Loxodonta_africana Locus TCP1
snOPY snoRNA Orthological Gene Database
Loxodonta_africana TCP1
Loxodonta_africana
TCP1
GeneScaffold_2442
SNORA20
3510..3640
4992
ACATCAGTGAAACCTAATTATTAACACAGATGAACTTGGAAGAGACTGCCTGATTAATG
CTGCTAAGACGTCTATGTCTTCCAAAATCATTGGAATGTATCTTTGTGGTGGTACAATAA
AGTTTAGGGTTTTTTTTTTTTTTTTAAGTTAGATTTTTATCTTAGTTTTTATATTTGGCT
TAGTAGTCTATATCAAATTGATAAAATGCGTTATAGATAGATTATACTGCATTAAAGTTG
CCTGTTGCTTTCTCTGCTTTTCAGGGGTGGGAGAAAAGGTAATATAAAGTGTGGATAAAA
ATGGTATGAAGTGAAGGTACTGACAAATAGCACTGTGGTATTTTTACGACATGAGTAACA
CATGTTTCTTTGGAGAATGAAATTGCTAAAGAGAAACAAATCCCTTTGAATTACGCTTTG
TTTTTATGTGTAACGTCCATTTTAAGTTACCATCCTTAACTGTTGGCTTAGAAATGGTGA
TTTCTTTGCTAACATGGTGGTAGATGCGGTACTTGCCATTAAATACACAGATGGAAAAGG
CCAGCCTCGCTATCCAGTCAATTCTATTAATATTCTGAAAGCGCATGGAAGAAGTCAGAC
AGAGAGTCTGCTGATCAATGGCTACGCACTCAACTGTGTGGTGGGATCGCAAGGTAAGGG
CCGGGCTTAGGCCATGTCATGAGAGGACCACAGTTAAAATGAGTTGCATACTGTACCTTC
TCAGATGAACTGTCCAAGATGTACACTAACCACTCTTTTAAATGGAGCCCAGCAAAAAAT
TGTTTATCACATTAGTCTCTTGTAATTTAAGGACATAAAACTCAGCACAAGTTTAAATTA
GAGGTATTTAATGATGTAATTTTTTTTTCTCAGGTTAAATATAAATTACAATCCCGGTTT
CTGTAATACCTTTGTGTTCTATTATGTATTTAAGGGTGTCTCGCATAAAATAGATTGTCA
TAGTTCCTGTAAAGGAACTAAATCCCATTTTTAATTATAGGTATGCCCAAGAGAATAGTT
AATGCAAAAATGGCTTGCCTGGACTTCAGCTTGCTGAAAACAAAAATGAAGCTTGGTGGA
CAAGTAGTGAGTACAAATCCTGAAAAACTGGACCAAATTAGACAGAGGTGTGTACAGAGG
TCCTTTGTGGCCTTTAAAGGGTTGTTTATAAATTACCCTGGTGTTTGAGCGAGACTGTGA
CGAATAACTTAAACGAACCAGTGCTTTCTTTCATAGATAGTGGAGCATATGACCTGTACT
GTTTACTAGATAGCATGATGTGTTGGTTATACTGCTGGAATTGTAAGCATGTCGCCCGGG
ACTTTAAAGATTAGCGTTGTTACCTCTAGTCAGACTGTTGTACCTAAACTTACAACAAGA
AAGGGTGGTAGTGGTGTGTTCAAGAGATTTGGGCTGCTATGACTCACAACGCTTCAAATT
GGCGTGTTTGTGAATTCGGGGTTTATGAACATTGATAGATTAAGTATGGAACCTATTTTT
TTTCTTAGCTCAGAATTTAGTTTGGATCCTTGACCTCAAATTTGGGCAGAAGAGAGCCGA
GTGTGTTTTAACGTCTTGAAATTTTTTGCTAGTGAGGCTGAATTAAGTTCTGGTCATAGG
TGGGAATGGATGGTTAATATAATTTAATCCAGAATTATCTTTTGTGAAAAATACTCGGAA
AGTGTAGTTGTATCACACAGAAACAAAATCGGGTTAATACTTAAATACATTTTCACTATA
GAGAATCTGATATCACCAAGGAAAGAATTCAGAAGATCCTGGCAACTGGGGCCAATGTTA
TTCTAACAACTGGTGGCATTGATGATATGTGTCTGAAGTATTTTGTGGAGGCTGGTGCGA
TGGCAGTTAGAAGAGTGTTAAAAAGAGACCTTAAACGTATTGCTAAAGCTTCTGGAGGTA
TGTCTTCTGCCAACTTTGACGTGGTCCTTCATGCTGTTACACATGACCATGTAAAAATCT
TTTCACATTGGAAGATTGAGACTAAGCCATTCCAAAAACAAAGTTTTCATTTCCTTAATG
CTGTTACATATATATTGATAGAGCCATTTTTTGTGTAATTGTGAAAGTTTTTCAACATAC
TGAATTTATTGAAAAATTCATGATTTTAATCTGTAGTCACTTCAGAAAATGAGAGTTCAT
CTTAAAGGGACAGTTGCTTTTATCTGGAAACCTTAAACTTGTATTTTATACATCACTTTA
CTGTAAGTAAATGTTTCTGAATTGAAGACAGAATGTTAAAGTCTTCGGGAGGAGAGTGAA
GGAGCAACGTTTATTGTGTCTTTGCTAATTCTCTTAACAGCAACTGTTCTGTCAACTCTG
GCCAATCTGGAAGGCGAAGAAACTTTCGAAGCTGCCATGTTGGGACAAGCTGAAGAGGTG
GTACAGGAGAGAATTTGTGATGATGAACTGATTCTAATCAAAAAGTAAGGGCCACTTTCT
AAATGACAAAGCTATATAGGTTTTCTCAGCGTTAAAGGTAAAATGAGGTCATCTTCCCAT
TTATTTGCTGCTATCGTCTCTCAGTGATATGAGCAGTTATACGCATGGGATAAAATATGC
TGGACGTTTGTAAATAGAGATGAAGTCACTATATTTTATCTCTTCTGCATGGTCTAGACA
TGCTTTTTGGTACAGCATGTTGAACTCCTGTAAGTAGGGTTTTAAGAAGGATGTTTGCAG
TGAATTACCATGTAGACTGACTATATGAAAATACTGATTTCAGAACTTGGCTTACTTTTG
TTTTTAATAGCACTAAGGCTCGTACATCTGCGTCCGTGATCTTACGGGGGGCAAATGATT
TCATGTGCGATGAGATGGAGCGCTCTTTGCATGATGCTCTCTGTGTGGTGAGGAGAGTTC
TGGAGTCAAAATCTGTGGTTCCAGGTGGGGGTGCTGTAGAAGCAGCCCTTTCCATATATC
TCGAAAACTACGCGACTAGCATGGTAAGAAAGCCTTTCTTTCAAGATGGGCAAGGGAGAG
ACTCTGGCATTTTATTATGTCTTGTCTGAGCTGCCACTGCGGGCTTTAATTTTTCTCCTT
TTGTGAACATGCCTAACTGCCTTTCTTCTAGGGGTCTCGGGAACAACTTGCTATTGCAGA
GTTTGCAAGATCTCTTCTTGTTATTCCTAACACGCTCGCAGTTAATGCTGCCCAAGATTC
CACAGATTTGGTTGCAAAGTTAAGAGCTTTTCACAACGAGGCTCAAGTTAATCCAGAACG
TAAAAATCTAAAGTGGTGAGCATACGATTTCTCAGTCAGTTTCATCCTCGACTACGTACT
GTACGTGGTGGTTTTGTTTTAAATTCATGGTAGATTGTATTTTGGCCCTCCTAGACCTTT
GGAAAATTACAGACCTCTCAAATACTTAACGAAAGGATGCTGACGAGGGGTTATTAGCAT
GGGTGTGTCTTAGCTCAATTCCTGACTTCTGCCTGCTTCTTGAAGGAGCCCTGGTGGTGC
GAATGCTTCAAAGACCTGGCTCTTTTCTACCCTGGCAGTTGTCCCACTGGAAATGTTTGC
ATACAGAGTTCCTTGTCTTTACTACCACTTAGGCTTTTCTACTGTCAGTGCTGCTGGTTT
GTGTCAATTTCTTTAGTCCTAAAGTGACCTTGCCACAACGTCCCAGCATTACCCAAGATT
AACATTGCATGGAACAGATAGAATTATGGGCTGTTAGTTTTGTATTAGCTTTTAGAGAGA
GAGGATGGGGTATGTTAGGTAAGAGGGCCATTTAGTCGTTTGTTTCTTCCCTACAGGATT
GGTCTGGATTTGGTCAATGGCAAACCTCGTGACAACAAACAAGCAGGGGTGTTTGAACCA
ACTATAGTTAAAGTGAAGAGTTTGAAATTTGCGACAGAAGCTGCAATAACCATTCTACGG
ATTGATGATCTCATTAAATTACACCCAGACAGTAAAGATGACAAACATGGCGGTTACGAA
GATGCTGTTCACTCGGGAGCCCTTGAAGACTGATGTACTTGCTCCTTTATTTATAACAAT
GTTAAATGCACTTGTCCTGTACTCCAAGTATTACACATTAAAGTACAACAATCTAGCAAG
CCTTGGGTTACTGTGAAGTGGAAGGTCCTTTCCATCCTCATTTTGGTCCTGTTTTCACAT
TTTAACTGAGTAGCATACAAAGTTTAAAAAGAAGGCTCAAGGTTAGATCACATTCATCCT
CTCTGAACACACATTGCTATTCCCATCCCTCCCCCGATGCACAGGGCGGCAACACCACGC
TTCCCACCAGTTCTCTCCATGGTGTGTAACAGGGTCACAAGAATCCGACAGCCAGATGCT
CCGAGGGGGTGGCCCAAGGCTATGGCTCCTCCTTGAATGTTGACCTATGGGGGTAAAGAT
TTATTTTAGATTGTTCCATGGGCTTCGGGTTAAAATCCTAAACCTTTTTTATTTCCCCCT
CTCAATTTGCATTTTAAACTACTTAGGAATTACCTCATGCCTCTGACTCTCGTACCTGAA
TACCTGCTCTTGTTCCTTAATATAAAACTTAACTTCAAAAACGTTTTTAAGAACTTAAAA
TGTCCTGTTAATGTAGGAAGTGAATTAATGTAGTTGAGGGTTTTTGCCTTGGTGAAGTAA
TAATAGATGGCCCCCGCCGCCACACCCAATCACAGTAAGAGCTTCAGTCTGTCTTCGTTA
CTGTATGGCTAACACCTGGGAAGTTGCTCATTTCATATGCATGGGTTTTGCTGTTTACAG
TCTTAAAGTTGTGGTAGTTGAGTTGTTAGGAGTACTTGCTCATGCTTACCTTTTCTGGGT
TTAATCCCAGGTCTTTACCTATTGCAACAGAGAGGGCTGCGAAGGCTTCATTGATTTCAA
ATAGATCAACATCTTCCAGTGACCAGCCTGCTTTTGCAACCTGAAGGAGAGGGATTAGTG
GAGTAAAGCGAAAAAACCACCGAGCCCCTTGCCGTCAAGTCAGTTCGGACTCAAGGGGAC
CCGAGAGGACAGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1009, 1012..1094, 1469..1650, 1998..2124, 2739..2914, 3318..3441, 3768..3960, 4089..4252, 4774..4990
1001..1009, 1012..1094, 1469..1650, 1998..2124, 2739..2914, 3318..3441, 3768..3960, 4089..4252, 4774..4987
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved