Loxodonta_africana Locus GTF2A1
snOPY snoRNA Orthological Gene Database
Loxodonta_africana GTF2A1
Loxodonta_africana
GTF2A1
GeneScaffold_7490
SNORA79
14011..14154
44521
GAGGTATAAAATAAAAATAATGACAAATAATTTTAAGAAAGAAATGTTAACCATATGTG
TATGTGATAATAACAAGGCACCTCTAGTTTTACCAGTCTGGCTGCAAACTTCCTTTTGTC
TAACATGTTAAAAATAGGATGTGGGTTGGGCTAATTGTTCTACGTCTCACCTTTTAGTTT
TTAAAAAATATGTTTGAAAGTGGTTTTCATAGACACTCGCATTTCATCCTGGCAATCTTC
TAGAAGCCAGCTGCCAAGTACCAACAATAATAGTAATAATAATACCAAGCAATGTAGTAC
CAACAATAATATCCACCAAATAATACTAGCAATAATAGTAATAATAAATTTTGGGAGGTC
CTGGGAAAGAGATCAGTATAACCGGTTCGTCTCGGACATTGAGACCTATCGTTGTGGATA
TGGGAACAATTTAATGATAGAACTTTAAGATACAGAGTGGGTCACAGGAACAGAAATTAG
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCGAGCCTAAGTTATACAGATCTG
TGATTGAAGACGTTATTAATGATGTGAGAGACATATTTCTGGATGATGGAGTAGATGAAC
AAGTCCTGATGGAATTGAAAACTGTGAGTTGGCTTTTTTTAAAAAAAAAATTCATGCATT
TTTATCAAAACATTCTTTTTTCTAGAGACTAATCCATACTTTTTCCATAGCATGAGTGTC
TGACTTTGATGCAAGAGACAGCATTGTTTAGTGAAGGATGCTGGCTTTGGTGCACAAATA
ATTGGTTTCAAATTCTGACTCTATCATCTATTTCTCTCACCTTGGGAAAGCTATTTCCAT
TTTTCAATTTTCTTATCTGTAAGATGAGAACTAGTAGTATTTACCTTATAGGGTTGTTTA
GACGATTAAATGCAATAGCCGTAGAAAAATGCTTAGTGCAGTGTTTGGCAAAAACATGAG
CTATTATTGGGTGATTAACATTCTGCTTTATGGTCAGGTTACTTGATGTGCCTGTAACGG
TTTTTTTTTTTTTTTTTTAATAGTGTTAATGCATTTGCATTCTAAAGTGTGTTTTAAGTT
GTGGGGATTGAATAAATGCTTGATAAAAGAATTTTAGGTTCTGAGTCAGATCCTTTATGT
GGACCAAATGTTAGGTTTATAATGTATTTTATTTGGGGAGCTGGTTTTCTGTATCTGGAA
TTTAAGCAGAAATATTTAGATATTTTTATTTAGCATTTGTGTTTTCTGGTGTTACAATGA
CTCATGAAATTAAATGGAGTATTTTAGCACTATTGCTTAGAATAGTGGCTTTCAAGTATG
GTCCCTGTGTTCCTGGAGGTTCCTCTGAGACCCTTTCAGGGGGCTCATGAGGTCATTCAA
ATGCCAAGTTTGAATAACCATAGTTTATTCATCAACTTTTCAAGTAAAAGTTAGGTTCTA
TGAAAAAAAGTGGCCAGTTCAACTCACAACTCAAATGTATAAGTGCTGCTTTCCTTTAAG
CCATTTGTCACTGAAAGTGATAAATTGTTCTGAGACCAAAAAGTTTTAGAACGGCTGGCT
TAGACCTTGGATGTTCTTTTACTGCTGTGTACAAGTAAGTAATCCCAGTTAATAAATGCT
AAGGAGTATTTGTTGTGGTCTTACTTATCCATTCAACCAAGGTATAAAATGTATAACTTA
GCGACTCATTATAAATCCAAGAAATCTCACCTTTACTGTGGTTATAAAATATGTCTTAGA
GTCATAAGGAACTTCTCTAGAGTTTTCAGTAAAAATCTGCCCTTCTGAAGGAATACTAAA
TAGATTTAAGCAATGAGGAAATATTTATTTATTTGAGAGACGTGTAATGGTTACTAAAAG
GGAAGATTAAGTGTCTAAAAATTCAGGTGAGAGAATATGAACTCAGACATGAATTGGGGA
GAAACAGCAATATAAACTGCTTCAATAGCATAAAGTACCTCAGGGATATGAGTAGCAAAA
GAATAAGCTTATTTTGATTCCTTACGTGGAGTGAATATTTTGCATTTTATGTTACACTCT
TATGATTGTCCTTGTAGTTTTGTGATCTTATATAGGAGGTATAATATTTTTAGGTGTAGA
AAATCATGCTCAAAGAATTTAAATAATTTATTTTAGGTCAAACTAGTGGTCAGTTCAGGT
GTCATTATCTGTGCTTGCATATCTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCTG
TGTGCTAAATTTCTTCCAGACTGTTATTAGAACTGCAGAATGTGCCCTAGTTTTTAACAG
TGAACAGCCAGAACTGTCCAGTAGAACTGTACATGATGATGGAAGTGTTCTGTGTTTGTG
CTGTTAACTATGGCAGACACTAGACTATTAAACACCTGAAGCATGCTTAGTAGAATTGAG
AAACTGAATTTTATATTTAACTTAGTAAGACGTCACTTAACGCCCACAGTAGGTTCTGTG
AAATAGGATGTAATGTGTTTTGGACGTTGTGCAAATACCTGGGTCTTTGGGACATGGGTC
TCCCACGCACGTAGGCCTGGGGGCTGCTGTGTAGCAAGCATCCCAAGCAGCTCCCGCAGG
GGTCACCCCAGGTGAGCACCCGGCCAGGTCCTGCCTGGTGCGTGGCATGTTAAGGTCACA
GTGAGTAGGCTCCAACCTTGGGTGCTTGGGAGCAGGATCGGACGCCCACTCCTCCCAGTG
GCTCAGGTGCCTGTTCCAGTAAGTGAGAGGGTGGTGGGGCAGTAGGCATTTCCCAGAGGG
TACACGCCAGACTACAGATATATATGCAGTTGGATTTTGCCCTAACTGATGTTATGTAGT
GCATTACTGTAATTTAAATTGCCATGTGTGGCTAGTAGATAGCATATCGAACCACACAGG
TTTAGACATTCCTACTAATAAAAACTAATTTTATATTGTGTAGTTTATGAAGGGCTTTGT
TATTAGCTCCCCTCCCCTCTTTGTTTGTGTGAGGCTGTGAAGAATACACTGGTGGATTAT
GAATTAAGATGAAGGGATGAGTATATGTTATTGAAAGGGTAAGTATAGATAATGTAGGAA
GGGAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAACAACTAAAGATATAG
ATCTTTGATCAGGACAGGCACTTTTCAGTTGCGCCCAAAGGCAGGCCTCTCTCTGGCCCT
TGACCTGGCCTCTGCCTTGCTTGAGGAAGTGTTAACGAAGCTCTTTAGCTCTGCCAGTAA
GTGCCAGGAGGTACCCCACTTTGCCAGTAAGCCCTAGCCCGGAGGCGCTCAGCTCTCTAG
CTCTGTGGGTTGGCAAGCCTAGCTCTCCCAACAAGTCCCCAGAGGCACCCCAGTCCACCA
GCAAGTCTCCTGCCGAAAGGTGCTCAGCTTTCTTGCTCCTTGGCCTGGGAAACTCAGTGC
ACTATCTTAAGCCGGTCTGGTTCTGCTGCCTCTGCTGCTGCTTCTTGCCGTCTTGATGTC
TTCAGTGTTGCGACTCTTTCTCTGTCTTCTGACCTAGGAGGGTGTCAGCACAGGGATCCC
AGGTCCAAAGGACGTGCCCTGCTCCCATCTCTTCTTGGTGGTGGTCAGGTCGCCCTCTGC
TCTGGGATTGGCTCTCTTCTAAGCCTAGCACAATGGCAAAACCAACCAATCCCCTCGTTA
GGGTTCCATACACCTTATTTGTGTGGTCCCATCCCCACAAGGGTGCCATGTACCTTATTT
GTATTATGAGCAAGCTGTCCAGTCTCCTTGGTGGGCCACAGCACCTTGTTTGCATAGTCC
CAGCCAATCTTTTGGTGGAAGTTACAAGACCATAGCTAGAAAGGCCGTATAAAAGCAATT
CATTGCATTGCAGTTTTGGTGTGTGACAGTGGGTGGGAATGACAGTCTAGGATTTCTCTT
CTTCCAAAGTAAATGATAAAATCATCCTGATTTCTAGATTGTTAGACCTACCCAATGTAG
CAAATATTATGGGAGATATAAAACATGGTCCGTGTTTTCAGTAAAGCAGACAAGGTGAGA
AGAGTTTCCTCAATTGGAAATAAATCTGAAATTTAGTTAGTTTACCTCTAGATCAGGTTT
CCTAACCTTAGCACTATTGACATTTTAGACCAGATAATTCTTTGTTGCAGGGGAACGTCC
TGTTCATTGTAGGGTATTAGCAGCATCCCTGGGCTCTACCCATTAGACAACAGTAGCACC
CCTGAGTTGTGACAACCAAAAATGTCTCTAGACATTGCCAAATGTCCCTAGGGGAACAGA
ATCGCCCCTGATTGAGATCCATTGCTCTAGCTATATTCTAGTTGAATATAAATACTTGGA
CCATATGTCGAATAATCTGCAGTTCTACTTTAGTCTTCTCTGAAGGTACTTAGTAATTTT
TCTGATGAAAAGTGATAAAATTACACTTTGTGTAATTATAAGAGATTGTTACGGCATAGA
TGATGGGATCCATTGGGAGCATCTTATTACAGAGGGTTTGATTGGCACGTGGCTGTCCTG
TAGAGACAAATTAATAGAAACCAAGAGACTGATGATTGCAAATAGAGAGCAAAATATCTT
AGAAAAATAATTCATTACACTGGAGAGCCCTCTTACAGCTGTAATAGAGACTGCATTGCG
CTGCATTTTCAGGAATAAGTAATATTTCCTTTGAGATTTTGTTCAGTTCCTTTTCCCTTG
TTGTCTTTATCTTGTAATGTTGTTGTTAGTTGCTATCAAGTTGATTCCAACTCATGGTGA
CTCCGTGTGCTATGGAGTAGAACTGCTCCATAGGGCTTTCTTGGCTGTCATCATTATGGA
AGCATATCACCAGGGCTTTTCTTCCCCAGTACTGCTGGGTGGGTTTGAACTGCCAACCTT
TAGGTTACCAGTTGAGTGCAAATCATTTGCACCACCTAGGGACCTTCACCTGGTAGTAGA
GAATAGGGGTATAGAGGAGCATGTGATTTATCCTTCATTAGCATTCCTAGAAAACTGTCA
ACCATTATCTCTTCAAATACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTGGATATATCAACCAATCCCTGCAAGATGCATATCAATCACAG
GGCAGGCTGCAGCCTAGGGCCAGATAAAAAGTCAAGTTATTTACAGCTTGCCTAGGAAAT
GTCAGTCAACGTGGACAAACATAAATCCTCTGGGGTAGAAAACTAGGGCAAAGGTAACTC
CTCAGAGTTCATTTCTAGCTGAGTATACTCCCAGGAAGCCATCAGTGAGGTAGTCTAATT
ATTTACCTCAGGGAGTAGACTCCGAATATACGTTGACAAGGCCAGTTAATAAGTGGTAGA
GGCATGAACCTAGGCCTTTTGTCTCTCTATGCTATATACAATACTTACCTGGAAAAGAGA
AGTTACCAGAGCTATGACCTGATCTTGGGTTGCTGATGGGTGGTACCTGAGCTGATTTTG
AGGGGCACTTACCTGCCCTGAGAGTAGCAGTACAGTTTAGAGATAAGGAGTGTGGACTAG
AACTGGGATTACGATGAGGCAGGCAAGGCCCATAGGGTACAAAATTTAAAGAGACATGCA
CTCTCAGGGTCGTGGTCATGGCTGGAACATCGGAGTCAGACTGCCTGGGTTGTATCTTTG
TTCTGTCTGCTTTTAGTTGGTGATTGTGGGTAAGTTACCTAGCTCCTCTGTGCCCCAGCT
TCCTTTTCCTTTAAAAAATAATGAGATAATAATAATGTTTGTCTCATAAGGTTATTGTGA
AAAATGAGCATGTGATATGCATAGAAAGTACACAGTGAGAGCTCAATAAATGTTAACTGT
TATTAGTCTGACATGATATACATCTCTGAATCATTTTGGGAACAAATGATAAACTTTCGC
TATATGTAATTTCAGGGACCTGGCAAAGATGCTGAAGTAAGGCTGCCAGATTAAATAGCT
CTACTGTGTTGGGGAGAAGGGAGTACTGTAGAAATCCGGAGGAAGAATTCTAATTTTCTA
AGGAAAATAAATAACAATTTTAATATTCTTGGTTGTCTTTAAATAGTATGATTACTGCCA
CTAAAACAGTGTTAATTGTTTACTGTAAACAACTGATACTTATAAAATAGAATACGTCAA
TAAATAAAACTATATTAAAGATGAAGTTGAAGAGAAACTATAAACATTCAATTAAGTTGA
ACTTTTATATCATTTGATATAATAAGGTTAATAGTAAGTACTTGTGTGGTGTTATTTTTA
TATTCCTCACAGTAGCTAGAACAGTATTATGGCACTTCGTAAACGCAGGTTATCGGTGGG
CTACCATCTCCCAGTTCCCACCCCACCCCAGAGCTGGAAGTGTGTGGGGCCATATTTGTC
TGGCATAATGTCTAGTGGATGTGTCTGTAGCCAGGGATATTGTATTTTCTGCATGTTACA
TTTCCTGCAGGACTGTGCTGTGCAGTAGAGTTGTTCTGCCCAAAATATCAGTAGCTTCCT
TACAGAGAAACCCTATCGTAGACTATCATAGGCTGTAAAAATGGCTGTGGCGCCAAGGTG
GCATGACCTCCTCTAACTTTACAAGGAGGAAGGGAGAATCAAGATCAGCAGCCTAAGCTG
ATTCCTCTGAGGCTAGAGAGTAAGACTTACCTCCTCTCTCCAACCTTTTTACCAATTCTG
ACACCAACTGTCCCTCCCATAGCACACACTATTTCTCTGCCGAGTTCGATAATCCATTGC
AACGGTGACACAGAAACTCTCAGACAGTACGCAAGATGATGGGGTTTACTAGGGAAGTAA
CAGGTTATAGCTCAGGTTCCCGTAATGCTCAGGATACAGTTATTCCACCAGGACAGTCTC
TTCTTTGTCCCTTGGCCTCTGCCCCGCTTGGGCAATTGTTAAAAAGCTGTTTTAGCTCTG
CTAATAAGTGCCCTTGGAAACTCTATGGGGGAGTTCTACTCTGTCCTATAGGGTCGCTAT
GAGTGGGAATCGACTCGACGGCAGTGGATAATAAGTGCCCAGAGGCACACCCCACTCAAC
CAGTAAGCCTCGGCCCAGAGGCACTCACCTCTACTTACATGAGTTGGCAAACCTAGCTCC
ACCAAGTGCATAGAGACACCCTACTCTACCAGCAAGCTTCCTGCCAGCAAGCACTCAGCT
TTCTTCCCCCGTGGGCTGGGCCATCTCCTGCTGGTCTCCTGATTCTGTCACCACTGTTTC
TCTGTCACTCCTTCTCGCCATCTTTGGTGTTATGGCCTGCTCACTCGCACTCTCTCTGTC
TCCTGGTTCCCAGGAGCTTTTCAGCACAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATACTGGTCGGAGGAGAGG
ACTTGAACTGAGGCAGTAGTAGAGATAGATTCAAAAAATGCTTCGGAAGGGAAGTTGACA
GTAATGATAGGGCGTTGGAGGTGGATTCTGACTCCTCTGTGGTTCATTTGGGTGGCTAGG
GGAGTAGTGATAGCAAGCACTTAGCAGCACATAGTATGTGTTTTTAACATTTGCTATCAT
CATAAAAAAATGGAGGTCATTAAATTGAAGTGGTGGATTTCCGATTGAGGGTGATAAAGT
GAAGCATTAAATTTAGAAAATTATGGTTTTAAAAACTATTTCCTAAAGCATTAATTACTT
TTCGCCTTTTATTTTTGGCTCATAACAAGATAAGTTTGTTTTGGAAGGGGGAAAGAGATA
CAGAAGATTTAGGTGATAGCGAAGTGGTTTTTTTTTTTTTTTGCAGCCTTACTATATATT
ACATTCGTCGTAATGTGTTTTGTTCATCGTTGAAGTGCCTATTTTGTACTGTGTGCTGTG
CTAGGTGCCCAGTTTACATAGATGAAATCACATAAAACTTGGGTTCTGAAAAAGTAGGGC
TTTGCTTCCATTGGAAGAAACTAGCTGTTTTTAGTCTGGTATTTGCAGAAACTTAGAGTT
ACCATCTGTAGTTGAGTTTAGAGGTAATCTAATTCAACGTGTCCCCTTTTTTAGGTGAGA
AAAATGTCAAAGAAGGATAAATGATGTATCTTAAAGGCCAGTTAGTCAAACCAGGACAAA
CTGGTTTACTGACTTCTGGTATAATGCTGTTACACAATTAATACCACCACCACTGATAAT
AACTAACATTTAGTGATCACTGACTTTATGCTAGCCTCAGTGATAAATGTTCTACACGAC
TGTCTTCGTTGCTATTATCTCTGTAGGAGTAGACTTCAGGCAGGTGTAAGTACTTGGCCT
GCTAGAGGAATGATTGCCCTGGGAAATAAACCTTTAGTTTACTCTTCCAGTAAGCTGTCA
CGAATGTGCTGGAATTGTTACCAGTGTGTAGACATGAATCTCGAATTTCTAGAATGGCTG
TAGGGGTCAAGAATTGATAAAAACCCCCGGGAGTATGGCAGAGAGCATCTTGAAGTATCC
GATCAACACCTGAGATGAGTTAGGCAATATCTAAGAGCAGATCCTGGAGGAGAATACAAA
GTATGTGTGGGTTTGCATGTATGCGTGTGCATGTGTGTACATACAGGCATGCACACGCAG
CCCTTGCTGGTAGATCCTTGTGAACAAAATGTTGTTTCATTTGCATTTTCAAGGAACACT
TTGTGACATTCTTAGGCAATTTTCTTACAGGGTTGAGGCTCTAGATTAAGTACTAAACCT
AGTAGAGAGGAAATGTGTTAGGGAGAGGGATAGACTAGTTGCAGAATATTTTTCTTATCC
CTTCTTCCTTTGTCTGGCTGGATTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGTATGTTTGAGTTTTGTAATATGTCTTAACACTGGAAGATACAAAA
AGGCAATGTGAACACTCAATCTCATAGTAATTTATGTCATTCTAAATTGACCGAATTATA
TTTATTTATGTGAAGAGGGAGTATATTCATATTTTAATATTTATGTGAATTTGATTTATA
GATAAGAAAAGACTAGTTGATTGACTGTGTCCATAGTGCTTTCTACTATGGAAAACATTT
TATAAATGTTTCATTGAGGCCTTGCAAAGGCTTTGTGAAGTAGCTCTTAACTCCATTTTA
CAGCTAAGAAAAATCTGGGACATGAAAAGGCTAAGAAACTTGATCCATTATTTATAACAA
GTATTTTCTTTGGCGACAGACATTCAGTTATAAAACTACTGGACATTCTAATTCAGTAAA
TCTTTTGAATGTTTATTGAAGGTAACTGAGAAATTTACTTTAAAGCATCCATTTAGTTAC
CTGTGTCATCTGAGAATACATGTAAGACTTAAAATTGGTAACGATAGACAGTACACCTTG
TTAGGTTATTTTACTGTTTATATCAGGTAAGACTTTTAATATTTGATTTTAATCTGTTCC
TTGCATTCAGTAATACCCTTTTAGTTTATTTTGATGACTGTTCCTCCTATTGCCTTCAGA
CCTGGCACTAGGATTTTAGGTCATCATAGATCAAAATGTGATTTTCTTCACTCAGAGAAT
ATTAGGATAATGGGATTATCTGTCTATTCTCTGAAATTTGTGGAATCAAACAGCTCCTTT
TACACTTACGTAAGATTGCCATTATTTCTGATTTGCATTTAAAAAAAAAAAACTTTTGTT
GTGCTTTAAGTGAAAGTTTACAAATCAAGTCAGTCTCTCACACAAAAACTTAAGTACACC
TTGATAGATATTCCCAATTGCTCCTCCCCCAAATGAGACAGCCNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGCTCTTATTTCTCTAGGGTATTTTCTGAGGAGTG
GGATTGCTGGATCGTATGGTAGTTCTATTTCTAGCTTTTTAAGGAAGCACCAAATCGATT
TCCAAAGTGGTTTTACCCTTTGACATTCCCACCAGCAGTGTAGAAGTGTTCCAATCTCTC
CACAGCCTCTCCAACATTTATTATTTTGTGTTTTTTGGATTAATGCCAGCCTTGTTGGAG
TGAGATGAAATCTCATTGTAGTTTTGATCTGCATTCTCTAACGGCTAATGATCGTGAACA
TGTCCTCATATATCTGTTAGCTACCTGAATGTCTTCTTTAGTGAAGTGTCTATTCGTATC
TTTTGCCCATTTTTTAATTGGGTTATTTGTCTTTTTGCAGTTGAGTTTTTCCAGTATCAT
GTAGACTTTAGAGATCAAGCACTGATCAGAAATGTCATAGCTAAAAACTTTTTCCCAGTC
TGTAGGTAGTCTTTTTATTCTTTTGGTGAAGTCTTTGGATGAGCATAGATGTTTGATTTT
TAGGAGCTCCCAGTTATCTAGTTTTTCTTCTGCATTCTTTATAATATTTTGTATACTGTT
TATGCCACGTATTAGGACTCCTAATATTGTCCCTATTTTTTCTTCCATGATATTTATCAT
TTTAGATTTTATATTTAGGTCTTTGATCCATTTTGAGTTAGTTTTTATGCATGGAGTGAG
GTATGGGTCTTGTTTCATTTTTTTGCAGATGGATATCCAGTTCTGCCAGCACCATTTGTT
CAAAAGACTGTCTTTTCCCCATTTAACTGTTTTGGGGCCTTTGTCAAATATCAGCTGCTC
ATATGTGGATAGATTTATGTCTGGGTTCTCAATTCTGTTCCATTGGTCCATGTATCTGTT
GTTGTACCAGTACCAGGCTGTTTTGACTACTGTGACAGTATAATAGGTTCTAAAATCAGG
TAAAGTAAGGCCTCCCATTTTGTTCTTTTTCAGTAATGCCTTATTTATCCAGGGCCTCTT
TCCCTTCCATATGAAGTTGGTGATTTGTTTCTCCATCTCATTAAAGAATGTCCTTGGGAT
TTGGATTGATTTGCATTTTTTAAAGTTGATGGAAGTAACTTGTGATTATGAGAACTATCA
AATCAGGAGAAAAAAACTGTAGATTTTCAAAAAGTAGATTTTTTTCACCTAAATTTTATT
TACTGTTGTTGAGAATATATACAACAAAACATTTATCAATGCAGCAGTTTCTGTATGTAC
GATTTAATGACATTGATTACATTCTTTGAGTTGTGTAACCATTCTCACCCTCCTTTTCTG
AGTTGTTCCTCCCTCACTAACAAAATCACTGTCGCCTAAGGTTCCTATCTAATCTTTCGA
GTTGCTCCTGTCAGTTTGATTTTGTGTAGGTGGTTCTTAAAAGAGCATAATGCTCAAGGC
AGACCTTTTTCACTAGTTAAGCTAAATTGTTGTTTGGTTTCAAGATGACTTCAGGGGATA
TTTTTGGTTTAAGGTTTAAAGATTATCTCAGGGCAGTAGTTTCAGGGGTTTGTTTACCCT
TCATGGCACCAGAAAGTCTAGAGCCCATGAGAATTTCAAGTTCTGTTCTACATTTTCCCT
CTTCTGATCAGAATTATCCTATGGAATCTTTGATGAAAATGTTTAGTAATGGTAGAGTAC
CATCCACTTCTGGTCTCACGGCAAAGGAGGCATTTGTTCATCGAGGCAATTAGCCACATA
TTCCATAGCCTTCTTCTATTCCTGAGTCTCCTTCCTCTTTTGCTCCAGGTGAATAGAGAC
CAAATGTTGTGCCTTGGGTGGCTGCTTGTAAGCCTTTAAGACCCCAGGCACTACACAGCA
AACCAGGAGGTAGAACAGAAGCACTGAACACATTATTAGGCCATGTAACTGGGGTGTCCC
ATAAAGTCATTACCCTAAACCTTCAAACCAAGGAACCAAATCCCATGAGGTGTCTGGTTG
TACATAAGTAGCCTCAGCAGCTGGTCTTTTTTTTTTTGGTCATTGTTGCAGATAGATCTA
TAATATAATTTTTGCCAATTCAACTTAAAAAAATTTTTTTTTTTTAGCTCATTCTTAATG
GGTTAGCAACTCCTTCCAATAATGGCATAATTCTATCAGTAAAACAGTTACTGCTGAGTC
AGCAAGACAAGGTTAAATTATGTTTGAAAACATGATTCAGAAAGCACAGAAATGTGTATG
TTTAGGTGTTACAGTCCTGCAGTGTAGAGAATGAATCTAACTGTCATATTTCTAAGTTCC
CTGGCATCCTTAGTATCTTTTCTATTCATGTTTTCCAGTATACGGTGAGTATATCACAGC
AGTTATTTGCCATAAAAACTTAAAATGTTCTGAGATACCAAATGATTGATTACATTTGAA
TGCAGAAAATGTGGAAAACATGGAAAAAGAAGCATTGTGTAGCTTTTCTGTGATTATGAA
ATAGCCTCCTGTTTCCTTATTTGCATGTGTGCCTGTGTTTTTTTGTAGCCACAGCACCAC
AAGTTATTGTTCCTGATTCTAAGCTAATACAACATATGAATGCATCAAACATGGTAAGAT
TCAGAGCTGAGCATTTTGGCTATACTTGTTTTAACTCACATTGTGACTATGCCTAGGTAT
GTTTATTAACAACATGAAGTTTATTCAGGATGTGAGCAAAAACAGCATTTTTTCTTAGTT
TCCTAAGTACTAGATTTTGCAGCAGATCTAAAGTTTAGCTTGATACTTAAACATTGAAGT
CAGTAAAAATAAGCAGTGTTCCTATTAAAAATATGAAAAGAATTTGATGCTTTGTGGGAG
CAATTTCATCCTCTGCTGTGTTTGGTAGGGGGACCCACCAGAGTAGTTATGCCATGTATA
GTTCTTTTTTTAGAAGATCCATTAATTTCCAGAGGCTCAGTAAAGCTAAGAATTAAAAGC
TTTTTGAAAATGAAACAAACTGGATAGATGAAGATGACTATTTTTTAAGATTCAAACTTG
AAAAAACTTTTGCTGTGATCTCACTGTAGTATAGCCTAATAAGTTTTATTAAAATATGTA
AAAGGTATACATTAGTGCTTTTGATATTTCTGAGAGATTTCACAGGTCCTTCGATTTTCA
AATATCACTTAGAGTATATATGCCCCATCAAACGTACTGAAGTATAACTAAAATTGAAAG
AAAGCCATCTTTTCTTGTATGCTTAAAGTTTTTTTTTTTTTTTTTTTAAATAAGGCAGTA
AAACAAAGTCTGATTAGAGTAGCTGTTCCAGCAAATTCTAACAAGTGGCTCTTCCTTATT
CTGTTTAAAATATAGAGACTATTAAAGTCTCTAAGGAAACCCTGGTGGCATAGTGGTTAA
GTGCTACGGCTGCTAACCAAAGGATGGGCAGTTCGAATCCACCAGACACTCCTTGGAAAC
TCTATGGGGCAGTTCTACTCTGTCCTATAGGGTCGCTATGAGTTGGAATCGACTCGACAG
CAGTGAGTTTGGTTTTTTGGTTAATGTCTCTAAAATCTCTGACATTTCATTCTTAAATTT
AGCCAGAACTTAAAGCTAAGAATCCTTATTTTTAGAAATATCTCATAGTTTATGTAAATA
ATGCTAACAATGAGTTTTTTGTTTTCCTCCAGTTCCAGATTTTTTTATTAAAAAAAATCA
TTTCTGTGTGAGTAATGAGTTGTGAACCACAAAGCTCATCTGTAATTTCTATAACAGATA
AAACAGGGTTCACCAACTACATAAGTGACTTCCTTCTACACGTATCAGCCATACAAATTC
ATACCTTGGCGGATTCCAGATTTCTTTATGATTTTCCGAACTGCTAGGGAATTACAAAAA
TTGAAGTTTTTAAATTGACAAGTATCAAAGATTTCTGTTTGTACTTATAGTTCAAGTTAT
GAGAATCAGTTCTTTTGCATGAAAATCACAAACTCCCCTGCCTGTCATTTCTCAGAATAG
TTTGTTATCTGAAACATTTCCATTTCAAGTCTGAGGCCTAAAATTTCTTTCTAATCCCTC
TCCTTTAAGCCTCGCCTTAGGATCCCTACTTCAGCTGGTGTTACTAAAACTGTTTCCCAA
GAAGGAACCCACATCATTTAAAATCAAATTTGGTAGAATCACCAGCAGTGGGCCCATCTA
ATTTCAGACAATTTTAAATATTGAGGGAGAACCTTTTGAACTGAAATTGTGATGAAAGAG
ACTGGGCAGAATCAGTGGCATATCTCTGATCGATTAGGTCTCATTGATTCTAAGTTGCTG
TTGAGTAGACTATGATTCATGGTGACTCCATACGTCAGAGCAGAACTGTGCTTCATAGGC
TTTTTAGTAGCTGAGTTTTCAAAGTAGATTGCCTAGGCTTTTTTCTGAGGTGCCTTTTTC
TGGGTAGACTCAGACCGCCAACCTTTCGGTTAGCAGCCGAGCATATTAACAGTTTGCACC
ACCCAAGAACTCCCATTGATTCTAAAGAACAACATATTTAAACAGATCATAGGCCAGAGA
CTTCAATAAAATGGATTAACATTTATGTATATTTCAGCATTGTGATATTTTCATTGTTTG
CTCCATGTTATTTTACATGTTGTGAAACATAGTCAAGATAGGCTCTTTACCAAGAAAACT
TTTTTGTTTGCATTATTCTTGATTCAAAGAAATCTGTTAAACATAGTTTTGATTTTGCTG
GTGGTTCTGTACGCTTTGGAAATGAACATATTGAAAACTTAGTGATTTTATGAAAACGTG
AGATCCCCATTGCCTTTGTGTCAATTCCAAGCAATAACAATCCTATAGGATAGAGTACAG
CTGCCTCCTAGGGTTTCCAAGACTCTAATCTTTATAGATGCAGAAGGCCACATCCTTGCT
CCCACGGAGCTGCTGGTGGGTCTGAACTGCCAACCTTTCAGTTAGCAGTGGAGTGCTTAA
GGACTGAGCCAAATGTGAGATAGTGATAATGTTAGATGGAAAGCTCTTTCAAGGAACTTA
TAATACAGGAGGGAAACCCTGATGGCGTAGTGGTTAAGAGCTACAGCTGCTGACCAAAAG
GTTGGCAGTTGGAATCTGCCAGGTGCTCCTTGGAAACCCTGTGGGGCAGTTCTCCTGTGT
CTTGTAGAGTCACTAGGAGTTGGAATTGACTTGATGGCAGTGTTTTTTTTTTTTGTATAA
TACAGGAAAGGAGCACTGGTGGCACAGTGGTTAAGCACTAGGCTGCTAACTGGAATGTAG
GCAGTTTGAACCCACCAGCCGCTTCATGGGAGAAAGATGTGGCAGCAGTCAGCTTCTGTA
AAGATTACACGTTTGGAAACCTTATGGGCAGTTCTCGTGTGTCCTGCGGGGTTGCTGTGA
GTTGGAATTGATGGCAATGGGTATAAAACAGGACCTTATCAAAGCAGTTTTACAGTTTCT
CTTTATGAAATGATTGGTCTAATTTATTATTTATGTTTGGGTTATTTCTTAAAAAACAGA
AAAAATTTCAGTAGTCTTTAAAGTGTGTTGAGTTATGATACATCACTCAACAAATGCTTA
TTGAGCACCTTGGATATGCAGAAGGTATGCATGTGATTATTGTGACATCTATGCCGTGTA
GATCCATGGGGGAAAGATTGGACAGTTTGCCTCAGGGATCCAAGAAAACCTTATGAGGCA
GTTCTGCTCTATCACATGGAGTCACTATGAGTTGAAGCTGACTCGACCACACCTAATGAC
AACAACAGCAATGCACTATAGACACTACTATGTCATTTTGCCAGCAGAGGAAGATCTATT
ACCTTATGATACAAGATCAAAAAAACTAAACCAAACCTGTTGCCGTCGAGTCGATTTCCG
ACTCACAGCAACCCCTATAGGACAGAGTAGAACTCCCCCCTATGGTTTCCAAGGAGCGCC
TGGTGGATTCGAACTGCTGATGTTTTGGTTAGCAGCCGTAGCTCTTAACCACTGTGCTAC
CAGGGTTTCCTGATTCAAGGTAGGCACTTAATATTCCTAAATAATATTTCTCAGTAGTAA
GTGATTGTCACTGTGTTTCTTAAACTTAAATTTCCTTTCATTTGCCTATATAGACAATAT
TTATTTTAAATTGGATAATTGTTTCCAGTGTAAAGATGGATGGATCTGGTAGACTAACTG
AATTCTGGCAGCATAGTGGGAATTTCAAGCTCAAGATGTAGGAATTACTTAAATATATTC
TTGGAAAGCTGTACCTAGCCCCTACACCAGATAGTAGTTGTGTCATTAACCCACTTTAGT
GTAATTTTCCAAGTTTTGTTGACTTCTCTGGCATTAGCATCTGCAAAGCACAATTTTCCT
TTCTATACTCTTACACAAACGTGTTTTTCCAAAAATTTATAGATTAGATTTGAGTATATG
AACAGTTGATTGGATAGTTAAAGGGGGGGGGATTAAAAGGGAGGGGGGAAAACTAAATAT
AGTTATATAATATAATGAGATACATGGAAATATGTAGAGCACAGGATAAAAATTAGTGTA
TAAAAGAGGTGTAATTCTTTTGGAGGAGGGTAAGGGGAGAAGAGAATTCTTCAGAAATAG
TAAATCAAGAATGTATCCTAAATATAAAGAAATTCAGAGTAGAATCCCACTCACATCTTC
ATAAGTAAATGGTCAGATGCAAGCTCCATTTTAAAATATAGAAATAAAAGTTTGCAACTT
CTCTTAAGATTTTGAAGGTTTTTTGGTACTAATACAAATGTTTTTAATACATTCCACTTA
GAATATAATATCAATATTATAGTTTTTTAATCTCTTTTAATATGGAATCTTAGAAGAATT
GTCAGCCCTACTCCCAAGCTCTAGCTTCTGATACAGGGTTTTCTTAAAAGACATATGGAT
TCTAGTATAAATTTAAAAAATGAAGAATTCTAAAACGAATACATATCTTTGTCTCATTGC
ATTATTGGAAAACAAGGAATTGTGGGTAGGGAAGCAAAGAATGGGAAAGGAAGTAATGAA
ATAGTTATTTCAAAATGTTGTGCAGCGTTGTTGCTAACGTGGGTGAGATTTCCTTAGAGC
ACCTCCTGGGGTGGAGGAGGACCAAAACAATTACATCGTTTTATTGAATTGATTGGCATA
ATTAAGTACCTTATTTAGGCTTTGCAGTCTTCGTTGTACCATTTTTAAAAATAGGATTTA
GCCTTATTAGAGCTATTCATTGTAGTATGTACTAAAACAATAAACTTCAAATGCTATTAA
AATAGGCTGAAGATAAACTGAGCTGCTATTAGGCACATGGGTGATTTTGAGTTTTTTTTT
TCTTCTTGATTTTTAGAGTGCTGCTGCTACAGCTGCCACCTTGGCACTCCCTGCAGGTGT
AACTCCTGTTCAACAGATATTAACAAATTCAGGTAATTGGGAATAACAGAACAGTGAATT
GAACCATCTGGTCTTCATCGTTTGTCTTTATTAAAAAATAGAAAATCTTAATATTGTTTT
ACCATTTGGTATAGGTTATTAAAATAACATTATTTGAGGGCTGTAGCACATTCAACTGTA
AATCATTGCTGAGGATGCAGTAGAGAAGGTGAGACTTAGTACTTCAGCTTTTGATCCTTG
AATGAGGATTTTATTTATTGAAAGAAGTATGATTTATGATTATATAGAAACATGCATTTA
CTTAGGTTTTTGCTAAACATGTTTAATATGAAAAATGAGTTAAAGGATCCTCACTTGAAC
TAATTGGTGATATCAAACTAAATTCTACAGACTGCTAAGAGCAAATTTATATTATTCTGT
TACATGTAGTAGCTCAGTGTAGATTGACAAGAGACCAATGTTTATTTACCCTTTGATTTT
TTTGCGTGTTTATGTTTAAAGAATTTATTTACGTAGATGTCAAGCATTCTCCCTATAATC
TCGATTTTATAGTTTATGTGTCAAGCAAAGCTTACCAAACCAAGCCCTATGTTTGTTAAT
TTCTCATTTTGTGAAGAACAAATTAGTGACTTGTCATGCTACATAATTTACTGAGATATA
ATTGTTTACTTTTTAATTAATTCATGATTCTGGGTTATCTAAAGCAATATTTTTTTAGAG
AAATTTGGTTTTACACCTATAAGCCAGTCATATAGTGTTATGTGGCAGTGATAATTGGTT
CAACAAACTTTTACTGCTTTTAAGCAATTTTGAAGGTAATATCTTGGTTCAAGATATTAA
ATGAACTGTTACGTTTTCATTTCTTTAAAGCTTTAAAAATGAAGAGTGCCTGAAACGTCT
GGCCTTACTTCTCTCATGACTTCTAATGTGCTAGCAAAGATAACTTAAACTTTTAATCAA
ATTTCATAATCCGTTGTTAAACCATATTGGAAAACAGCGAAGTAAGTATAACACATATGG
AAAAGAAAACATTTTAAGCAATGTATTTGAACCTGGAGGGTAGTCAGGGAAGGTGAGGAT
TATAGTTGGTGTGGCAGATAGCCCTTAATAAAGTTGTTCAGCTTCTTACTTGATTATTTC
TAGGGCCTTTTGGTGGTTTGATATATGAATTCAGTTATTTTGAATTATTTTGAAATTGTT
AGCGCTGAAATAGTGACTGGAAATACATCCTTTCCTCTTCAGGCCAGCTTCTTCAGGTGG
TCAGAGCAGCCAATGGTGCCCAGTATATTTTTCAGCCTCAGCAGTCAGTGGTTCTGCAGC
AGCAGGTTATACCACAGATGCAGCCCGGCGGAGTACAAGCTCCTGTTATACAGCAGGTAA
AAGGATCTACGATCACCACGGGGTTCTTTTTTCTTCCTTCCGTACAAACTCCCTGAGTGG
TTCGGCTTTTCCAGTGGCTTCATCTTAAATTCTTCTCCAGTGCTCCATATCCCACTGTCC
TAAATTCCTCATACACACCTCACAGCTTAACTCAAATTCAACATGTTTAAACTTAAATTG
TTACCCCTTCTCATTTTTCATCTTTTCCCGAACCACTCTCCATCCAGCCTCCTCATTCAG
CAGTCACTCGACAAGCGTTAACTAACTGGCTGTGAATCATGGTCTTTGCAGGGGGCTGGG
GATTTAGGAGTGCATGAGGCAGGCATATCCCGATAGTTTCCTATTTCCTGGAATAGGGCG
ATTATAGACCTCCCTCTCCTTTACCGCCGGTATCCAAGGTATCATGAAGTCCAACCAGTT
CTTAATAGTTCTTTGTTTTACTTGACATGTTTGCAACTAGTTTTTTTCCCCCTCTTGTTT
ATGCTCTCATAATTTCTCACTAAAGTACTGTTTTATCTTTCTAACTGATTTCCAAGCTTC
TAGTCAGGTACCCCTCCTAACCTGAGTGCCACTCTTTTTATAGAGTCATTTTTCTAAAAA
TGTTAACATCTTTTAATAAATTCCTATTGGAAAATGTCTAAACTTGTCAGCATGGTTTAT
AAGATCTTTAGGATCTTGTTTCTTTGAATGTCCCAGGGTTAATTCTTGCCATGTTTCTGA
AGTTGTTACGTGCTGCAGGTTTTGTTTAAAATCAAGGTTAATATTTGCACCTACTTATGG
GCCAGGTGTTATACTGTTGCACTGTGAGGACAATGATGAAAGAGGAATCGTTATTTTCTT
GGGGAATTTTGGTACTTCACAGAGTACAACAATGTCAGTATGACAATACAGTGATAGAGG
TAAGATTAGAGGAAGAACAGTAATCCAGCCTACTTACAGCTTTCCAAAATTATAAGTTGC
TCTCACTTCTGGGTTTCAGCTGATGTCATTCTTTTTTTTTGAATGCTGCCTTCGGCCTTC
TTTCTAGTGCCCCTCTCTACTCTCTCTAAACAAGTAAGCAAACCAAACAAAAAAGCCTGC
ATTTTCTTAAAGCACAAACACAGATTCAGATATTACTAGGAAGGTGTGATGGTTAAGATT
GTGTGTCAGCTTGGCTGGGCCATGAATCTCAATGTTTATATGTGGTCACTCTTTTGGTGG
AATCTGCTGTGAGTAGCCAGTCAGTTTAAAGGGAGTTTCCTTGGAGATGTGGCCTGCATT
CGAATATAAGCATACATTCTGGATTTTTGCTCACTCTGCATCCTGTGGCTGCATCCAGTT
TGCCTGACCTCCAGTTCTTGGGACTTGAGCTATCAGCTTACCTGCTGATCTTGGCCTCGC
CAGCCCCTGCAGCTACATGAATCAGGAGAAGCCTGGTGGTCTTGCCTGCCAGTTGTGATT
TTCACAGCCTGTGAACAAGAGTCCTGCTTTCCAACCTGCTGCTGCTGATCTTGGGTTCCC
CAGCCCCTACAGCTACGTGAGTTGGGAGGAGCCTCTGTCCTAATCCGTGGACTTGGCAAT
CGTGTGAGCTGTTTCTTTGATAGAAACCTCTGTCTGTATGTGTACACATTACTGGTTTTG
TTTCTCTAGAGAACCCAGCCTAAGACATTTGGTACTGAGAGTGGTTCCAGAGAAACAAAA
TTGTAAGGATGTTTCCTAAATTGGTTCTCAAGTCAAGCTAGTCTTACAGATGTTGACTTT
GCTTCCAGCAGTAGAGAGGGCACGGCTAATCCATGGTGATGGTGGAGACACAATATACAA
AATATCAGCACCAGTAGATGAGGTATTGATGAAAGGCAAGGCTCTGGGTGAACACATGTG
TGGTATCTTTCTGCAGTTCTGTCGGAATGAGAAGTATGAGGAAGCTGGTTGGTTGGTCCT
ACTTGAGCTAGATGAACTGGTGAAACAGAGATGTTCTCAGGGCTTTAGAATGAAAGCTCA
AGTGCAGCATAAATGACCTCAAGGCTGTTACTTGTGCTTTGAAAGGAAGCCTTATTTCTT
GTAACAGAGCTGAAACTGCCGAAAACTAAACCCAGAGCCTTATTGTAAGAGTGGCTGAAT
TACGATGCCAGTTTGCCAACCTCGAGAGGTGCTTGAAAGTAAGGGCATTGATTGGGAAGA
AATGGGGTCCTGAAACTTGGGATGGGGACATACGGGCAGATGATCAGCAAGCTGGGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTGGGGATTACTGGATA
CTGACTCTGAATTGACACTAATTCCAGGAGACCCAAAATGTCACTGTGGCCACCAGTCAG
AGTGGGGGCGTATGGAGGTCAGGTTATTAATGGAGTCTTGGCTCATGTCTGTCTCACAGT
AGGTCCATTGGGTCCCTGAATCCATCCTGTAGTGATTTCCCCAGTTCCAGAATGCATAAT
GGGAATAGATACACTCATCAACTGGCAGAACCCCTTCATTGGATCCCTGACAAATAGAGT
AAGGGCTGTTATGTAGGAAAAGCCAAGTGGAAGCTGTTAGAACTGCCCCTACCTAGAAAA
ATAGTAAACCAAAAGCAATACCGCATTCCTGGAGGAATTGCAGAGATTACTGCCACCATC
AAGGACTTGAAGGATGCAGGGGTAGTGATTCTCAGCACATTCCCATTCAGCGTGCCTATT
TGGCCTGTGCAAAAAACCCATGGATCTTGGAGAATGACAGTAGATTATTGAAAACTTAAA
CCAGGTGGTGACTTCAATTGTGGTTCCTGTTCCAGATGTAGCTTCATTGCTTGAGCAAAC
TAATACATCTCCTGGCACCTGGTATGCAGCTATCAATCTGGCTGATGCCTTTTCTCCATA
CCTGTTTCAAAGGACCATCAGAAGCAGTTTGCCTTCTGCTGGCAAGGCAGCAGTACACCT
TTACCTGCCTACCTCAGGGCTATATCAGTTTTCCAGCCCTATGTCATAATTTAGTCTGCA
GGGACCTTGATAGCCTTTCCCTTCCACAAGACATCACATTGGTCCATTACATTGATGGCA
TTAGGCTGATCGAACCTAGTAAGGAAGAAGTGTCAATGACTTTGGACTTACTGGTAAAAC
ATTTGCGTGCTAGAGGGTGGGAAATTAATCCCATAAAAATTCAGGCACCTGCCACGTCAG
TGAAATTTTTAGGGGTCCAGTGGTATGGGGCATGTCAAGATACTCGTTCTACAGTGAAGG
ATAAGTTATTGCATCTGGCTCCCCCCCACAACTAAAAAGGAGGCACAATGCCTAGTGGGC
CTCTTTGGATTTTGGAGGCAACATATTCCTCACTTGGGTGTGCTACCCCAGCCTATTTAT
CAAATGACTCGAAAAGCTGCTAGTTTTGAATGGGGCCCAGACCAAGAGAAGGCTCCATGA
CAGGGTCAGGCTGCTGTGCAAGCTGCTTTGCTGCTTGGGCCCTGTTATGCAGCTGATCCA
ATGGTGTTTGAAGTGTCAGTGGCCCATAGAGATGCTGTTTGGAGTCTTTGGCAGGCCCCC
ATTGGTGAATCACAGCACAGACCCTTAGGATTTTGGAGCAAAGCCCTGCCATCCTCTGCA
GATAACTACTCTCCTTTTGAGAAACAGCTTTTGGCTTGTTACTGGATCTTACTAGAGACT
GAATGCTTAACCATGGACCACCTAGTCACCATGCAGCCTGAGCTGCCCATCATGGACTGG
GTGTTGTCTGACCCACGAAGTCATGAAGTTGGACATGCACAGCAGCACTCCCACGTTAAA
CGTAAGTGGTATATATGAGATCTGAAGGCACAAGTAAGTTGCATGAGGAAGTGGCACAAA
TGCCCATGGTCTCCATTCCTGTCACATTACCTTCCATTTCCCAGTCTACACCTATGGCCC
CATGGGGAGTTCCTTAGGATCAGTTGACTGAAGAAGAGAAAACTCGTGCCTAGTTTATAG
ATGGTTCTGTGTGACACACAGGCATCACTTAAAAGTGGACAGTGGCAGCACTATAGCCAT
TTTCTGGGAACTCCGTGAAAGACAATGGTGAAAGGAAATTTTCCCAATGGGGAGAACTTT
GAGCAGTGTACCTGGTTGTTCACTTTGTTTGGAAGGGGAAATGACCCAGATGTGTGATTA
TATACTGATTCATGTATGGGCTGTGGCCCATGGTTTCGCTGGATAGTCAGGGTCTTGAAT
GTGATGGGAAAATGAGAGACAAGAATTTATGGGGAAAAGGTATGTGGATAGACCTCTCTT
GAATGGACCAAAGAAATGAAGATATTTGTGTCTCATCTGAATGCTCACCAAAGGGTGACC
TCAGCAGAGGATGATTTTAACAATCAAATGGGTAGGATGATACACGTTCTGTGGAAACCA
GTCATCCTCTTTCCCCAGCTACTCCCTTTACTCAATGGGCTCATAAACAAAGTGGCCATG
GTGGCAGGGATGGAGGTTATGCATGGGCGCAGCAACGTGGACTTCAGCTCCCCAAGGCTG
ACTTGGCTACAGCCACTGCTGAGCACCCAATTTGCCAGCAGCCAGAGACCCACACCAAGT
CCCCAGTATGGCACCATTCTTTGAGGTGATCAGCCAGCAGCCTGGTGGCAAGTTGATTAC
ATTGGACTACTTCCGTCATGGAAAGGGCAGTGTTTTGTCCTTACTGGAATAGACGCTGAC
TCTGGATATGGCTTTGTCTTCCCTACATGCAATGCTTCTGCCAGAACTGCCATCCGTGGA
CTTACAGAATGCCTTATCCACCATCATGGTATCCCACACAGCATAGCCTCAGATCAAGGG
ACTCCACAGCAAATGAAGTACGGCATTGGGCCCACACTCATGGAATTCACTGGTCTTACC
ATATTCCCCACCATCCTGAAGCAGCTGGCTTGACAGAACGATGGAATGGCCTTCTAAAGA
CACAATTATAGTGTCATATAAGTGGCAATACCTTGCAGGGTTGGGGCAGTGTTCCCCAGG
AGGCTGTATATGTTCTGAACCAGCATCCAATATATGGTGCTATTTCTTCCATAGCCAGGA
TTTATGGGTCCAGGAATCAAGAGGTGGAAATGGGAGTGGTACCACTCACTATTACCCCTA
GTGACCCACTTGCAAGATTTTTGCTTCCTGTCCCTGTGATTTTATGCTCTGCAGTTCTAG
AGGTCTTAGTTCCAAAGGGAGGAATGCTCCCACCTAGAGACACATAACTGATTCCATTGA
ACTGGAAGCTAAGAATGCCACCTGGCCACTTTGGGCTCCTTATGCCTCTGGATCAACAGG
CAAAGAAGGAGTTATCATACTGGCTGGTGTGATTCATCCTGATTACCAAGAGGAAATTGG
ATTGATATTACATAATGGAGGTAAAGAAAAGTATGTCTGGAATGCAGATGATCCCTTAGG
GCATCTTTTCATACTACCATGCCCTATGATTAAAGTCAATGGAAAACTACAGCAACCTAA
TTCTAAAATGACTACTAATGAGCCAGACCGTTTAGGAGTGAAGGCTTGGGTCACCTACAA
GGCAGAGAACCACAATCAGCTGAGGGCAAAGGGTATATGGATTGGGTGGTGGAAGAAGGT
AGTTCTAAATACCAGTTACGGCTACATGACCAGTTGCAGGAATGAGGACTACAATTGTTC
TGAGTACTTCTGCTTTTTTTTTTATGTGTGCATCAGATATTTTTGTTTTCTTCACTTACT
AAAAATAAGATGTAAATGGGGCTAGTGCATTTTGGGTTGTTGGTATGTTAGTNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGGTTTAAGAGAGTTTCCTTGGAAGTGTGGCCTTTGAATA
TGAGCACATGTTCTGGCTTTTTGCTCAGTGTGGTGCCTGTGGCTGCTGCCTCTTCGTCTG
ACCTCTGGTTCTTGGGACTTGAGCTATCAGCTTACCCGCTGATCTTGGGCTTGCCAGCCC
CTGCAGCTGTGCAAATCAGGACATGCCTTGCCATCTTGCCTGCCAATCGTGGGATTCATT
GATATTTACAGCCTGTGAGCAGGAAACCTGCTTCCCAACCTGACGACCAATCTTGGGTTC
CCCAGCCCCTGTAGCTGCGTGAATTGGGAGAAGTCCATCCTAATCCAAGGACTTGGAACG
TTCCAGCCTCTATAACCGCGTGAGCCGTTTCTTTGATATAAATTTCTCTCTCTATCTGTA
TTTAAATGCTTTACTGGTTTTGCTTCTCTAGAGAACCCAGCCTAAGATAGAAGGCTTCTG
TGACCACGCCTTGTTCCACAACCTGAATTTGGCACTCTCTCCTGTGTTCTCATAACATCG
TATCATACTTCTGTTACATCTAAACATCATTCTATCTTTACATTACATTACATTCTAAAC
ATCTGTCTTTTTGAGTTGGAATTCTTTGTTGACACCATTAATCCATAAACTTCTTAAGGA
AAACAGTGTATCTTACTATTTTTGCATTATTTGGTCCTAAACCAGGAAACCCTGGTGGCG
TAGGGGTTAAGTGCTACGGCTGCTAACCAAGAGGTCGGCAGTTCGAATCCGCCAGGCGCT
CCTTGGAAACTCTATGGGGCAGTTCTATTCTGTCCTATAGAAAAAAAAATACAGGGTCGC
TATAAATCAGAATCAACTTGATGGCAGTGGATTTTGTTGGGTTTTTTTGATCCTAAAGGC
AAACAATAGGCGTTCAGTGCTTTTTATTTATTAACAGTTATGTATATTAATTATAGTACA
TGTATTTTTTATTACAGTGCATGTAATTAATACTTGTTAATACATTAACGTATAACGGCA
TGGATGGAATTAATTCTTTTTGAGTTGTGGTTTACTTTAGAATCTTAGAATATAGAATCT
GGAAGGAACTTTAAAAATCTTTGATCTGGGTATTCTCAGCTGTAGGTACATGAAAGAATC
AGCTGGAGACCCTTAAGCGAAATGAATAGGTTTCATCTCACATCAGTTAAATCAGAATAT
TAGAGGTGGAGGCTAGGCATCATGTTTTTTTTTAAGTTACCAGGTGTTTTTAATTTATAG
CAGGGTTGAGAACCACTGATACTGTCTAACAGTGAAGTGACTAAAGCCAGGGAGGTTAAA
GGATTTGCTCCTGTTAACATCTATATCTGTGATCTTAGACAAAACTAGAACCAGTTCAGT
GTTCAAGTGGATGCAGTGTAGCATAATAGTAAGAGCATGGGCTCTGGAACCAGAAAGCCC
AGGTTCCCATTTTGCCTGTTAGTGAGTGTTTAAGCTTGGCAAATTACTAAACCTCTCTGT
ATCCCAAGCAAATAAACGAAGTTTGTGTAACTCTAGGCTCTGTGTCTCTCGTACACATAG
TGTTAAATGTTATTAGCACTGTCTTTAGAAAATCTTTTTTGTTCAGAAATTTGAATGGCA
GAAAGGAAATTTAGTGGGTCAGTGCCAAAAACCCATAGCCATAGGGTTTTTCTTGGCTGT
AATGTTTACAGAAGCAGATTGTCGGGCCTTTCTTTCACAGTACAGCTAGGTGGGTTTGAA
CTGCCAACCTCTAGGTTAGTAGTCAAGTAGTGCCACCTAAAGACCGTAGTTGGTCAGTAC
ACTAGTTAAACGTTGCTTTTGTATTTTGCTAGTTTTAAATGTGTATGAGAAATGGCTGCT
TCTGGTGATTGTTCAGCGTTTGGGCCTATTTCTGTGTACCAAGTAGTGAAACGGAGTTGC
TTGATCTGCTAGTCCCTAATACGTGGTTTTCTTTTGCCTTAGGTCCTGGCTCCTCTTCCT
GGAGGGATTTCACCACAGACAGGTGTCATCATCCAGCCTCAGCAGATCTTATTTACAGGA
AATAAGACTCAAGTTATACCTACAACAGTGGCGGCACCTACATCAGCACAAGCACAGATA
ACAGCAACTGGGCAACAGCAGCCGCAGGCCCAGCCTGCTCAACCACAAGCCCCACTGGTC
TTACAGGTTGATGGAACGGGGGATACATCATCTGAAGAAGATGAAGATGAAGAAGAAGAT
TATGATGATGATGAAGAGGAAGACAAAGAGAAAGATGGAGCCGAAGATGGGCAGGTGGAA
GAAGTAAGTTTCTAGTAAAAGATTTGACTTGAGAATCTACTCAGTTGTTTCCTATTGTAG
TTGGTGGCTAACTGATGAATTATATCGTATTTTGGGGGGCTTTTGGCAGTGCTACACAAT
GTATGATTGTAAAGATGAAATTAGATTGCCCTAACTTTAGCAAGATTATTAGATTGTTCT
GGCTGTATTTATCTTCATAAACCATTGAAACATAATTTAAATTGTATTTATAAAGGTGGA
GCCAGTACAAGTAATTATAGTTCTTTGGGTAATGCCTTCAGTGCATTCATGGTGTGGCTA
CCAATAGTTGGTATTGGTAGAACAGACAGATGTAGTTAATATTTTGCTTTAATAGTTAAA
AAGATATGATAACCTATGAAAAGAGAGGAAACTCCAGAAAAAAAAGCTAAATACAGCAAA
TTTATTTGAGATACCCTTTGGTCCATATTCGGTAACAGTTCCTCAGATAACCTTATCTGT
TAGTGTCTGTCCGTAGTTTAACAACTATCCCTTCTTATTTCTGTGTAGTATATTCTAGAA
ATACACAAACGTGTCTTTTTTTTCCTAACTCTTCCAACTTCGTTACTTACATCCAAGGTA
TTTATCCTGCCACAGTTTCCACTGTTAATTGTCTTCTTCAGTCTAAGATTTCAGTCTTCT
TGTTTACCTTAGTTTAAGGTTCTTTTAAATTACCTAAATAGTCTTTAACCAAAAAAGCAT
TGTTTTTATTAAATATTGATAAAAATAAATAAAATATATTTTAAGATTTACCTACTAGGT
GCCCATCACTTAGTTAAAAAAAAGAAGTATTGTTACTTATTAAAGTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGTTTTCTGTATAGACAATCATAT
ATGAAAAAAGACAATTTTTTTTGCTTTGCCGGGCTAAAGCCTTCCAGCCTCCATACTGCT
AGTTAATGATGAGGAGCAAGCATCTTTGTCTTGTTGTTAATCTTAAATTCTTTGGTACGG
TTGACCATTAAGTGTAATGCTTGCTGTAGGTTTTCTTATGGATACCTTTTGTCAGAAAGG
ATTTAAGGAAAAATTTTTTCTTCTATTCATTGTTAACTAAGAGCTTTGCTTTGCTGGATT
TTTTTTTTTTTAAATTTCTGCCTTTTTAAATGTTTTTATTAGAGACTAACAAGGTAGTAT
GAGCTCAGTGTAAAAAAATTCAAACAATGTGGAAGTATATAACATAAAAATAAAAGAGTC
TCCGGTAACCCTAGGCAAGAATATTCTTCCTGACATGTTTTTGCTTGTGCAAATGTGTAT
ACATATACTACACACATACCACAAAATTTTTCATGTGTATTAATTATAGACATCTTTCAA
AACCAGTACATATAGATAGAACTGTCTTTTTTTTTTTTTTTTTTATTTTTTTTGCTTTGG
TAAAATATATATAGTAGGACAGTGGTGGTTAAATGATAGAATTCTCGCCTTCTAACATTC
AATTGTGCTGTGAGGAACCCATACATAGATCGAGAGGCAGCCATTCGAACAGAACAAGGG
GTACTGCATGGTTTAAAGTCAGGAAAGGTGTGTGTCAGGGTTGTATCTTTCACCATACTT
AGTCTGTATGCTGAGCAAATAATCTGAGAAACTGGACTGTATGATGAAGAAGGGGGCATC
ACGATTGGAGGAAGACTCATTAACAACCTGTGTTACGCAGATGACACAACGTTGCTTGCT
GAAATTGAAGAGGACTTGAAGCACTTACTGATGAGGATCAAAGAGTTCGGTATTCAGTAT
GGATTATACCTCAATATAAACTAAAAAGTCTTAGAACTGGACCAATAAGCAACATCATGA
TAAAGAGAAAAGGGTAGTGTTGTCAAGGATTTCATCCTACTTGGGTCCGCAATTAATGCC
CATAGAATAAGCAGTCAAGAAATCCAACGAGGCATTGCATTGGGCAAATCTGTTGCAAAA
GATCTCTTTAAAGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTTTATGTGGCCCTTTCTGTCTTCA
ATGGGCTCATAATTACCTTGTGTCTTTGGTGTTCTTCGTTCTGCTTTGCTCCAGGTGGGT
TGAGACCCATTTTGTATGGATCTTAGATGGCTGCTTGCTAGCATTTAAGACCCCAGAAGC
CACTCTACAAAGTGGGGTGTAGAATGTTTTCTTAATAGATTTTATTATGCCAGTTGACTT
AGATGTCCCCTGAAACCATGGGCCCCAAACCCCTGCCTCTGCTACGCTGGCCTTCAAAAT
GTTCAGTTTATTCAGAAAACTTCTTTGCTTTTCGTTTATTCCAGTTGTGCTGACCTCTCC
TTGTTTTGTGTGTTGTCTTTCCCTTCACCTAAAAGAATTCTTATCTACTATCTAGTTAGA
GGAAACCCTGGTGGTGTAGTGGTTTAAGTGCTATGGCTGCTAACCAAAGAGTCGGCAGTT
TCTAATCTGCCAGGTGCTCCTTGGAAAACTCTGTGGGGGCAGTTCTGCTCTGTCCTATAG
GGTTGCTATTGAGTTGGAGTCGACTCTATGGCACTGGGGTTTGGTTTTGTTTTTTTTTGG
TATCTAGGTAGTAAAAACCCCTCTCTCTCCCTCCCCTCCCCCGCCTTTTGTAACCGTCCA
AAGAAATATTTTTCTTCTCTGTTTTAACTATTTTCTCCAAGTTTTTATAAAAGTGGGTCT
AATGCAATATTTTGTCTTTTTTGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
AAAAGTACTTCTGTTTTAAATGTTTGCCGGCATAAAATTTCCTGTGACAAAGGGCCATAT
GTATATGTAAACTTGTTAGAGATAAGATATTTTTCAGAGAATTGTCGTTAACTGTACGGT
CCCTAAGAGTCAAAATTGATTCAGCAGCAACGGGATTGGTTTTGGTTATTAGGTTATTCA
GTGAACAGAAGTACTAAGCTATCAAATAATATTAACTGTAGATAATTTATTTTGTCTTTT
TTTAAGTGTATCAGTTGGTTTTTGTTGTTATTATGGTTTCTCTGTCCTGCTTGTATCTTT
TATATTCTTTTTAATTGGGTTTTTGTTTATTTAGATACACAGAAGTAAAAACAAATGGAA
ATTTCATCTAAAGGATGGCATTATGAATCTTAATGGAAGAGATTATATATTTTCCAAAGC
CATTGGAGATGCAGAATGGTGAAGAGTTCCTTTTTTCCTTTTATAAATAAAACAGAACAA
ACTTAAAAAAAAAAAGAAATAAAAGTGGACAATTTGCGACTTGGGACATATACCAACCAA
AACTTAACTTCTGCATGTCAGAAAAGTACAGTAGGAGCAAAGCTACTGGAACAAAGATAG
ACTTTGACAACATAGACACTACTTTCTACACTGGCAAGCCATGGAACTGCTAGCACCTGG
GATTCGTTGGGGGGAAACGGGCTAGGGATTTTGTGTAGGAAAACCATAAATGTCCATTTT
AAATACAGGTACCTGCCACCAGTAATTAGCATGTAAAGCTTTGTCTATATTCTTTTCTTC
CAGCTTGGGTTAAATCAGAAGATACTTGTTAGAAGGAACTGAAGAAACTTTCTCTTTTGA
TAGATTGAGTTGAAACTGCTTATTGTGTGTGGTTATATTTGGTAAAAATTTCGTGTGAAC
TTTTTACAGAAGGGTAAGAATTATGGTGTTGAATTTTAATTCACTTGTATAAGGAGACAA
TTTAAAGCTCTCGTAATAGGTCTTAAATATTTTTACTTGCTGTTCTCCCTCAGTAATATG
TCCCTCTTCCTTCCCTGCTTTATGAAACATCAGTAATCACATTTAGTTGGGAGACAACAT
TTGACCCAGAAATGGATATTTATTTTAATAGGTTTTCATACATATTAAATGTAATTTAAA
GACTTGGGTCTTGCCTGCGTTCAGTGGAATTAAAATAACAGCTTTAGTTTCCTCACTGAA
AAACTGTTTCTTATAGTCCCACATCTTTAAAAGCAGCCCCAAATTGGCTCCTCAGGAATA
CAGTTTTATGTCACAAAGTTACCATCTAACTGAAATTGTAAACACATAAGTATATGTAGG
TTTTTTTCTGTTGGGCTGAAGTCTGTGCTTGTGTATGTGTTTCGTCTTTAAGTGAAACAA
AATTCAGTGCACTGACTGAAGTATAGGGCAGGTGGTAAGGACCTGGATTTTTATTCCACA
GT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1102, 13089..13293, 18108..18172, 22876..22951, 24162..24295, 33402..33722, 39159..39248, 43414..43521
1001..1102, 13089..13293, 18108..18172, 22876..22951, 24162..24295, 33402..33722, 39159..39248, 43414..43518
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved