Loxodonta_africana Locus RPL4
snOPY snoRNA Orthological Gene Database
Loxodonta_africana RPL4
Loxodonta_africana
RPL4
GeneScaffold_5660
SNORD18, SNORD16, SNORD18
1219..1290, 1680..1778, 3470..3540
5753
GAGAAGGTGGCCTGAAGGAGGTGAAAAATGCCAAGGGGATCCGTAGGGTGAAGGCTTGC
TACCTCTGAAGCTGGAGGGTAATGGGCCTGATGGTACAGACAAAAGTATCTGGAAGACTG
TAAGAGATGGTATCAGGTCTGTAGGCCAGCCTAAGGACCCTTCCAATCCGAGGGTGGGAA
TCCTTTAGAGGGTGTTGAGCACAGTTAACATGACTGGTGTTTTTATTAGTAAGCTGTAGA
AGATGTGTTTAGAAGGGAAGTGTGGAAGCAGAGATGGAAGTTTGGATGAGTAAAGCCCTG
GTAGACAAGATTTGCTGACACATTTGTAGGGGGGAGAGATTAGGTGGCAGTATTAAATAG
CATTTTCAAATTTTACAGTGTGGCTTAGATTCAGCATTGTTCTTTATAAGGCCTGCTTTG
GAAACTTGATGATAAACCATTCTCTGAAAATTTTGTGGCAAGACATCAAATTAAGCTGTC
ATGTGGAATGTAGCAGATTGTACGTCATTTACTCATATTAATAGAGTTTGGAAACAGACA
TGTCCAAAATATAAATGTATCCCTGTTAAATACTGCTCTAGACAGATTTGTAACTTGGAA
GATGTTTATGTCGTGAGTTTATTCTTAAAGGGCACAGGGCAGTTCTTAACATTAGAAAGT
TTTGCTTGCAATGATGTCGTAATTTGCGTCTTACGCTGTTCTCAGTGACAGATGCCTGCT
GTCATTAAGCTGGTACAGAAGGTTGACGAAAATTTCTACTGAGCAAGACATTACCTTTTT
TTAATTCCTAGAACATGAGAAATGGTGTTCTTAACTAGTAGAAGTGCCCCTGAAGTATGG
GCGAATTTTTTGAAGTTAAACCTGTTCTGGGTGTGTTGGTAGCTTAGCCTTGCTTGTCAT
GGTGTTTGTTGCCTGTTTTAGCTCAGCTCTATAGCTGAGATGAGTATGCCTCCAGCGATG
ATGCTCACCAGCATAGGTTAACCTTTTCCTTTTTCCCCAAGGCGTGTGCTCGTCCACTGA
TATCGGTGTACTCCGAAAAGGGAGAATCATCTGGCAAAAATGTTACTTTGCCTGCTGTGT
TCACAGCTCCCATTCGACCAGATATCGTGAACTTTGTCCACACCAACTTACGCAAAAACA
ACAGGCAGCCCTATGCTGTCAGTGAATTGGCAGGTATGGATTTAGACCTCACACAGGTTG
GTATCTTAGGGTTGCTTTACAGTAGTGATGAGATTACACTTAATTGGTCCGTGTTTCTGA
ACCACATGATTTTCTTGGGTGTTCTGATGCTGTTTGCTACCATGTGTAATGGCCACACAT
GGGTGTGATTGAGTAGCTAAAGCGTGCATTTCTTTCCAATTTTAGGTCATCAGACCAGTG
CTGAGTCCTGGGGTACTGGCAGAGCTGTGGCTCGAATTCCCAGAGTTAGAGGTGGTGGGA
CACACCGCTCCGGCCAAGGTGCTTTTGGAAATGTATCCTTTTTGGTTTTACTGCCTGGAC
ATAGTCACCTGTCATGCAGGATTTAGCAAACTGAACCTGATGTGTTCATATTAATAATTC
AGTTTGGACATAGGCATGTCCAAAATACTCGCTGTATCCCTGTTAAATACTGCTCTAGAC
AGATTGGGAATCTGGAAGGTACTTATTTCTGTGGCAGTTCTGAAGTTAGAAAGTTTTGCT
TGCAATGATGTCGTAATTTGCGTCTTACTCTGTTCTAAGCGACAGTTGCCTGCTGTCATT
AAGCTGGTACAGAATGTTGACGAAAATTCTTACTGAGCAAGGCATAAACCTTTTTTTAAT
TCCTAAATCTTGAGAAATGTGATTCTTAACTGGGAGTANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATTTGGCAAATCGTATACCATT
GTGTTTTTTGTAAGTTATATAAAATAGCTCGTGTATAAGTGGTTTCTTAATTTTTCAAAA
GGTTCAGGGTAACCAGTGTTGAATTGGCTTTGCCAGGTCACCGCATTGAGGAAGTTCCTG
AGCTTCCTTTAGTGGTCGAAGATAAAGTTGAAAGCTACAAGAAGACCAAGGAGGCTGTTT
TGCTTCTTAAGAAACTCAAGGCCTGGAATGATATCAAAAAGGTAGGCTTAAAGAACGCAT
ACAATTTTGGTAATCCTTGATCCACATGAATTTGTTTTCACGCGTTTAACTTCAAAAAAT
AAGTATGAAGGACAGTATGGCTAAGCCCTAGTGGGTAAGAGTGAGAACATTGGAGACAAA
TTGCTTGGGTTCAAATCCTGACTGCCATTTACGGCTGTGTGTATAACTTTGGCGAGTAAT
TTGTATGTTTCGTCATGTGTAAATTGGAGTTTGTTAACTATAAAGATATACTAGAAGGGT
TGTATATCTTAATCAGAATACTAAATATCTCAATTTGTTAGGTCTATGCCTCCCAGCGAA
TGAGAGCTGGCAAGGGCAAAATGAGAAACCGACGTCGTATCCAGCGCAGGGGACCATGCA
TTATCTATAATGAGGACAATGGTGTCATCAAGGCCTTCAGAAACATCCCTGGTAATTCTT
ACACTGTTTCCATTTTTTATTATTCATACTGTACAGTCTTGGTCAGCTTTTTTTTGTGAT
GAGATTCCACTTTATGGTCCGTGTTTCTGAAACACATGATAATTGTGGAAATTCTGATTC
TTGGCTGAGTGAGTGCACCATTGATGGTTGAAGCATCTTACAGTTAATGAAGTAAGTTTA
ATGAGGGTTTCACTGCTAATTGGATAGTTCTCAAGTACCTACATAGCACGTAAGCCATGA
AGATGGTTGATGTTTTTTCTTTTGAAATAATCTAATTCTCTTTTCCTTTTAAAAGGAATT
ACTCTGCTTAATGTAAGCAAACTGAACATTTTGAAACTTGCTCCTGGTGGGCACGTGGGA
CGTTTCTGCATTTGGACTGAAAGTGCTTTTCGCAAGTTAGATGAGCTGTACGGCACTTGG
CGTAAGCTGCCTCCCTCAAGAGTAACTACAAGTGAGTGTTTTTCATGCTGATGTCCTGCA
CACAGCTGTTGATACCGTGGATATTTACATCCAGATTATGGTTTGCATGTTTACTAAGTA
CAAAATAGTGTAGAGGAAACACTGAATTCTAGAAGCTTAAATGAACTTTGAACAGAAGAG
ATTTTGTTCTTTAGTCGATTACATAAGAAATAGGAATTTGTTCATCCATTGTGATCCTTT
TCCCTCAGTCTTCCCATGCACAAGATGATGAACACAGACCTTAGCAGAATCTTGAAAAGC
CCCGAGATCCAAAGAGCCCTCCGAGCACCACGGTAAAACTGTTTTCTTTACAGTATAACC
CTTGCCCCAACCTACACTGAGTTCTTTTTGTAAATGTGGATGATTGGCAGGATTTGGAAT
CTACATTCCTAGAGCAGTGCAGGTCACATGTTAACCCATTGTCTGCTGGTTTACAGCAAG
AAGATTCATCGCAGAGTCCTGAAGAAGAACCCACTGAAAAACCTGAGAATCATGTTGAAG
CTAAACCCATATGCAAAGACCATGCGCCGAAACACAATTCTTCGCCAGGCCAGGAATGTA
GGTGACAATTTATTTTATTATTGGTATGTCAGATTTTTAGAAAGACTTGATTCATACATT
TTCTAATTTTTTTACAGCACAAGCTCAGGGTGGATAAAGCAGCAGCAGCACTAGCGGCCA
AATCAGATGAGAAGGGGGTTCCAGGCAAGAAGCCTGTGGTAGGGAAGAAAGGAGGAAAGA
AAGCTGTTGCTGTGAAGAAACCGAAGAAGCCGGTGGTGGGAAAGAAGGCAGCAGCTACCA
AGAAACCAGCAGCTGAGAAGAAGAAGCCGGCAGAAAAGAAACCTACCACAGAAGAAAAGA
AGCCTGCTGCATAAACTATTAAATTTGTTTATTCCATACAAGTCAGAGCATTTTGGACAG
CTTATTTTGAATAAAGACCTGATCAAAGAGGCAGTGAGAAATAGGCGTTTGGGTGTGTTG
TGTGAATCTTAGTTTTTTTTTTTTAATCATGTTTGCTACTTAGTAATTCCAGCCCTTTGT
CATCTTTTGTTTTTTAACATCAAGTGGAGCCTTGGTTTTATGCTAAATCGATGTAGTTGT
ATGGGAAGCAGTGATTGTCTTAAATCCATTTTGTAAGTGTCAAATGTTTCAAAATACAGT
TGATTAAAACACTTCCTCTGAAAAGAGAGGCTATATAGAAGCTGTTGTGGGGGTAAAAAA
AAAAAAAAACCCACTGCCATGGAGCGGATTCTGACTCATAGCGACCCTATAGGACAGAGT
AGATCTGCCCCATAGAGTTTCCAAGGAGTGCCTGGCAGATTTGAACTGCTGACCTCTTGG
TTAGGAGCCGTAGCACTTAAACCCTGGACCACTACACCACCAGGGTTTCCATGGTGGGGG
TAAAAAAGGGTAAAATTCCATGAAGAGTTGACATTTTAGGTAACGACAAGGGTAGAACTG
CAGAATAAATTTGAGGGTACTGTAGCAATGCTTCCCTTCAGGTTCTTGTTAAAAAAAAAA
AAAACGTGCGCGCTTGGTGAGAGAAATGCTGCCACCTCCTACCCCATGACTTTTTATTTT
TACCCTGGGTATGAGAGACTATGCCAGAAGCTTTTTTTTTTTTTTGTAAACTCTTGACAG
TTTCAGATGGGGATAAACTCAGTGGCCAGGTATAGCAGTGAGAAGAGATTTAGTATTATC
TGGAAGCTATAAACGTCATTGCACTTCTTACCACTCCAGAATTAAGCTCCCTTCCCTGCT
TTTGTCCAGTCAGGCTCGTTTTGCTTCTAGATTTAACTTCTCACTGGCCATCTCGTTAAA
TTCCACCGCCAGGATGACTATCCCATATGCAGGGTCATCTTAGCTCCTTAGCAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1172, 1365..1471, 2218..2356, 2856..2980, 3281..3410, 3715..3842, 3845..3870, 4088..4171, 4316..4436, 4517..4753
1001..1172, 1365..1471, 2218..2356, 2856..2980, 3281..3410, 3715..3842, 3845..3870, 4088..4171, 4316..4436, 4517..4750
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved