Loxodonta_africana Locus NCL
snOPY snoRNA Orthological Gene Database
Loxodonta_africana NCL
Loxodonta_africana
NCL
GeneScaffold_2123
SNORD82
8158..8227
13689
GGGAACTTCTGAGGTGGTCAAAGACCCAGCTGCAGTCTGCTGACCCAGGTTCATCTGCC
GATCCCAGCGGTAAACCCTGAGACGGCCAGAAGCTTACGAGTCTGATCCCCGTGGGGAGG
GAAATACCTACCGCATGAGGCTGTGGGATTAAATGAGATGTCTGTGCGCTTATCAGCAGA
GCCTGAACACGGTAAGCCTCTTTATTAACAGTTCTCAGGGGACAGCTTCAGGCCCACGGC
CTGGGAGCGTGTCACCTGTGCCCAGGGAGATGTTTCTGGTCCCTGGTTCGTGGATGGACG
GGGCTAAGGTGGGCACCGAAAGGGGCAAAGTGAACCCTGGTCCCTAAACTTTGGGCGGGC
TCGGGCTCATCAGCAGTTAAATGGGCCGAAATCCTCCCCACGGCCGCCGGGAGTCTCAGC
GTGGAGTGCGGACCAGAGCCGCGCGTGGGGCATCGCAGGACCCGCAAAGACCGCCCGAGG
CGATAGGGCTCATATACGGGAGCTGCAGACCGCCAGCCCCCGCCCGCCCCAAGCCCGGGC
CCACCCGGCGCCAAAATGTCCGTCTTACGGCGCAGGCGCCATAAGGCAGGCAGCGCAGGA
GCACCCGGGGCCGCGCAGCCACCGCCCAATCAGCGCAGGCTTCGCACAAAGCCAAGCCCG
CCCCCAGGTGCCGACACCAAGCCTCCCTCCCATCCCCCGCCGCCTTGGCCCGCCCACTCC
CGCCCCGCGCCGTTCTCGGGGAGGGGCTCGCGATTGGCTCGCGGGATGGACGCGCGCTCT
GATTGGCCAAGGCGGGGTCACGAGAGCGCCGTCGTCGCCTTTCCAGAGGCGATTACTGGG
TAGGCTCCGTCTTTTGCCTCAGTCTCGAGCCCTAGCTGGCAGCGAAGCGTGCGCGCTCCA
GGCTCTTCAGCACTCGCGGCCGCCATCGACGTCGCTTGGGTTCTTCTAGGCTCATCTGCG
CCACTCACTCTCCACACACTCCGTCGTCACAAGCCGCCATCATGGTGAAGCTCGCGAAGG
TAAGCGGCCTTGCAGGCGCAAGGCCGGGCGTCGGGGCCTGCTTCCCGAGGAGCGCGCGCG
CGGCGCCGCGAGGAGGAGGGCCTGCGCGCCGTCCCGGGCGCGTTCGAGGTTCGCCATGCT
GACGGAAGTCTCGCGCGAGAAGCGGGCGGGTCTCGCGGGTTTTGGCGACATGGAGACGCG
GTGAAGAGCGCCTGCAGGTGCAGGGGGCGGTGGGCACGGCGGGGAGAGACTTCGGGGCTG
CGCGCGGGAAGGGGCGCGGGGCCCCGGGTGGAGGGGTGAGGCGGGAGCCCGCGACGCGCG
CGAGCTGGCCCCGCCTCCTGACGCACGTGCCCCGGCGCGCGGCCTGCCACGCGGGCCGCG
CCGCGTGGGTCCCTGCGGCTCCGGAGAGGGCCGTGTTCTAGCGGAGAGCCGTGGGGCCGC
GGGCCGGGGGCAGCGGCGGGGTGGGGTTAAGGCAGACGTCCGGCGGCCTACGGGGTCCCC
GCGCGGCGAGCTGGCACGTGGTGAGCCCCGGATGGAGACGCCGCCTCCGCGTGTTTCTGC
GTGCACATGGTGGCCTGGGAGACACCCCCACGTGGCCCGCTGGGCTCTGAAAGTTGGGGG
GTTTCTCCGGGAAGGGAACACTGTTAAAAAGACCACAAGTGTTAAAAGGTGACTGAAAGA
TCGTGGTTTTTAATTTGAATTCGGACCACGTGCCCAGAATTTATCAAAGGCTTTTCGAGG
GTAGTTTCCCAAGGGTAAAGGATTATGAATTGTTGGTTGCGCAGTGGGCCTGGCGCAAGG
TATTGTATATTAAAAAACACTCAGAGCAATATTTAATAGTTAGGGGATAATGTTTTTAAA
ACAGCCGTGGTTCGGAAAGGCGACAGGAAGAGGGAGATCGTTTTTTTGACCTGTTATTCT
AGGCTTGATTTTGTAGCTGTACAGACTGACAGGAAAAATACAGGTAGGTTGAAAATGCTG
TCTTAAGTTGTATATTAAGACTTGTTTGCATGTTAATGGTATTTAGCGGCATGGAAACTG
GATTCTGAGGAAGAAAGAACTGCATTTTACTACGTAGACTAATGGCAAAACATAAATGGC
TTGAAATACTGGTGCAAATGTGGTGTGCTAATAGTTGTGTCCATTTTAGGCTGGTAAAAA
TCAAGGTGACCCCAAGAAAATGGCTCCTCCCCCTAAGGAGGTAGAAGAAGATAGTGAGGA
TGAGGAAATGTCAGAAGATGAAGAAGAAGAAGAAGAAGACAGCAGTGGAGAAGAGGTAAT
TATATGTGATTTGACACGGAATGACATTAAAACATAAAATCAGGGAGGTGGTGTTAGGTG
TTTGAAAATACTACCAAAACTGAAGGTTTATATTAATTCATACGTGGCCTTGTATCATGG
TTGTCTCCCAAGCTTTTCTTTGACATATCAAGATGCAGTTTGGGTAAGTATTTGAGTATG
AGTTTGAGACCTGACAAGATCTCAGATGCCTTTTTGCTGGCCCTTTCTTGGGGTAGGTGT
GATGTGTTTAATGATTACATTTTTCTAGTTTTAACATTTTAGCTGCATACGTTAAATAAG
GCCACAGCCTGGACAGTGGGCAGAACTGAGTATCATATTCAGGTCTGAGGAGTCCATCTT
GTAGCCTTATCACATCTCTTGACTAGCTTCTAAGCAGGATCAATTGATCTGTATTTCACT
GTGGAGAAGCTTGGTAACAATCGCATTGTGTTATTATCTGTATGTGTTCAGGGTTGCCAC
TTGTCTTAGTGCTGACCCTCTTTATAGAGGGCTTTATTCTTCCCACACGCTACGTGATAA
ACTAATAATCAAAAAACAGCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCATTGGGCTTAATTACCCACGACTGACTGA
CCTCCAGGAAATGCTGTGTGCCTGACAGAACGTTCTGGGAACGCTCCTTGTAACGCAGGG
TTTTGCTTCCAAGTGACCTGTTCTGGTTTTGTTTTTTTGTACTTTAGATGAGATTTACAG
AGCGAATTAGTTTCTCATTAAACGAAACACATTTTATGGCGTTGGTTGCCAGTTCCACGA
CACGTCGACACTCTTTGCCTTCTCGACCTTGGGTTCCCCATTACCAGCTTTCCTGTCCCT
TGCCATCTCGGCCTTGTCTGGGCTGGTGTGCCCATTCAGTCTCATTTTCTGTGGGCCTGT
CTAACCTTCGGCTGAAAGATGAATCTCAGGAGTGATTATTACTGAGCTGTAAGGCTGTCT
GGGGGCTGTACTCTGGGGTGTTCTCCACTCTATCAGACCAGTAAGTCTCCGCCCCCCCCC
CCCCTTTTTTTCTTCTGTGAGTTAGAATTTTGTTCTACGTTTTTCTCCAGCTCTGCTGCA
GGGCCTTTATTGTGATCTCTGTCAGAACAGTTGGTGACGGTAGCCAGGCACCATTTAGTT
GTGCGAGCTGTTAATTCTTGCCGTAACTGGTGGTATTGATGGGATTGTGTTTTCTGCAGA
CTTCTTAGAACCACAGTTGGGTTCTGAGAGAATGCTGTGTCTAACCGAATGCCCTTTCTC
TCTTAGACTCTGAAGAAGAGGCCATGGAGACTACACCAGCAAAGGAAAGAAAGCTCCTAC
AAACGCGCTGTGAAAGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGAAGAGGAGGAGGATGAGTAGATGAAGAGGAGGAAAGGTAATCAT
AGTAGCTGTTGAAGTACTCTGACTTGAGTGTTAGAAAGATGTACTTGAATGTGTGTGACA
GCCCGTTGATAACACATCCTTTCAAAACTTACCCAGAACCTGTCAAAGAAGTACCTGGCA
AACGAAAGAAGGAAATGTCCAAACAGAAAGCCGCCCCTGAAGCCAAGAAACAGAAAGTGG
AAGGTAACTTGCAGAATTTGGAGGAGTGGTTGGGGGAGGGGCACAGACAAGGTTTAACAG
CGCAAATGATGAACAACAAAGGGACTTAATGCTGAAACCTGATGTTACGTTGTGATGCTG
ATATGTGCTGGGTATAGAAGTGTTGAATGGAAATCAAATATGTGTCACTGTTACTAGATT
GACTGTAGTTCCTTTTGTGTATAGCCGTAGAACCAACTTCAGCATTCAATCTCTTTGTTG
GAAACCTGAACTGCAACAAATCTGCTCCTGAATTAAAAACTGGCCTAAGTGACCTTTTTG
CTAAAAATGATCTTGCTGTTGTGGATGTCAGAATTGGTATGTCTAGGTGAGTAACTTGGG
CTTCTTTCAGAATCTCTCACTTGAAGTTGCCGTAATCTATCTTAACTTTTGGTGTAACAC
AAGACAACTCTTGACAGAGAATTTGATGCTTGTATTTTTGGAAATAATCTAGAATTCTTG
GACTCTAGTAGCCATAATAGTACTTTTTAGCTAGATAGGATTTTTTTCTTAAAGTGTAGG
CCGGTTTTTTATCACAATCTAAAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCTGCAGGTGCCCAGAATA
TGTGTGTGGCTCTTGATTTTTTCCTCTGTAACTTTTTGCCCCTCATCGCCTTAAAGGAAG
TTCGGCCTATGTGGATTTTGAATCTGCTGAAGACCTGGAAAAAGCCTTGGAACTTACTGG
CTTAAAAGTCTTTGGCAATGAAATTAAACTAGAGAGACCAAAGGGAAAAGACAGTAAGAA
AGGTACGTGGGAAAGTATGGAAAGTTTTTGATCATTGTGATGCTAAGGGTAACTTGTCAA
CAGATGTGTACCTAGAGGGTCCACCACCTGGCTGGCTTGCATGTTGCTATGATACTAGAA
TCTTTGCCACCAATATTTCAGATATCAGCAGGGTCACAGTGGTAGACAGGTTTCAGTGGA
GCTTCCAGAAGGACTGGGAAGAAAGGCCTGGCAATCTGCTTCCAAAAATTACTTGATGCA
AATCCTCTGAGTCATACCAGAACAGTGGTGGAGGGTTAGCCCACTGGGCTTAGAGGGCAC
TACACAATGGCTGAAACAGTGGGCTCACACGGTCAATAATGAGTGAAGGGACATGGGGTT
GCATGAGTCACAACCCGCTCAATGCAGCTACTAACGTCTGTAGGGTAGCCTCATGTGGCT
AAGAGCGTGGCCTCCAGTGGTAGACTGCCAGGGCAAATGGTTTAACTTTTTTCTCTTAGG
TTTCTCATAGTTTTATGAGGATGAAATTAATTAGGATATATTAAGTGTTTACAACTGTGC
TTGCCACTCTTTGTTGCTACTATGATAGAAATTCCAGGCAAGCAAGCAAGAGAATTGCTT
AGGTGCACCTGAAACTAGTAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGATGTCT
TTATTGTTCTTGCATCTGAAACAAGATCTTGCTGCTGAGGTTAAAACATTTGTGTTAAAC
AATTTTTTGTTGTTTATTTATTTTTTTAAAAAAAGATGAATAGTTAAATGTTTTTTCGTC
TCATCTCTACTGCAGGTTTGCTTACATTGAATTTAAGACAGAAGCTGATGCCGAGAAAAC
TTTTGAAGAAAAGCAGGGAACAGAGATCGAGGGGCGGTCAATATCGCTATACTACACTGG
GGAGAAGGGTCAAAATCAGGACTACAGAGGTGGAAAGACTAGCACTTGGAGCGGTAAGGC
TTCCTCAACATGGGTCCACGTTCCAGAATTGATGGAGGGAAATTCTTTGTGCTTTTTAAG
TTGATTGATTGTAATTAGATGGGGATGAAGGTCAGAGGAGGGTGATAGCCAGATTTTGTA
GTAATTCATTTTCTTAAATAAGGGCTATGTGAAATCATTTTGTGTTGAAGCACAGTAGGT
CAATTTAGCTTCCTTTGCAGATTTATTTTATGCTTTAACATAGATCTGTAGATTTTAAAA
TTAGAGTATTCTGGGAGGATGTACTAGTTCAGTAGTAGGGTGCACACATAAACAGGAACA
GAGGGGAGTGGCGCATAGCAGTATATGACCGGTGTGGCCTCACTTGCCTCAGCGTTGGCA
TGTTCGTTATCCCAGCGCACAAATGTTCTTAAGAACAAGGTGTCCGCCATGACTAAAATT
GGGAACCACTGTTTCTCCTCTTAAGAACGTGGCATCTCTGTTTGTAGGTGAATCCAAAAC
TCTGGTCTTAAGCAACCTCTCCTACAACGCGACAGAAGAAACTCTTCAGGAAGTATTTGA
GAAGGCAACAGCTATCAAGGTGCCCCAGAACCAAAACGGCAAATCTAAAGGGTAAAATCG
TTACTATCTTGTCAGTTATGGACTGTTACATCTTAAATCAAAAAAAAAAAAAAAAAAAAG
TAAAATCAGGTTTTTCTGACTGTCAACAGAAGCTGAATTTTTTTTAAGCTACAATTTTTA
AGTTGGTTGAGGTTCAGCATGTAAGTAAGAGGAGTCTGCCTGGTAACTTATTCTAAATAT
TAACACTTCATCTTTAGGTATGCGTTTATAGAATTTGCTTCATTTGAAGATGCTAAAGAA
GCTTTAAATTCTTGTAATAAAAGAGAAATCGAGGGCAGAGCAATCAGGTTGGAGTTGCAA
GGATCCAGGGGATCACCTAATGCAAGAAGCCGTAAGTTACATCCACTTCACAGCTCCTCA
GTACTGTGCTTGGAGTTCCCGTTCAGGCTGGTGTTCTGCTTTCCCCCATATCTTCAGGTC
TTTCAGTCGCTACTGAGTGAACAGTACTGGACATGATGACTGATTTTATCTGAGAAATAA
TTGATGAACCTCAAGAAAATTTCCTCTAGATAGTCAAGTTCTGACCCAGATGTGTTTGAC
TCAGCAGCACCTTTACCATGATTAGGTGCCCCCGATGGTGGGTTGTAATTGGCTGTGTTA
AGATGACTTTTGACTTGTTTTACGTTGCTTCTCCTGCTTTCCGTAAAACATCTGAGATGA
AGAATCTTAACAGCTGTCTAAACTCTAGTTGCCAACAGAATCAAGGCCCTTTCCTTTTAA
TTAGCGGTAGTTAACTAAGATGGCTATTTAACTGCTTTTGTAAGCCCCTTTTTGTTGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1018, 2149..2274, 3951..4428, 5226..5257, 5260..5286, 5289..5298, 7789..7892, 7895..7906, 7911..7911, 8016..8102, 8304..8445, 8996..9005, 9007..9121, 9843..9966, 11595..11752, 12227..12350, 12557..12689
1001..1018, 2149..2274, 3951..4428, 5226..5257, 5260..5286, 5289..5298, 7789..7892, 7895..7906, 7911..7911, 8016..8102, 8304..8445, 8996..9005, 9007..9121, 9843..9966, 11595..11752, 12227..12350, 12557..12689
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved