Loxodonta_africana Locus PABPC4
snOPY snoRNA Orthological Gene Database
Loxodonta_africana PABPC4
Loxodonta_africana
PABPC4
GeneScaffold_991
SNORA55
8929..9062
16407
TGGCTCCGCTGGCCGCCTCTCTCCGCCCCGGGTCGCCGCTGTCTACGTTGTTTTCGGGC
CCAGTAGCCTGAAGAAAAAAAGATAAAAAAAAAAAAACGGAAACGCTTTAAAAATCTTAA
AAAAAAAAGAATACGCGAATCTTCCTCGGAGCACCCGCAGGGAAGTCACTTTTGCACGCT
TCCGGCCTGCCCCTCGCCCGCCGCCGCACTTTGGCGTCTGTCCGCCTCCGTCTGTCGGTC
CCGTGGTGAGCAGCCCGTGCCCGCCTGCCCGCCGCCTGCCCGGGCCTGCCATCGTCCACG
CGCCTGCGCTCTGACCCTCGTGCGTCCGTCCGTGCTGCCCGCCGCCCGGCCCTGCCCGTC
CGCGCGCGCCGCGTGGCAACCTCGGCGCCCGCCCGGCCCCGCCGGCAGCCCTCGCCCCCC
GCGGGCCGGCCTCCCCGGCGCACCACGTGTCCGCGCTGCCCTTCGCGGAGCCCGGCGTGG
GAGGCGGCTGCGCGCGCGCACGCACGCCCGCCTGGGGCTTGCCGAGTCGGCACCGACAAA
TATTTTGTTTCCCTCTTCTCCTGGCTGTTGTAATCCTAAACCGCCAGGAGCCCGGGGCCT
ATATTTATAGAGAAACGCGTCTCCCGAAGGCCGCTGTGGGCAGCATTTGGTTGCCTCTTG
AAGAATTTTTAGAATTCGGAAGGGGATTCCCCATTTTAAATTATTTTTTTTGAAATTTGG
AGGTTCAAACCAGGACAGCTGCAAATTACAAACTCCCAGGGAGGGCCATATTGTTTTGAG
CGCCTTTTGTCTGAGGTTTTGCAGAGTCTTCTATGAGCTGTCCCTGAACTCCTGTTTTCC
GTCTTCTGTGTATCTGAGCCTACTCCAACGCTCCTTGGCTTCACTGTTGCCACCTGTGAG
CCGCCGCGCGAGCCACGGCTCCGAGAAGAGCCCCTTTTGTGCTGTGGTGATCCCTAGAAG
AAGTCCTCCTGGCGGGGCTCGGTGTGGTGGGGGGCGGGGAGATGAACGCTGCAGCCAGCA
GCTACCCCATGGCCTCCCTGTACGTGGGTGACCTGCACTCGGACGTCACCGAGGCCATGC
TGTATGAAAAGTTCAGTCCTGCGGGGCCTGTGCTGTCCATCCGGGTCTGCCGCGATATGA
TCACCCGCCGCTCCCTGGGTTATGCCTACGTCAACTTCCAGCAGCCGGCTGACGGTAAGT
AGAAGCTATGCCTACGAAATTGGGACCTCAGGGAACCCTGGGACTTATCTAGGCAAGTCC
TCTACCTCCACGGAGAGGGGCATCAAGGCAGCATGTTGCCCCAAAAGCCAGTAGTGGGAG
CCTCCTGTAAGGGTTAAGAACGCGGAGCCTGTCATCTTATGGGTGGAGTTGCTAGTATCA
CTTGCTAACTGGGTGACCTTGGGCTAATAAGTTGTGGAGGTAGGGTTGGAACCCAGGAAG
ACTGCATAAAGAGTGAAGCCACTGTCACTCTACTGTGTGTGGTGGTTCTGCTCAGTGGGA
CTGGACTGGTTAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGAACAAAAGTACTGTCACTTAGAGATAGTAGCAGAAGCCATTGGTCAGT
GTGTCTGCCAACACATACCTCTGCAGGACCTCTCCTGCTATAAATAAGACAGCCAGATTG
TCAGACTAAGCCGACTTGCCTTCTGCAGTGCTCACGTGAAATAGAGAGGAGTCGTGTAGA
AATGAGTCCCAGGCATGGGTTTCACATAATCCTCGCAGCCGACTCTCCTGTACCTGGACG
TTTCCTGTCCTTTGTCTCCCTTTTCCATGCCTTAACTGAAGAGTGTGGTTGGAAATAACG
AGGGAAAAGAAGATACTCCTTTGGCTGGCTGGACGCTGAACTTCTGGAGGGGAGAAATTA
GGGAGTTGATTCTGCAAGACAGGAGAAAGCTCCCTCACTCTAGCCCTGTCTGAATCCCCT
CAGGGAGGAAGTTCTAGGTGATGTCATTGCATTAGGGAAGTCACTGCTGTGAGGTTGTGC
TGTAAATCAGGTCTGGGTGTCCTTGTTGCTGCCAGTGAAGAAAAGGGTTCCTGGCTGGCA
GCTTATTTTTACTTCTGGTCCTTTACATGGTCTCCATGGTGCAAACATCGACTTGGTTGC
CAAACTGAGGAAAGGTCCCAAGGCACTGGATGACGAACTGAAGTGTGATTGGGCACCTGG
GCAGTTGAAATCCTGGAATTGCATAGAGCTCAGGTTACTGTTCAGCTGAGCAGTCCAGAC
CAGATCCACTGCTGTCAAGTCAATTCCAACTCATAGTGACCCTATAGACCAGTAGAACTG
CCCCATAAGGTTTCCAAGGAGCAGCTGGTGGATTCGAACTGCCAACCTTTTTGGTTAGCA
GCCGTAGCATGCAGTAGCTCGTAACCACGGTGCCACCAGGGCTCCAGCTGAGCACCCCTC
AAATGCCCAGATTCAGAAGACCTGGGAACCACTAGGTGCAGGGCCTAGCTGGACTGCTGG
GCTAGACAGAAGGGTTTGGCGGTTTCATCCTTTTTTGTCCTGATAAGGCAAGTCTCTTAA
CAAATGATAAAGCCTCGTCAAATGTGAGGTAAGTTTGAACTTGATGCCACAAAGCCATTT
AGATTATCCTGCTTAACCCCCTTACCCAGCAAGGACACAGACCCAGAAAGGATCGAGACT
TTCTGTCATGAGGTAGAGTGATTAAAAAAAAAACTTATTCTACTCTCGGTAACAAATTGG
GCTAGGGAAATCTGATGCCCTTTAATTTTAATAGAGTTGCCTTTTTATCAGAGTGATTAC
CTTGAAAAGGCCTGGAGTAACTTATGATAGTCACTTACATGAGGATAAGGATTTATATTC
CTTGACTGAAATGTGTTTCTCTTACAGCGGAGCGGGCCCTGGACACCATGAACTTTGATG
TGATTAAGGGAAAGCCAATCCGAATCATGTGGTCACAAAGGGATCCCTCTTTGAGAAAAT
CTGGCGTGGGAAATGTCTTCATCAAGAACCTGGACAAATCCATAGATAACAAAGCACTTT
ATGATACTTTTTCTGCTTTTGGAAACATTCTATCCTGCAAGGTAAACACTGATTAAACGA
TTTTAGCAGAACAAGTATTGAGTCTTGAATACATGATAAATACCAGAAGGGGAAGTGCCT
TGGAATTGGGCAACAGAGAACGGTAATTTTCAAAATGCTGGAAATGGTTCTGCATCCTAC
GAGTTCCTTGTCGATAATCTAGTGCCACAACTCATTATGGTCTGATAGGTGCTTTTGTGC
CTTTATTCTTCTCTCGGCCTGAAAACTCCTCCCGGGTTGCTAGTTTTGGAAGGCCTCACA
TTTTTTGGGGGGGAGGGGGAGGACCAGAGATGTGTCTTTGGGCTCCAGGAAGTTTTACGT
AATCATTTTGGAAGCAAACATGTTTCCCACTTCCCTCTCTATACACCTGTTTGTGTGAGG
TGCTTTGTAAAACTGTTGTGTGGTTATTTACATGTCTGGCTTCACCAAAACCATTGCCAT
CGAGTCAATTCTGGCTCATAGCAACCCTATAGGACAGAGTAGAACTGCCCTCATAGAGCA
GACTGCAACATCTTTCTCCTGCGGAGCAGCTGATGGGTTTGAACTACCAACATTTTGGTT
AGTAGCTGAGCACTTAACCACTGTGCCACCATAGCTGTGTGTGTGCATCTGACTTCACGC
TAGACCGAAATTCCATCATGGGCCTGGAAAAGAGCTCATCTTTCTGCAGCACTATGGTTT
GCACCCGATCTCTAAATGTTTTTTAGTGAAAGTAAGAAGCAGCCCGTTAGAAGCTTTCGT
TTGTAGATGGAGCACTTACTAGATGTCTGGCACTGTGCTAAGTGTCTTACCTCTGCTACC
TTTTGACCATAGATGGGCTAGAGACCTCTCAAAACACAGGAGACCCCTGACTAGGAGACC
ATGAGGTTCTCACCTCTCTGTAGCTGGCCAGTGGTGCTAAAATGGCCCGCTTTGTCTTTG
ATAGGTGGTGTGTGATGAGAACGGCTCTAAGGGTTATGCCTTTGTCCACTTCGAGACCCA
AGAGGCTGCCGACAAGGCCATCGAGAAGATGAATGGCATGCTCCTCAATGACCGCAAAGT
GTGAGTGTCCCAGTCCGGAGCAACAACCATCGCATGAGCCAGCCGTGGCCCCACCTCGGT
ATTAACTGGCACACACAAGGCGGCTACTGGTTCTCTCGGCCCAAGTGTGGCCTGCTCCTA
CCTCTCCACTCCAGGGCTGGTGAGTCTCCCTGCCCAAGCTGTGGCAGCCCTTTTGACTCG
CCAAGGTGGGCTTCCTGCCCATGCCATGGCCTGCCTGCCGCCTCTCCCTTAACGGCATTC
ATCTGTGGGTTTTGTGAGCATCTGCACCTGGGGCTGGCTGGAAGGCAGCTCTAAGCCCAC
TCTGAGCAGGGGTCTTGGCCAGCGGCAGAGTGGAGAGGGCCCTGGACTGACCAGGTGCTG
TATACTAGCCATGTGACCTTGGCCTTCCTATGACTTAAGTCTGTCCATGGGTCACTTGCT
AGTCGGCGATGCCAAATTGTCCCTCTAGAGCTACGTTTCCTAACTTAATGACTCNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNACAAACAAAAAATCCTATCTGTCCTTTGTGCTGTTGAACAGATCAGCGGTG
GTTGTATTGATAAATGTCTAGTGCCCACCAATCGTGTTTCACAGGTGTCACGGGAAAAAA
AAATTAAAATTTTTGCAGTATATGAATACATTTTCTTACTAAAGGTAAACAAAGCTAAAA
ATGACTAAAGCAGCGAAGGGTAGTTCTTAATTCACGCCAACAATCTCACTCCTCCTAGGA
TTAACCACTGTTAACAGTTTGGTTTGTATCCTTCCAGACCTTTTCTATGCATTTACATAG
ATGCACAGAAATGAACGTTTTAAAAACACGGTCTTCAGGTTCCTTCACGAAGGCAGTGTG
ATGTGGTAGGAGTAGCCCTGGTCTGAGCCAGGAGCCCTGGGACTGGTCCTTGCAGGAAAG
TCCTGCCTGTCGCTTTCTGCTGGGGAGTTGGGGCATCTCTGAGCTTGCTTTTTTGGTGGT
TGGATGGGGACTTGTGTGTTAACATCTCCTCTCAGCCTTTAACCCACATTCCTTCGGGCC
CCTGGAAATAATATTTGGTCCTTCAGGGTGATCACTGGTTTTCATGGTTTCTTTTTAGGT
TTGTGGGCAGATTTAAGTCACGCAAAGAGCGGGAAGCAGAGCTTGGAGCCAAAGCTAAGG
AATTCACCAATGTTTATATCAAGAACTTTGGGGAAGAGGTGGATGATGAGAGTCTGAAAG
AGCTGTTCAGCCAGTTCGGTAAGTTAGGATCCTTTGCTCCACGTGTCTCCTTTCATTGTC
CTCCAGACCTGGAATCCTGTCTGTTTTTACTCATTTAAGAGATGAGGGCACCCAGGCCCA
GAAGTAAAATACCTTGCATGACAAAGATCACAAGGTAGATAGGAATAGACCCCAGGCCTT
GTCTCTTGACTTCTTCCTACTTCATCTCATCCCCCAAGGCCCTCTCAGCTGCTTGGAGTT
AATTAGAAGGCCAGGTGTGGTGCCTCTCTGTCTTTGAGGCCATGTGGGTTCAGCAAGAGG
TTGGCTTCAAGTGGGTTCCTAGAAGCATTCTCTCATTCAGCTGTGGTAGAGAGATGGTGT
TACTAATAGTTCTGTCCTTTGGTAATAGGTAAGACCTTAAGTGTCAAGGTGATGAGAGAT
CCCAGTGGGAAATCCAAAGGCTTTGGCTTTGTGAGTTACGAAAAACATGAAGATGCCAAT
AAGGTGAGAGTACCACCAGTGTTTGTAGGCGGCAGCCCCAGGGTGTGGGGGCAGGGCCTT
GTCAGCACAGCCAATGGAGCCGGACTGGTCAGAGTATCTAGTTGCGGCTGCAGTTACCTT
GCTCTGGAATTACCTGAGTGATTCCATATGTTAATATCATTTAACTCTTCTCGAAGTACT
TGGCACATCCATGTGTCCTCAGCTATCAGCTCTCCAGCCCTGTGGGTTGGAAAGAACAGG
ACAAGGGTTTGTTCCCACTCATAGGTGAGAGAACTAAGGCTCAGAGTTGCTGCTTTGATT
ACTGCAGAGTATTGTGTGCTAAGCCCTTGATCTGTCTTACCTCACTTAATATCCACAAAA
GAGAAGTTGAGTGACAGCCAGAGTATAAACCTAGGCTCATCTTTTCCGTACTTGTATTTA
TGTGATAACTATTTTTTCCTATATTTGGACCAACAACCCACTTAAATATTAATTCCACTT
TACAGATGAGGAGGTTTGGATTTGTTTAGCAGACTTCAGAGATGGAATGAAATTAGTTAT
AAGCCCTGTAAGAAAGATTTCTTTGCCCCAGAATAATTGGTGGGACTTCTAGACCTTCAG
AGCATCTCCGGACCCCCTGCTTTTATTCACATCTTGATCTAAGGACAAGCATTTCTTTTC
TAGGCTGTGGAAGAGATGAATGGAAAAGAAATCAGTGGGAAAGTCATTTTCGTAGGCCGT
GCACAGAAGAAAGTTGAACGGCAGGCTGAGTTAAAACGGAAATTTGAGCAGCTGAAACAG
GAGCGAATTAGTCGCTATCAGGTGAGAGGTGGTCTTGGCCCAGCCTACTAACAGGATTTA
CTATGAAATATTTGCACAGCACCTTTATGTTTAGCAGGTGTTCTCTTTGGGGGTTTGGGG
TCTGCTCTTCCTAGCCTTTCTCCCAAGAGCGTTAGGTTTAAGAGAATACACCTACCAGAT
ATGACAGTGGCTATAAAACAGGGACAGAAGGGAGACTCAGCCTGTTGCTCCTGGACATGT
GGGCCCCTTGTACTTAAATAACAAAAAAACCAAACTTGTTGCCATGGAGTCAAATCTGAT
CATATAGCTGCCTCATAGGGTTTCTAAAGAGCCGTTGCTGTATTTGAACTGCTGACCTTT
TGGTTAGCAGCTTAGCTCTTAACCACTGCACCACCAGGGTCCCTTAAATAAGCCAAAACC
AAACCTGTTGCCATCCAGTAGAACAGAGTAGAACTGCCCCATAGAATTTCCAAGGAGTGC
CTGGTGGATTTGAACTGCTGACCTTTTGGTTAGAAGCCAAAGCACTTAACCACTATACCA
CCAGGATTTTAGTACCCCTTTATTTGGAATGGTGGACTCTGCGGGAGTTAAGGGAAGACC
AGGTCAGCCAGAGCAGCTGTGGGGAAAGCTGACATCCAACTGCACTAATGATAATGTTAG
TCTTAGGGAAGTGGTTTCACAACTTCAAGCCTGCAGGGCTTGTTAGCATGTGGATCACTG
GGCCCCAGCCCCACAGTTGCTGATACATTAGGTTTGGGGTCTGGCCTGAGAATTTGTATT
TCTAACAAGTTGCCAGTGATACTGATGGGTGCTGGTCTGTCGACCACACTTTGACAACCA
CTGTCTTACGGGGTGTATAGAGTACAGAAGTGCCATTAACAGTGCTCCTTCTCTTTCAGG
GGGTGAACCTTTATATCAAGAACTTGGATGACACCATTGATGATGAGAAGTTGAGGAAAG
AGTTTTCTCCTTTTGGGTCAATCACGAGCGCTAAGGTACTTTAATGCTGAGATTTGGGGA
CTGAAAGCAGAGATGTAGTAGTCCTTTAGAGGTTTATTGGCATTTGTTGTTTCCTTGAAG
GAATAGGATCTAAATTGTGCTCACTGCTGAGAGTAGCTACTGCATTATTTCAGCACACTC
CTTGCATTCAGTTACCTATCAGCGTGTGTGCGCTGGAGAATGACATTTCTCCCAAACACA
GGGACATGCGGTTGTATCTGACCCATCCGCTCCTTGCCAACCCCCCGGAGCACCTGAATC
TTTCCCATTCTCTGCTGCCTCGTGCTGGTGTGGGGACAGACGGTGCTACAACACGAGCAG
AGGAAATCCAGACGGGTTGTTCGCATTTGTCTTGGGGCCTGTCTCTACAACTCTGCCACA
CTCTCCTCTCTGAGAAGGAAGGGGTTTTGAAGACTTTGGAGCCAGGTTGGGAACTTCCAC
TTCGTTTAAGAAGGACAAGGAGGGTGGAAAGTTTGTTTTTCCATGTGATTTTGCAATGTG
CGGCATTGCTTGGTTTTCTTTGATAACTATTCCATTTTAAAGGTAAGGGATTGGAGTTCT
TGAGCAAGAGAATGTTGGTTATATGAGGATAATGTACTGAGTGTCCTTGGCATTTGGGAG
TGTGACAGAAACTGATGGCATCTGAAAGTTTTGGGTCATGGCCTGATGCAGTGCTAGTCC
TGGCGGCAAAGGTGTAGCAGACTTTATGAAGTCCTTTGGGTGACGAGAAAGGCTGGGGTG
GGCTGGTAAAGGTGTGGGGGCCCTGCCTCAGCCCTGATCTATGCTGGCTCAGAACCTAGG
GCTGTTGTGCAAAGGAAGCTTGTCAGTTGCAGTAGGGAGAGTTGACCAGAGGCACAAGCC
AACCTTGTGGGCTCCCCCCAGTTCCTTGCCCCTCCCTCTTACCGTGCCCTTAACTGGCCT
CCCATCACGGCAGAGAGTGATAGTCTTTCCTTGATTATTAGCTTAGTAGTCTAGCTGGTT
TTTGCAAGAAGATAGTAAAAGAGCCACATCATAATCATAGCACCATTTTCAAGAACATTG
TGTTGCTGGCCCATCTCACCACTTGATAGAGTTGTTGCGCTGAATATATGTCTTTAGGTT
CATGTCCTCAGCTTCAAGAGACTCTCCAAGTAATGAGCTAAGACACAAAATGATGCTAAG
CACACATTCATTGTGCTTTCATTGCTTCTAGGAGGTAGGTCACGGAAAGTGATTGCTTTT
TCAGGTGAAGGAAAGAGCCATTAGTGACTAATTTCTATGTTGAAAAAGAGTATCTGAACC
AGTAGACCTGTGGCTTTGTAGCTATTTGCCTTAACACGAAAGTTGAGGCTCAGGGGGGAA
AGTGAGTGATTTGTCAAGGTTATACAGCTTGGTAAAAGCAGAGCTGGGACTAGAACCCAG
GCTGCCTGTCTCCCACCTAGCTGTATTCCTGTATTGTTGTTCCCGTTGAATTAGTGGTGG
CACCCAGTGGTGACTCTAGGGTTCCATAATTCCTGCCTGCATGTGATATTTCAAAGGCAT
ATCCTAACGTTGCTAAGAGTTGGGAAAAGTTTTGTTCGCCATGTCTCCAGCAGATGAGTT
CTACAGTCGTTTGATGCTAATGTCAAGATCTCTTGTGGATGTATGGAGTGGTGGGTAGCT
ACATTTCTAGGCATCAGGAAACTTTTTTTGTGTGTTCCTGGTTCAACCATTAACCATATT
GTAGTGTCTGGGAACCTCAGAATCACCTAGAATGCCTAGGTTCTACCCTCAGGTTGTGAC
TTCATTAGTCTGGGGTACATCCTGGGTCAAGGTCGAGAATCCCTGACCCAGACATGGAAC
TGCTTTGCAACAGAGCCCAGATTTTCTAGCTCTTCTGAAATAAATGCCCTTCTAACACTG
CCGCCCCCCCCCACCCCCACACACATACAACTTTTCCTTAAGTAGCTGCTCTTGTTTGGT
AGGTGATGTTAGAGGATGGGAGAAGCAAAGGGTTTGGCTTCGTCTGCTTCTCATCCCCTG
AAGAGGCAACCAAAGCAGTCACTGAGATGAATGGACGCATTGTGGGCTCTAAGCCACTGT
ACGTTGCCCTGGCCCAGAGGAAGGAAGAGAGAAAGGCTCACCTGACCAACCAGTATATGC
AGCGGGTGGCAGGAATGAGAGCACTCCCTGCCAACGCCATCTTAAATCAGTTTCAGCCTG
CAGCTGGTGGTTACTTCGTGCCAGCAGTTCCACAGGTGGGTCTGCTGGATGCTCATGGCT
CTTTGGAACCTGCCTAGTGACTGCTCCTGGAGCCTGGGGTTGGGGGAGGGGAGGGAGGGG
CAGTGATTTTCTGGTATTAGACTTTTAGAATGTCAGTAAACCAAAAACTAAACCAAACCC
AGTGCCACTGAGTCGATTCCGACTCATAACGACCCTATAGGACAGAGTAGAGCTGCCCCA
CAGAGTTCCAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGCTGTGCAGCTGCTGCTCCTCGGGCTGT
GGCACCATACAAATACGCCTGCAGTGTCCGCAGCCCTCATCCCGCCATGCAGCCTCTGCA
GGTAAGGTCCACCACACAGAACGCACAGGCATTTTTCTCGCTTCCACTTGATTTGAATGA
TGCTTTGCTTTGATTCCTTCAGCAGGTATCAGGTGCTGCTATGTGTCAGGGCACTGTGCC
CTGTGGTGGATTCATCAAGCACTGTCTCTGCCCTTGAGGAAGAGAAGGGGCTTGATAAAA
GTAAACACAGATATAAATGCAAATTCTGCTAAGTGTTTTGCTGCTTTTTATTTTTATGGC
GTATGTACATATGTGTGTGTGTATATATATATGCACATATACACGTGCTCAGCTTTTGAG
CTTCCAGGTGAAATTCACATCCATTGGCCTATTTGATTCTTAGGTGCTCTGCAACATGAC
AGGTACATTAAAGCAGGAAAGACCACAGCCTTACAAATGGCAAGTTCAGCTTCAGATCTT
AGATTTTCTAAGCTGGGACTTGCTGTCTCTAGAGCTGTGTCCCTAAAGGTGAGCCAGGCT
GTGACAAATTTGTCTCAGGGCTGAGAAGTTTGCTGTGGAGGAGCCACATTCAGCCTTCAG
GCCCATCAGCTGCTTAGTAGATTGCTCTTTCATCCTCCTGCCCGAAGCAGTCTAAGTTTA
AGGTTTCCAGGACTTGATGCTGTGCAACGATCTCTTTTGCCTACAAGGCCCTACTTTTAG
TGCTATGACTGGTGTTGACATTTCATGTCAGTGAAACATGTGAGAAAAGGTAGAGTAGAG
GTTATGTGGGTTGTAATGGTAAATGTTTTGATATTCACACCCTTTGAGCCAATGTCTTCT
GGGAATTCATCCTAAAGGAATACTCTGATTTTCAGGAAAAGGCTACACAGATACACAAAA
GCCTTATTTAAGAAGGCTTCAAGTTCTTTAGGAACCTTGGGTGAATTAAGATAATGTCAG
GAAATCCTTGTGTTGCATTGTAGGTTTATTTTATTAATTTCACCTTCCCTTATAATGGCA
TACCATTTTTATTGTAGTTGACCCTACTCTCCTCAGACCCCAAGGACTGAAATTAGTTCC
TTGAGAGCAAAGAATGCCACATAGTAGCCATTCAGATGTTGAATGTTTGGATTGTCCTGA
CCGTCACCATTGTGAAGAGTGTCCTTTCCTTTGTTGCTAACCTGCTGTCCCTCCTGGTTC
CAGGCCCCACAGCCTGCAGTCCACGTGCAGGGGCAGGAGCCCCTGACTGCCTCCATGCTG
GCCGCAGCACCCCCACAGGAGCAGAAACAGATGCTGGGTGAGTGACCTGCGGACTTGAAG
AAGAGGGGCCCAGACCTGGTACTGGCCCGGACTCTAGCACCCACTCTTGACTATGATTAG
GCCTGATTTTTTTGTAAACATCCTTCCACAGGAGAACGTTTGTTCCCGCTCATCCAGACG
ATGCATTCAAACCTAGCTGGAAAGATTACAGGGATGCTTCTGGAGATAGACAACTCTGAG
CTTCTGCACATGCTGGAGTCTCCTGAATCTCTCCGCTCCAAGGTGAGCTGGTGCTTGGGC
TCAGGGCTTTAGCTGGCCCAGCTCAGGATGAGGGACACCCAGGGGCGGAAGTGAGAAGAC
TCCTCATGCCTAGTGATTTCGGGCCTGCTTCACAGTGGCTAAGTGATATGGCTGCTAATC
AAAAGATTAGCAGTTTGAATCCACCAGCTGCTCCCTGGAAACTCTATAGGGCAGTTCTAC
TCTTGTCTTATAGGGTTGCTATGGGTTGGAATCTACTGAACAGCGGTGGGCTTGGTTTGG
TTTTCTGTGGGTATAAGGAGCCCTGGCAGCACTGTGGTTAAGTATTCTGGCTGCTAACTG
AAAAGTCAGCAGTTTGAACCCTCCAGCCGCTCTGTCAGATGTGGCAGTCTGCTTCTGTAA
AGACTACAGCCTTAAAAACCCCATGGGGCAGTTCTGCTCTGTCCTGTAGGGTCACTGTGA
GTTGGAAGCAACTCGACGGCAATGGGTTGGGGTTTTTTGTGGGTCTTTGGGAAAGCAGTA
GGCACCAGGAGAAGCTCGGAGATCATCTCTGTGGTTGGTTCTTCCATTACTGGGCCTGGG
CACCAGGGAGGGGGCCAAGTGGCTTTCCTTAGGTGCCACCAACCCACTGGTGATTTCTCA
CAGGTGGATGAAGCTGTGGCGGTTCTACAGGCTCATCATGCCAAGAAANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1193, 3747..3940, 4864..4979, 6298..6437, 6808..6902, 7563..7700, 8579..8674, 10622..10894, 11875..11962, 12063..12182, 12283..12369, 13134..13174, 13177..13260, 14403..14496, 14611..14741, 15363..15407
1001..1193, 3747..3940, 4864..4979, 6298..6437, 6808..6902, 7563..7700, 8579..8674, 10622..10894, 11875..11962, 12063..12182, 12283..12369, 13134..13174, 13177..13260, 14403..14496, 14611..14741, 15363..15407
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved