGCTTAAGTGGCAAAGCCTCAAGGGCCG
TTCTATAGCAGTGCTTCTCAAACGTAAATGTGCATGTGAATCGTATTGGTGATCCTGTTC
TGATTCAGTGGGTGTGGGAATGGGCCTTGGAGTATGCATTTCTAACAAGCCCCTTGTAAA
CACTGTTGCAGGTCTTTGGACTCTAAAATTTAGTGGCAGGGTTCTGTAGGACTCCTTTCA
AAATCTTCAAACCATTAGTATCTGTGTCTACTCAACTGACACAAATTACTCTGCCCAATG
TTAAGTCCTTGGATAAGTAATCATATCACTTCCTCGTCTAGGATTCAGGGCAGCAAAGGG
TGATAGAAATAGCTTATCTTTTAAGGTCTTGGGTGTGATTCTGGATCCTCTGCTTATTCC
AAGCCTAAATTTCTTCGATAGCTTAAGAAAGGGGGAGTATATAATATCTACTTTAGAGGT
TGTCATGGTTGTAAAGTGTCAGGCACATAGTAAGTAAATGATGGTTCCCTTTCTTTTTTT
TTTATTTTGCATTCTACCATCTTTTTCATAAGTGTAGATACTGTCTTAAACATATTAGGT
GTTCAATAGATATTTGCTGGTTGCCAAGAAACTGAAAATCTGTATCTTGTAAGGGATCCG
AGAAAAGGTTGGCTTGTATTTGTTAATGTGTATGATGGTGTGTTTTTAAGAGTAATACAG
GGTTTAGTTACTGCTTCAAGGCCTCGTCAACATTAAAACTAAAAAGAAAAGTAGTAACAT
TCTATAAGGCACTTGGTGTGGCATTTATTTGCCTTTTTTTCATTTCCCAAGGAAATCTGA
AATAGAGTACTATGCTATGTTGGCCAAAACTGGTGTCCATCACTACAGTGGCAATAATAT
TGAATTGGGTACAGCGTGTGGAAAATACTACAGGGTATGCACACTGGCTATCATTGACCC
AGGTATGCTTTCTAACTCAGACTCATTTTAGTTTTTTCCTTTTTTATGTAATACAAATAT
TTGCTATATTAATCTCTTAGGCTCCTGAGTTCAGCTATTGAGAATTTGGATAGCGGGGGG
TATGTTCTAGTGTATTTCAGCGAATTAACGAATGTATCAGTATATTATAATCGGCTTTGT
TAAAAAATAGCTTTTTTTTTTTTAACTTTGAGAGCATTAAATAGTGACCGTGGAATTAAT
AGTTTATGTTGGATGGGAGAAGTTGGTTTACCTACCTCTAAAATTCCACAGAAGAAAATA
CAGAAATTGTGGATTGTCAGAATTTTTTTTTTTAAAAAGCTCTGTGTTTGGAGACTAGGA
ACTTGCAAAAGGTGTAACTGTAAAGGGGTAAATAATCAGATGAAATAAGTAGAGGAAAAT
AATTCTTACAGTCTAGGAACATACAGGTAAAATTAGAAATATAAATACCTACAAATATAT
GCATATTTTGAATTTATGAAATTTTAGTTAATTCATAATATACATATGGCGAATATTCTC
GCTGTCCTGATTTTGTGATAATCAGGGCAGGCTAAACATTCGCTATAGTAAAACCATGCA
TGTGTCCCCAGACCTAGTTCTTTACCTAGGTCTGGTTTTATAAATGCTGGTGATAAACCA
AGTCTGATTTACTATACAACCATCTTGTGTAGGAAATGGCTGAGACTCTAGGTATCTTTG
TTCAAGCTTCAGAGAAATGACAATATAGCTAGTTAAAAAATGTGAAAATAACCAGTGCTA
ATTTTCAGAGCTATGCTTAAAGAAGGCATAAACACAGAAGGGATATTTTGTGATAACCAG
TTGCCATTAAATGTAAAATTGCTGTGTTTTGTTTTATTTTCTAGGTGATTCTGATATCAT
TAGAAGCATGCCAGAACAGACCGGTGAAAAATAAATCATGTAATTTTTTTCTTTAATAAA
ACTCACCAGAGCTTGTATTAAAAACACTGTATCTATTTCACTTATTTTTCTTTTTATCCT
TTTGTTTCAGTACAGTTTCCTGAAGGTAGGATTAGCAGCTAGATGTGATGGCCAGTCCTT
TGGGCTAAGAGTCTTATATCCCAGTTTGTTCTCCTGTTTTGTAAAAGAAGTATACCAAGT
TCCTTTCTAGAACTAGATTTTTAAGACAATTTTCATAATTCCTATTTCGAGGCATTGTTG
GGACTTTACATTTGAATATGCTTGAGAGGCAGCAGTACCCAAAATACAGTCAGAGTTTAA
ATCTACAAATCTGAGTAGCAAAGAGGATTAAATGAATATTTCCCCACCCCCAAAATGCTT
GCATAAACAGAAAAATTTTAGTGAACTTAAGAAGGAACTTAAGAATATGCCCTTGTAGGG
GTACTTGGACATCTTCAAATTAATCCTAGGTCTTAAATCAGTGTTAAAGCCAAGATGTGT
GCTTTATAGAATTTTAGTCCTAAAAAAATCTGCTCAGTGTATTCGGTGTTGAGATTTTTT
GGAAACTGCATACTCCATCTCCCAAAAACATGTTTTGTCAGAAATTAATATTGCTACTCC
TGCTCTTTTTTGCTTATTGTTTGCATGATATCCAAAAACATGTTTTATGGAACTCTTTTC
CCACATCTGATAATATCCTTTGGAACATTCAGAGAAATTAATTTGGGGAGAAATAATAAT
TTAGTTACATTCAAAATTGACTCATTTGCTTGATTTACAGAGTTGAATTGCTTGTGTGTG
CATGTGCACTAGTTGGGTATATCCTGCTCAGTCCACCGTGTTTGGCTAGTAGAGGCTACA
GAAGTAAAAAACAAAAAATGTCTTTTCCGTATTAGATTCGATCTCTTTTGAAGGCAGCTT
TTGGTGGTAGATGATTGAGATGTAAAAATGAGGATGCCTTCTATATACTGTCTAGAAAGG
CAAACATTTACCGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1021, 1288..1433, 2811..2941, 3824..3873
1001..1021, 1288..1433, 2811..2941, 3824..3870
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved