Loxodonta_africana Locus CCNB2
snOPY snoRNA Orthological Gene Database
Loxodonta_africana CCNB2
Loxodonta_africana
CCNB2
GeneScaffold_4724
SNORA11
17957..18083
22804
GGATAAGTAAACTAATTTTTAAAGAGTAGAATGAAGTAGGAATGATGGAAAGTTTGCTC
AAGTTCCTAAGCTGAGCCTGATAACCTGGCCATTCCACTGCCTTTACTGTGAGCTTTGGA
CCTTCGTCCCTCCGCCCCCTTCCTCCTCCTTTCCCTGTAAAGGCCTTAATCACCCATGTC
CCCGTCCACCTCTTCGCTTTTCAGGGCAATCTTAATACTGTTCAATTTGCTGCTCAAGGC
TTGGGGCAGGCACACTGTCCCATTTTAAATCTTCACGTCTTGGTATTGTTTATCCGATGA
GTATTTAGCGAGCACCGATCACGTACCAAACACTGTGCCTGGGGCAAACATTCATCACGA
GGCACACAAGTCACGTTTACCCGTTTTCGCCTCTCCCGGGAATCTTAGTTTCTGAGTATA
CGCCAGGATACCCGCTCCGTTAGCATACGTTTGAGTCTCACCCCCTAACACTGCAGCCCG
TGGCCCAGGGCAAGCGAGCTAAGCAACCGCTGACATATCCGGGAGGGAGCAAAGGTCAGA
AAGGGTGTTTCCGCGCTGCTCCCCAGAACCCACTTCCGTCCACCCAGAACAAACGTCGAG
ACCGATCTGTGGGTGAGCGCGCGTCGAAATTCTGGGAAGGCGTCCTGCGTCTGCTTTCCC
AAACGAGACATTTCCTGTTTGTTTTTCTTAGAGGCCAGGATTTTTAAAAAAGACAGCAGG
CAGAAAAAACAACCGGTTGTTATGACAACCAAACGGGGCTAGGGAAAGTCAGCCAATCAG
CGTGCGTGAGTGCCTCTGGCTCAGCCAATGGCAGGCAAGCGCTGTGCGTAAGGCCGCCCA
ATGGCGCACGGGCGGCGCGGCGTTTGAATCGTGGAGCTGGGCGACGTCGCGGGAGGAGCC
TCGTAGGGCAGGAAAGCGACCCTAACGGCGCCCCGAAGCTTGTGCCCCTCCAGCGCGCCG
TGACCCCGGCCCGGGCTGTCACCTCGCCTTCCCGGTCCCTAATGGCGCTGCTCCGACGCC
CGACGGTGAGTGGGCCCCGCCACCCTCGCACGGGCCGGGGCCTCGCCCGCAGCCCCTCAC
CTCCTCTGCTTCCCCCCTGCTGCCAGCCTCGCCCGCACCACGCCGCCTCTCCCCGCCTGG
GTCCGCCTCGGATCCACCTCCGTGCTCCGACTCTCCGTGCCCGAGGGCGTCGAGGTGGAG
GGGGGCGCGTGGGGACTGCAGCCTGGCTAGCCAGCCAGCCCAGGCTCCACGCAGCGAGCG
ATCCCAGGTGCTCTTTGTTGGTTGAGAGGACCCCCATGCAAATCTGGGGGGTCCTTCCCT
TTTCCCAGCACCCTGCCAGCTTAGGGCTCTGTTGTGGGGGCGGGGAGGAGAAGGACTGGA
GGGAATTCCAGACAGTAAAGGCTCTGAGTGTTTGGTTATCAACAGTCATGGCATGTTTTC
TTTTGTTTGAATTTCCCCATTATTTCTGCACCCTAAGTCTTCCTAGCCTAGTGCACTAAT
GTTTGGGCTTGTCCTTTTAAGAAAATTCTTTCACTCACGTGCAATAGAGATTTTACATAT
AATTTGTACCAATATGGCAGCCTGAGAGAAAAGGATTCAAGTTAATTTATTTCAGGTTTG
CAAAAATAAAAATGTTACAATTTTTGGATATATTTCCTGTGGGCTTGAATGGTATCTGAA
CCTAGTTTTCCTGTGCTGAAAACGAGAGGGCCCTGACACACCTGCATTCCATGTTCTAGC
TAAAAGGCTAGTTAAAAGCTGTCAGTTTTTCCTTCCAAATGAATTTAAACTTAGTCATAT
CACTAGGCTTCAACCCACGAACATTAAACTTTCAAACTTTTTTTTTTAATAGATAATTGC
TGCTGGAATATTGTACAGTGTGACTTAAATAGCTTGANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTTCAGCTGCTAATTGAAAGGTCAGCGGTTGGAATCCACCAGCC
ACTCCTTGGAAACTCTACGGGGCAATTATACTCTGTCCTGTAGGGTGGCTATGAGTTGGA
ATCAACTGGCAACAGGTTTTTTTTTTTTTTTTTTAAATACGTTCAGTATTCAGTTCATGT
CCCTTTGTGGATCTGAGTCAAACTGATGAGTAATTTTTTTCTATCGCATAAAGTTCTTTA
ATTGTCAAGTTATTTCTGTTCAAGAGTTTTCCCCCTCCCCTCTGTCTATCCTAGTAAAAA
AAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTCCACTCAAACCCCCTGTTATGTTGA
TAGATTTTTTTAGGCTTAGCAGCCGAGCTCTTAACCACCAGTCCACCTGGGTTTCCTTTT
TAGGATGAGGACCCCACAACTCTTAGGGATAGAATATGCTGTTCTTTCTCAAGAAATGTT
CATCAGTTCTATAATGTAAACCTTTTTGTATGAATTACTTTTCCTAGCAAGTTTTGTTGC
TAAGCATTTTCTGTCTGAAGCAAGTTAAGATCAACTAACAGTTTTTCTTTCCTGCAATTC
CAACCTTCCCTAAATTTGAGAACTAAAACTGCTTTACCCTAGAAAATTATTTCCTTTCCA
AGCATCCTTAATATAAGAGATTCTGTTCAATGGCAAGCTCATTTAAATGGACTATCATGT
CTAAGGGAGCTTGTCTTATTTCTAGAATGGCACAAGAGTCAAAGCTAGTTTAGGTTTTAG
ATGTCTAGATTTTAAACAGCCAGGCCTGTTACAGCTTTTTTAATATTGTGTCCTCACTGC
ACTTGCTCTCAGTTTCTGTAAAGGAAGGCTTTAAAATAGATGCCAAATTTACGGGCTCTC
TACTAAGTGATGGGTGCTGTGTGAAAAATAGTCCTTTACCTGTGAAGTTTTAAAGTTTTT
CTTAGAGGCTTGCGGGAATACTCAAAATACCTTTGCAAGATGAGGGAAGGGTCTTTATTA
CAGATAAAGTAGATGAGTGATTTGCCTAATTTAGAGTGGTGTTATCAATCACAGGAAACC
CTGGTGGTGTAGTGGTTAAGTGCAACGGCTTCTAACCAAAGGGATCAGCAGTTCACATCC
ACCAGGCACTCCCTGGAAACTCTATGGGGCAGTTCTACTCTGTCCTATAGGGTCGCTATG
AGTCGGAATTGACTCGACGGCACTGGGTTTGGTTTTTGGTTTGGTATCAATCACAGTTAG
CGTTTTTAGGCCTAAAATGTATCTTTCCCTCTTTCAGATAGATCTGAGCATATTCACCTT
TCCCAAAACTATTATGAATTTGGCTATCTGACTTAGCAAAGTATTTTAAATTGTCTAAAC
TCTTCCTTAATTTTTCTTTTTTTAGGTGTCCAATGATTTGGAAAACATTGACAGAGGAAT
TAATTCTAAAACAAAGAGCCATGTGACTATTAGACGGGCAGTTTTAGAAGAAATTGGAAA
TAGAGTTACAACCAGAACAGCGCAAATAGCTAAGGTAACTACCATGATGGCACTACATGT
GCATGTGGAGCTGATTCTGTATAGCACTCTGTGTGTGCATGCAGGGCTGATTCTGTCTAG
CACTCTGTGTGTGCATGCAGGGCTGAGTCTGTCTAGCACTCTGTGTGTGCATGCAGGGCT
GATTCTGTATAGCACTCTGTGTGTGCATGCAGGGCTGATTCTGTCTAGCACTCTGTGTGT
GCATGCAGGGCTGAGTCTGTCTAGCACTCTGTGTGCATGCAGGGCTGATCCTGTATAGAA
CTGTATGTGTACATGCAGGGCTGATCCTGTATAGAACTGTATGTGTACATGCAGGGCTGA
TCCTGTATAGCACTGAGGGACAAAACTTGCCAGCTTGCCCTATTCACGTCTCTTTCCTTG
TAGAAAGCTCAGAACGCCAAAGTACCTGCTCAAGCCACCAAAACGAAAAATGTCAACAAA
CAAGTAAAACCTACTGCTTCTGTGAAACCAGTACAGATGGAAATGTTGGCTCCAAAGGTA
GGAAGTTCTGAATTTACTAACATAGTTTGTGAAGTAGCCACTTTTTAGCTAAACTGAAAG
AATGCCTTTGTCATTACTATAACTTTTGAAACACATTCTTCTTTGAAGCAAAAGTGTAGG
AAATGAATACGTATACATTTTAGTGGTGGTACCTTAATTTAATATTATAATCTTGAATGG
CAAAGCTAATTGCCTTCACGTCCAGGTAAATGCAGTGTTCTCAGAGTGCAGTGTGGTGAG
CTTTATTACAATAATCCACTACAAGGATGAGCTTCCCTACAGAGGCTTTGGAAGCTCTGA
GGTCTTAGACCCAAACTCATGTAAGAACAACGGAATGTCAGAATTCTGTATTTATAAGTT
ATAGTCTGTGTGACTGGTTCGCTCAGTTGGAATTAGAATGCTAATGGATCCGTCAGCTTG
TTCACCTTCCACCGTGTTCAGGCTCATGTGTGCATTCGTTCAGAAGATCCTGTGCAATTA
CTATGAGACGGGTGCTGGTGCTGGTGCTGGTGCTGGTGCTGGTGCTGGTGCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTGAGCACTTACTGTATGTATCCAATGATGTTTAGGCTGAAGTAAGAGATA
TCTTGAATTAGTGATCTTAGACAATGATGCTGGATGCCCCTTGGCAGCATGTGGGTGAAT
GTGTAATGACTGGGCTGATGTAAGCGCAATCCTTTGGAAGCTGTACCTACTGGAGGGAGA
GAGCACCAAGGGATGGAGTGGTCGGGGAATGTCGTCATCTAAGTGGGATTTTAAGGATAG
GGAGAAGCTGATAGGACAGGTGGGAGAGAGCACTGAGGGACGGAATGGAATGTCGTGGCC
TAAGTGGGATTTTAAGGATAAGAAGAAGCTGATAGGAAAGAGTGTCTTTTTGGGGGGACA
AAGCAATAACAAGAATAAAGGCACCAAGATGGAAATAGGCCTGTATCATGTCCTTTGGGC
AAGGAAGCGGCAGCTCTGATTTGGGTCAGAAGACCTGTGTGTGTAAGCAGAAGATAAGTT
GGGAAGAAGGTTACAGTGGGACCTAAGGGCCTTGGAGTTTGGGTTTTATCCTCTGAGGCA
GTGTTGTGGATTGAACTGTGTCCTCTGAGAGTATCTGTTGTGAATCCTAACCCTAATCTG
TGGCTGTCATCCCACTTGGGTAGGGGTTTAGCCAGTCATCACCTATGAGATGTAAAAAGA
GCAGATTAGGACAGAAAAGCAAGTAGAGATGGGGGAAGATAGATGCCATGCCACATGGAG
ATCACCACGGAGCCAAGGAAGAGAGACAATGACCTTCCCTGGGAGCTGACAGAGAAAGCC
TTTCCGTAGAGCACCCTGAATTCAGACTTCTAGCCTCCAAAATGTGAGAAAATAGGTTTC
TGTTTGTTAAAGCCACCCTCTTGTGGCACTTCTGTTAATAGCAGCACTGGGTAGCTAAGA
CAGGCAGTAGGAACCAGTGAAAAGTTTTGAGAAGGGGAGAAATGAGCATAGTGAAGAGAG
GCCAGGGAAGGGGGAGGCCAGGGAGGAGGCTGCAGTTGCCCATGCAGAGTTGATTAGGGT
CTGAGCTAACCCAGCCCTGCCCCCGTGAGTGTCCTTAGTGCAGTGTCTGTGTGGATGCTA
AGAGCAGCACTGACTGGGTTGAGATGTACTGCACTCCTCTCAGGGATGTCATCCCAGGGT
TTTAGACGGAATAATTTGGATGTGTTGCTTGGGGTATAAGAGTGAGGCCCCATAAGCACT
TGTATATTTAAGAAACTATTTAGAGAATAAATTACTGAAAAATAGGGAAGTTGGGGAGGG
AAGTAGTTTTGGGGAACGTGTCTCATCTTGCTTAGATTTGTCAAGGTGACAGAGGGATAT
TAACCCGAAAATGCAACTGGAATGTGCCAGTGGCATCTGTGGGAGGGGCGGCTCAGGTGG
CTTCCACACAGGCGAAGGCTAAAAGCAGCCTGCTCTTTATAAACAGGCTTTCAGAGGGGA
CCCTCCCTTGAAGATTTCCAGTGACCCCATAGATAACAACCCCCAAGGCAGGTTTTCAGA
CCTTGGCCCCTTAACAATTCTGCTGCATTTTATGTGCGTAATTGTCTGAATGTGGTTCTG
CCCATATTTTAGGACAGTTTAGCAGGATGTTTCAAATGGTTATCCCCCGTACCCAGTAAA
TCTGTTTTTAAAATGATCAGAGGTATAGTAAGGACTTTTTTAAAATAGTGCTATAATGGA
TATCTCTTATGTAGCAGAGAAATGTGCTATAATAGGAGATGAGTTAAATCAATTTAATGG
AATACTGTGCAACCATAAATATGTTTTCATAGAACATTTAAACATGTGGAAATGCGTGTA
ACATGAAGTGGAAAAATCAGGTTGCAACACAGCATGTACAGGTTGCAACACAGATTTGCT
TTTAAAATGGTGCATTTATTCAAACTCCGAATGTTAAATCATAAATGCCAGGGATCTGTT
AAAATAAAGGCAGGTAGTGTCTAAAAAAAAATAATAAAACTGCATTTACATGCAAAATAT
TGATGGTTGTTATTTTCGAGTATTGTGTTGGGCTTCAAGATTTAATTTCTTCCTTAAAAT
TTTCAAACTTCTTACTATAGGTTCATATTACTGTTAGAATCAGAGAAGGAGAAAACAAAC
GAAACAAAGAACCAAAAAAACAAAATGAAGAAATAGTTTACTCCTGTGACCTCTACTCTT
CCTGGGTTCCCTTCACTCCGCATCTTCTTGCTGACTCCTTTTTCTCCTTTCACTCTGCCT
CTCCTTGGCTGACTCCTTTTTCTCTAGATTCCTGACAAAACTGAGACCCAAGTTCATGTA
AGACTCATGACTGAGGCCATGGTGTTTCAGGTAAAGAATTATGGACCTGTAACTCAGCCC
TGGTGGCACAATGGTTAAGCACTTGGCTGCTAACTAAAAGGTCAGTGATTCAAACCCACC
AGCCGCTGTGTGTGGGAGAAAGGTGTGTCACTTTGCTCCTGTAAAGATTACAGCCTTGGA
AACCCTATGGAAACCCTTGGAAACCCTGTAGGTTTCCTGTGAGCTGGAATCTACTCTACA
GCCACTATTTTTTTTTAACTCAGTTCATATGAAAATCACTTCATTGGATATTCTAAGTTG
TAGAAGACATCAGGGATTAATAAACAACAGTCATTTTCAATTCAAATACACTTCTCCCTG
GGGAACACAGCACAGAAGAGAATAAGGTAGAGCCCCTTCCTGGCAGGTGAGCCCCTCTGC
CTGCCTATCTCCTGGTCACCGAGGTGAGCCCTCTGGGTTTTTCGTTGTCACCTGCTCTGT
CTGCAGAAAGGAGCCCTGGTGGTGCAACGGTTAAGAGCATAGCTGCTAACCTAATGGCTA
GTGGTAGGAACCCACCCAGCTGCTCTGCCCGAGAAAGACCTGACAGTCTGCTTCTGTAAA
GGTTACAGCCCAGAAAGCTCTATGGGGCCATTTTCCTCTGTCACATGGGGTCTCCATGAG
TCAAAACCGACTCAATAGCACCACCAACAACTATCTGCAGTCGTCGCTGCTCCTTCACAG
CCGGTCCCAGGAGCTGTGGAGATGCCTGTTAAGCACAGCAGTTGGCAACAACATTATTAA
GCTCTGGAAAGATTGTGACATAAGCCACGTATCCCTGAAAGCAGATGTTCCCAGGCTTCT
AAAGGAAATCACACTACCCTTTCTTTGTAGAAGATGAAGAAACTGAATCTCCAAGGGCCC
TGGCTGAGACCCTGAAGGAGTTCCAGCCATTTACAGTTATTCCCAGCAGCTTGTTTCCTG
CAACTTTTGAAGAAAACAAATTGTTTTTGTTGACTCATGAGCGACTGTTTTGAAAGGAGG
AAGAGGCTTTTTACTGACCACTTGTTTTCTGGACTCTGGGACAACAAGTCGAGTAAACCA
CCTACTCTGCCTTCAGATAGCTCCCAGTCAGGTTGGGGACTGAAGGAGTAAAGGAATGCG
TTATACAGCATTACAGAGATAGACATGAGCCTAGGAGATGTGCTGGGGGAGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATAGTCATTATTCAAACACAAGAATGTT
TTCGTGGCCTAACTTTCCCTCATGCAAAAACTATATATAAAAGGGGAATAAACACAACTG
TTCACATTAATATAAAAGCGATTCTTAGTTTTAATTACATAAGAAATACATAGTCATAAA
ACATAGCAATACGAAGTCCATGGAGTACACAGAACAAGACGTCAGTTCATTTTTACTACC
CTCCTACCTCCAGAATTCCATTCTGTTCCTTTCCCGGAAGCTCATGACATGACTGGATTT
ACCTCTCTAGATTTTGTGTGTGCCTGTGTATCTGTCTCTCTGTATCTATCTGTCTGTCTG
TCTATCCTTGTTTTGTTGTACTTGGGGTCGCCGTGAGTCAGAGCCAGCTCTGTGGGAACT
AACAACACCAACGTGTCCACGCATACAGGCTTCCCAGTACAGATAATGGGTCGTCGTGGT
GGAACCCAGTTTTCTCACGGTCCTTTCCTGTGGCACTTCATTGACATCATTAATCTATCA
TAAATTTAGTCAATGAAGGAACTCTATGTTTTATCAAAACTCCATGTTGCTACTGTACAT
TTGCATGTGAATACAGCTCCTCCCTCTCAGTGGACACAGCTCAGTCCACTGGGCAGCCTT
GTTACTGCGAGAACTTCAGGAGCTTTATGCACACTCTGCCCAGCTCATCCCCAAATGAGG
CAGAATCTCACAGCCTCATTGTTTCTGGCTCTTGACCTGGCCCCTGTAACCCGCCTTGCT
CATTTGTTAATCTAGTTTGAAGGTTTTTATTTCTCGGACCACTTTTGCCCTTCAGAAGTT
TGTGACAGTGAATTGTACATGTAGAAATTATTGAGATGGTGTGTATTCTGTTATGTATAT
TTTCACACACACACACCCCCGCCCAAAACAAAACCCAAAGTTTGTGCCGGTCAGCTAGCT
GGTGTGGTTTTTAACCTCGCTCACAGCAGACACTGCACAGAGGGCTGCGTGGTTGGCCCA
AGGCCTTGGGAACTACCTGAGCAGACGAGCAGAACCTTGGAGAGAGTCTTAGAATAGTGC
AGTTATGTTAGAGTCCAGAAGGAATTATTTCACCAACATGCAAGTTAAGAGCCAGAGCCA
GTGTCCTGTCTGGTCCCGGAGGCTTTGGGATCTGGCTACACTCAGGTTCACTTCAGAGCA
GAACGCTGATAAACCTCTCAGCTGGAAGGTGTGCCCATCATCTCTGCCTCCTTCAGCCAG
GCTTCCTGGTACTGACCTCCCTGCCTGGGGAAGGGGCTAACGCTTTTCCTTGAAAAAGGT
TTCCTTAAACTGGAGCTCCAGCAGCTTCTTAAAAGGCACATCTGATTCCATTCATCCCTG
CTGAATTCCTTCAGTGGTTTCACTTCACCTTTGGATAAAATCCACACTCTTTAGCGAGGT
TCTTGCTCACTTTTCCAGCCCACCTTCTCACACCTCACGTGCTGTGCTTCTACCAAACCA
AACCAGCTTGCAGCTCTCTGAGTTGCCTGTATTTCTTAGCTGCCCCTGGCACTTTGCGTG
GGCCTCCTTTTGCCTACTCATCCACCTCCAGGTCTTTCCCTCCCTGGGCACCTGATCCAG
GTTTCTCTCCAGTTTCTCGTATAGTTCTTCTCATTGACTCCAGCCCCTTGAGGTTCTCGG
ATTCTTGACTAAATGGTCTGCATACCTCCTGTTCACCTGTCAGTTTAGGGCCATGGATTT
CGGGGGGAAGATCATGTTTTGAGCTGTTTTTTAAAGTTTGTTGTATCCTTCCCTAACCCT
GGGAACTGTAATCATTGAGCTTTAATGTAGATTTAAATTGTTTATATGTTTTATCATATA
GGCTTCTCTTTGATTTTATGTTTTATTACCTCAGTCTCTGTTCTTCATAGCCTAGCAGTC
CTGTTAGTTTCACTTTGAGAAGCACTCGGGATTCTTTTTAAGAGTAACGCTTTATTTATG
CTTCAGTACTGAATACTCGTTTTTAACTGACTTCTGAATTTTTAATTTCTGTGATTTTTA
TAAACAGTCACCCAGTAAGCATAAGAAAATTAAATACTGGGTGGTACACTTGCTCAGTAT
TTATTGCTCCTCCTGCTTTATTCATAGAATGGAATGTGCTTTTCTGCTTCTTAGTTGCCA
GTTTCTCAATTTAGAATAAATTAGTTGGAGAGAAGAAAACTTCGCACATGCAGAGCAGAA
CGAGCGTTTGGTAATCTCTGACCCAGATGGTTATGTTTTTTTCATTCAGTAGGTATTTAT
CAATCGCCTGCTCTGTGTCGGGGAGTAATAGGTGTCTGAGATATCTTAGTGGACCAAACC
AATTGTAATAAATGTTAGTTTAGGGAGCTTACATTCTAGCAGAAGTAAATAGAAAATAAA
CAATAAACGTAACACATAAGTAAATTCTATAGTATATTAAAACAAAAACTAAACCTGTTG
CCGTCAAGTCAATTCCATCTCATAGTGACCCTATGAAACAGAGTAGAACTGCCCCGTAAG
ATTTCCAAGGAGCAGCTGGTGGGTTCGAACTGCCAAACTTTCCGTTAGCAGCCGAGCTTT
TTAACCGCTGCACTACCAGGGCTCCACAGTATATTAGAAAGTTATATATTCTGTGGGGAA
AAAAAGCACTAGTAAGAGAGATTGGACATGTGTATGGGAGGGGAGTGAGACTGGAGCCAG
GCTGTAATTTTAAATAGAAAGTCAGGATAGACCTCATTGAAAGATAACATTGAAGCAAAA
CTTGAAGGTGGTGGGGGTGTACCCACGTGGATAGGGGGGCAAGAGCATTCCTATAGACAC
AGCCTGCTTATGCAAGGCAGGCAGAAGCCCAGGAGGATGGAGTGGAGGAGCCAAGGGGGG
AGGAGCAGGAGGTGGTTCAGAGAGGAAAAGGGCGGTCTGTACGCCATTGTGAGGACTCAG
GTTTTTATTTAGAGTGAAGTTGATGTTGGTAGTTGCCCCCAAGTTGATTCCAGCTCACAG
CGGTTTTCAAGGTGTGACCTTTTGGAAGCAGATCACCAGGCCTGTCTTCCGAGGTGCCTC
TGGGTGAGTTGGAACCACCAAACTTTCAGCTAGTAGTTGAGCACTTAACAGTTTGTGCCA
CCCAGGGTTCCTAGGGTGAAATTAGAGGGTTTTAAACAGGAATATTTCTTTAAAACTTCA
TCTATTGTATCTTGAGGTATTTACCTTTTATTTGATATTTATTGGTTTTGGCTTTAACCC
AAAAAACCAAACCATACTCGTTGCCATCAAGTTGATCCTGGTTCACAGTGACCTTATAGG
GCAGAGTAGAACTGCCCATAAAGTTTCCAAGGATTTGAACTGCTGACCTTTTGGTTAGCA
GCTGAGCTCTTTTTTTAAAAAATTTTTATTGTGCTTTAAGTGAAAGTTTACAAATCAAGC
CAGCCTCTCATACAAAAATTTATATACACCTTGCTATATACTCTTAATTGCTCTCCCCCT
AATGAGACAGCCCACTCCTTCCCACCACTCTCTTTTCACGTCCATTCCGCCAGCTTCTAA
TCCCCTCTGCCTTCTCATCTCCCCTCCAGATAGGAGATACCAGCATAGTCTCAAGTGTCT
ACTTGATCCAAGAAGCCCATTCTTCACCAGCATCTTTTTCTATTCCATTGTCCAGTTCAA
TCCCTGTCTGAAGAGTTGGCTTTGGGAATGGCTCCTGTCTTGGGCTAACAGAAGGTCTGG
GGACCATGACCACCAGGATCCTTCTAGTCTCAGTCAGACCATTAAGTCTGATCTTTTTCC
AAGAGTTTGAGGTCTGCATCCCACTGCTCTTCTGCTCCCTCAAGGGTTCTCTGTTGTGTT
CCCTGTCAGGGCAATCATTGGTTGTAGCCAGGTACCATCCATTTCTTCTGGTCTCAGGCT
GATGAACTCTCTGGTTTATGTGGCACCTTCTGTCTTTTGGGCTCATAATCACCTTGTGTC
CTTGGTGCTTTTCATGCACCTTTGGTCCAGGTGCGTTGAGACCAATTGATGCATCTTAGA
TGGCCTAGCAGCTAAGCCCTTAACCACTGTGCCATGTAGATGATGCTGGTCTTTAAGCCA
GTTGGCCCCACACATATTTGCCATTGAGGCTACTTCTAAGGCAGGGGTAATGCAGGTGTT
TAATGTGTTGGCACAGGGTACGTCTCCCCCGCTTGAGGATGTCTCCATGAAGGAAGAGAA
TCTGTGCCAAGCTTTCTCTGACGCCTTGCTCTGCAAGATCGAAGACATCGACAATGAAGA
TGGGGAGAACCCTCAGCTCTGCAGTGACTACGTTAAGGACATCTATCAGTATCTAAGGCA
GCTTGAGGTGAGCGGGTCTGTGTTTTGGTTGCACCAGCAGCGTGGAGTTTACCACACGGT
TGGAAAGAGAATGAGCTCAGCTTTTAAAATTTTTAACTCCACTGACAGGTTCTGCAGTCC
ATAAGCCCACGTTTTTTAGATGGAAGTGACATCAACGGACGCATGCGCGCCATTCTGGTG
GACTGGCTGGTGCAAGTCCACTCCAAGTTCAGGCTTCTGCAGGAGACGCTGTACATGTGC
ATTGCCATTATGGACCGCTTTTTACAGGTAGGCGGGGCCGGAGAAGCTTCACGCCAGCAG
CTCAGCAAACACTGCACTTATGCTTTGGGGATAGAAAGCTAAGGTGAGGTACATCTGAAG
GAAAGACCCAAAGCCGCTTTATGAGAAGCCCAAGATCTTCAGGTGCTAAAAAGGGAAGTC
GTGGAAGAGTGACAAGCCTTGCCTTTGGTGAGGCTGACCAATGCTGGATATTTTTGTTAC
TGCAACCTGCTAAAAAAAAGCTGGAGGGGAAATACTGCGTCACCACAGTCATTCATCAGA
CAAAGGCAACATACCATCAAATGGGCTGAAAGTCCTTCGGACCCTGCTTTTCCAGGACTG
CTTGCAGTTTCCAGAGTTTGGTACTCTTTAGGGTTAAGTTTTCTCACCTGGAAAGGAGTA
TGGCTAGATAACCTCAGAGGTTCCAGCCAGCTCTGGTATTGGATAGCTATAGCAGTGAGA
AGGAGGAGGCAGAATTAAATAAGAGAGAGAGAGAGAGTGAGTGTGTGTGTGTGTGTGTGT
GCGGTCGGCTGAGAATGTGAGGCATAAAGGAAAGAAGAATGTGAGAAAATAAACTGAGAG
GCAGAAGTGGTCTTTAAAATATTCATCAGCTGCTAAGATGTGAACCACTGGTGTGTGACC
CCATAAATGACAGCCCTGCTGATGAGGACTTATTTGTTTTAGATCAACATTCGTGATGTG
GGTTCAGGTAAAGCACAGGTTCTGCCCAAACAGTATAGTAATATCGTAATTATGTTTATA
ATAATGACCTTGAGGGATGGCAAAACCCCAAATAATCATATAAGTTCAGTGGTTTTCACT
GCCTCCTCGTTGGGCAGCATAGCACGGTAATATTTTAGGTGGGTTTTCAGTAATGAGAGT
TGAGGCAAGAAGAGCAAAGCCTTAGCTAAAGGAAATTAAGGGAAACGTGTCTTCCCTAGT
TGGAGAGGTATACCCTGACTCCGAAGCATTATTGGAAGATTCTTCACGCTGAATGAATGT
ACTTTTGGTGCGGATTAAGGAAAACTTTAAGCCACCCCCTTCTCTGCCCCTAAAAAAAAA
GCCCCTGGGCATCCATTAAATTTCTGCTATTTTGTTTGGCCTCGTTTCTGTTCAGACCAC
CTTGAATACCAATTCAGGGCTGCCACAGACACATCAGGGTGATGGGGGCAGGGCAGTGAC
TGGGAGCTTGGTTGTCAGGCTTGGGTTCATGCCTCATCTTCATTACGCAATAACTGAGTG
ATCGTGGCTGGCTTCTGAATCTCTTGTTAGGCCACCTTTTTGTAAATGGGAATAAAGATA
TGTACTTCCTAGGGTTTTTGTGAGAATTTGATGGGCTAATGTGTTAGTCTTAGCACTGTG
CCTGGCACATAGTACTTAGTGAAGGACACTTGCCCTGGCAGCTGGTGGCACTCCCTATTC
AGGTCTCCTACCCTGAAGACAGGCATGAGCAGACGATATGCAGTTCTCAAAGGCTTGGTT
CCTTCTCATCGCGCTGCATCCAAAGAAGCACCCCTCTTTTTAGGTGTGACTTCTGACATA
TTTTTGCTTCCATTAGATTCATCCTGTCTCTCGTAAGAAGCTTCAGCTGGTTGGGATTAC
AGCTCTGCTCTTGGCTTCCAAGTATGAGGAGATGTTTTCTCCAAACATTGAAGACTTCGT
TTATATCACAGACAATGCTTATACCAGCTCCCAAATCCGAGAAATGGAAACTCTGATTTT
GAAAGACTTGAAATTTGAGTTGGGTCGACCCTTGCCCCTACACTTCTTAAGGCGGGCATC
GAAAGCTGGGGAGGTAAGTGCTTCCAACTTTGTGGGAAACTTTATTTTGCTGTTTGATGT
CTCGTCCCAGAAGCATCGACTTACATGCACTTAATTGAACGGAAGCTTATGAACTTGCAG
GAAGCATCCCGTAGACAAGTCCTAATGCTTGCCTCATCACGTCTTAGGAGAAAAGACCTC
ACGCTCTGTGTCTGTGATATACTGCGCAGTAGAGCTGTGCTTGTGAGGAATGAGGAGGTT
AACTGGATCTGAGTTCCTAGACCGCCACCCAGAATTTTGCAAGACGGTAGTAACAGTTGT
GATTCTTACAGTCCCTGGCTGTTCTTTCATAGGTTGATGTTGAACAGCACACTTTAGCCA
AGTATTTGATGGAGCTGACTCTCATTGACTACGACATGGTGCATTACCACCCTTCTAAGG
TAGCAGCGGCCGCTTCCTGCTTGTCTCAGAAGGTTCTAGACCAAGGAAAATGGGTGAGTG
GTGGATTTAAGAAGAAATTAAGTTATAGTTTAGGTCCTCTTGATATGAAAGGACTTAGCA
TTTCCACAATGCTATCCTTGAAGCACTTGTCCAAAGTGCTGAAAGAAAGCTGCTTGGAAG
AATCCAGATGTCTTTCCACATGAGACTCATCGAGTGCACCACGGCACCCAAACATAGTAT
GAAAAAACCAAACCAAACCCATTGCCGTTGAGTTGATTCCGACTCGTAGTGACCCAATAG
GACGAGAGTAGAACTGCCCCATAGGGTTTCCAAGGAGTGCCTGGTGGACTTGAACTGCTG
ACCTCTTGGTTAGTAGCTGTAGCTCTTAACCACTATGTCACCAGGGTTTCCAAATGTAGT
GTAGAGCTGTAAAAAGAATGAGGAAGGCCACTAAGAACTGAAATGGTGTGATTTCTGGTA
TATTCTGTTAAACGAAACAAGTCATGAAGCACACAAGACAAGGCACGGCTGAGGCTTGAC
TTACTCGGCCGGTAAAGATGCAGTGAACCACCGGTAGAGCAGATAAAGTGCCTGCTCCCT
GGCCCTTGTCTCATACCAGAGACCATACCGAAAAAAGGGGGGACCTGATGTTGTGGGATG
TTTTCTTGCTGAGGAGCCAAATCAAGACTGGAGCCAATTCAAGACTGCAGCCAAGGGGTT
TTATATTCTGCAGTTCTGAGAGTGGCAGGGCTCTCTTCTATGAGTAACTGCCTCATGACA
CCTCCCAGGAGACTTCGGAAGGAGAGTGGGAGGTAGTTCAAGACAGCTTCTCCAGGCCTG
CTGTCCTCTCCTAGTTCAGGAGGATCACAGAGCGTTTTGCCAGGACAGGTTAACTGTGCT
TCAAGTCTGTGCCCGTGTGCCTGCACCGCCTGTGTAGATACATGCAAGGTTACCAGGGGC
CACAGTGGGACTGGTTTCCTGCACAAGTGCCCATGTGTCCACACAGCCTGAGTAGATACA
TCCAAGGTTGCCAGGGGCCACGGTGGTACTGGCTTCCTGCACAGGTGTACACAGGATTTG
CATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCAGTGTCTTATAACCACCAGCTCTGTCGTTTCCCCAAAACGTTTTCATCACCTCA
GAATGAAGCAGATTCTCCCCGTTCCACCCTCCCTGCCCCTGGCAACCACCAGCCTGCTTT
GTGTCCATCTTTCTGGGTTTTCCTGTGCCGGATATTTTATACAAGTGGAATCATGCCGTG
TGTTGTGGCCTTTTGTACATTGGCCTTTTGTACGACTTTTGGTTTGAGTGCCTGTTTTCA
AATGGGCTTTGAACACAGCATTCTGACTGTGCATTCCTAGAGAGATACAAAGTTAGACGA
AACAAAGGAACAAAAAAGGTACAGGCACTTGAAGTTTACTTAGTAGGTCTATTGTTAATA
GTAATACGGCATTGCAATTCTAAAATTCTTTTATGTCTATTGTAGGATAAAGCAAATAAA
TGTATTCCAGTTATTAAAGATTAAAATTTTCACTATGAGATAAAATATTTAAAAAAAAAT
TGAAAAACAAAAGGAAGAACCCTTATAATAAGTATCATTTGGAACAGTCAGTAAACTCAC
AAGAAAGAGTCTAGAAGCAATGACAACCCAGTAACAGTGAACATACCCGGTGTCCAGATC
TTGGGTACCAAGCCCTGTTACCCACAAGGAACCAGGGCTTCTTAGAGAAGTGGCTGGTTC
CAGAACAGCTTGTGCCAGAAAGCAAGAGCTTCTCAAAGACTAATGGGGTCATGCAAAAGG
ACATGGGAAATGGCTTGAAGAGGCTCTTGCCAGCCACATTTGGTTTAATTTGAGCATCAA
AAAGAAAAATGACAACATTTAAAAAAATGAAAGAAGAAAGAAAAAAAAAAATCCAAGTCT
TTAATGAATAAACAGGGAGGCTTTTTTTTGTTTTGTTTTAAGTAGAATGCCTGCAAATTA
ACGTACAGGCAGTCCCTGGGTCACAAACGGAAGGCTGACTTACGTGGCACCATACTTACG
AACCAGCCCTGTAGAGCCTTTTATATTCAAGATTCAAGGTACATACAGTGGTTCGTAATA
ACAAACAGGTGCTACTTTGTGACATGCATCAAAACATTAAACATTATTATTATTATACTA
AACATATTTTAGTGTATTGGCAAGTGTTTCATGTTTTTTATGCATAAAAAGGTACACTAT
ATACTAAAGACAAACATTTGACTAACTGACGTTAGATACGAACTGTATCTAACTGTTCTG
ACGTACATACAAATTGGACTTAAAGACAGATTTAGAACAGAACTCCTTTGTAATCTGGGG
ACTGCCTGTAAAAAGAACGATAGTTAGAAACTCATTGTTTTTGAACCTCCAATATAATAA
TTGATTGAAGCAAGGATCGTTAATGGATGCCGAAATCATTAGGTGAAATAATTCTGGGAA
ACAAGATTCCAATGGTCTCAAAATATCACCCCACAAATACATACTAATTCCAGAGACAAC
CGTACCTTTAAAGTGGAGAACTCTGGCAGTTACGTCCTTAAGCTCGCGGTTGAGGTGGGC
ATCACCAGTAGTGAGATCACGGACTTGATGTGCCTGCCTTCTGATGCAGTAAGGAGTATG
CATTACTCCCCGTGTAGCGGGTGTACTCAGAGCAGGGGGCCTCAAGAGTGGCTTCTCTGT
TTATAACACACCCAAGAGGAATCTGGGCTCATTGTGACAAAGGGCACACAGCTCATGGCC
TTCCTATGAACAACGCCCACACAGGTCTTCCTGCACCTCCAGGTTGCTGCTGGGTAGGGC
CAGTAGGAGAGGACTCACTATTGGAGGAAAAACTGCAGCATTCAGTTGGAGAGGTTGCCA
GTCCATGCATGAGCCATGGGTGAACCTCTCTTTTCAAGGGAAAAAAAATGATTGAAATGA
GGAAACAACCAGACAAAGCCAAAGTACGGGACATTCTAAACATCACTGGCCTGGATGCTT
CAAAAAAGTCAGTGTCAGGAACTGAAAAAGCGGAGGTGGTTTTAAGAGACTAAGGACACA
ACAACCAGAAGTACTGCGTGTACCTTGAGTTTATCCTGGATCTAAAAAAAATTTCCCAAA
AACCATTTCTGGAGTAATTGAGGAAATTTGAATATGGATCATATACTAGATGATACAGAA
TCATCAACAGTTTTCTTCTGTGACAATGGTATTGTGGATAGGTAGGAAAATGCTTACTGA
AACACTGAGGAGTGACATGTTATTTTCAAACATTTCGGCAAGAAGTGTGCACGTATGTAT
ACATGGAGCGGAGATAGAAAATAGCGAACCGTTAATAATTGTAAAACAATTTGGCAGTTC
CTCAAAAAGTTAAACAGAATTACTATATGACCCAGCAATTCCGCTCCTAGGTATATGCCC
AAAAGGCTTGAAAGCAGGGACGTCGGCAGACACTTGGGCACCAATGTTCACAGCAGCTTT
ATTCACAATGGCCCAAAGGTGGGAACACCCCAAATGCCCATCAATAGCTGAGAGTGGATA
AACAAAATGTATATACATCCCATGGAATACCACTCAGTCGTAAATAGACATGAAGTTCTC
ATACGTGCTATGACATGGACAAACCATGAAAATATGCAGAGTGAGAAAAGCCAGACCCAA
GAAGACAAGTATTGTGTGATCCCACTTATATGAAATGTCTAAAACAGCAGATACATAGAC
TAAAGTGTATTAGTGGTTTCCAGGGTCGGCGAGACTGGTAAATGGGGAAGTACTTGTTTC
TGCTAAGGATGATGGGAAAATTTGGAAATGGATCGTGTTGACGGTTTTACAGCACAGTGA
AGTAACAGATGCCACTGAAGTGGACACATAAAAATGGCGGAAATGGCAGATGCTTTGCTA
TATGTATCCTATCGCAATAAAATAAAAATTTTTAAAATACTGACTGATGGGATATACAGA
TATTCATTCTGTGTTCTTTATCTTATTCTTTAAATTTTTCTGTATTTGAAAATTTTAAAA
ATAGTAAGTTTGAGGCAGAAAAGCCACTAGTGGTCCACGGCCCTGGGGCTGATGGCTCAC
TTTCGCCATGTTACTCCTCAGCCCACTGCTTGGGCTATTGAACCGGTTAACAAGAGGCTT
CCCGGCTTTCTGGGAGCTGATTCCAGAATACCAGTGGTTGTGTGTTATTCCTTTTTTTCT
TTCAAATTATTTTAGAATTAAAATAAATTGAGATTTATTTTCCCGTTCAATTACAAGAAG
TTTGTACCGTACATACAAAAGGAATATGTTTTAGCTTTGAAATTGTACCACGTAACTCTT
AAATAAAGCCAGGTTATGTATCTTGATATGTGGTAAGTCTTATCAGTCAACAGTGGTCCT
TTTGCTGGAATTTCCTTCTTTGGGGAGGGCAGGTCACAAGGCTGGGCGGAGTGGCTTCTC
TGGGTTCTCCCTGTTCTTTGGTGCCTGACTATGCAAGGTGGTCATGGTCTGCACGTGGAA
GATTGCTCCTGTGGTGCAGTTTGGTTCTGCATCCTGAGCCTCTCCCCTGACCAGCAGTGG
GAAGTCTGGGGCTGGACCTCCCTGACAGCGCTGCTGGGCAGGACCCTGACGGAGGGACAC
GAGGGATGGGCTGGTCCCAGGCCTTTGCCAGCACGGAACAGGCGGCGTTTTGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
CATGCACCCAGCAACACATTCTGTGCACCTCTCTCTTTTTTTTTTTTATTAAAAAAAAGC
CTTGACGCTTGACTTAGCCAGGAGCCTCATAGTGTCTTAGTTTATCCCTGTCTCAGCGCC
AGAACAGACCTGGCTGTGTTAGCTTTGCTGGCACCACGGTGGCGGCTAAAGTTGTGTTTG
AATTCCAGGAGGTGAGAATACTCCTTTACAACTTCTGCGTAAGTAACGTCTGCGTGTGCA
GAGTGTCCTCCAACCACGTCATCTTCTCTTTGCTTGTGTCCCAGAGTTTAAAGCAGGAAT
ATTACACCGGCTACACGGAGAAGGAGGTGCTGGAGGTCATGCAGCACATGGCCAAAAACG
TGGTGAAAGTAAATGAGAACTTAACGAAGTTCATCGTAAGTACTGCTCTCTCTCCAGCTG
TGGAAAGCACTGGACCGTGGGCTGTGCGTGTGTGTTTTCCTGCAAATACATTATGGCTTA
TGTGGGAGCCTCTTTTAGTACAGGTTGTTTATATCTTCCTAATACAGCAGGGGATGGAGC
ATACTGGCCAGCCCAGATTCCTTTGAAACAGAGTCGGTGGGCTGATGGTGTCATCAGCCG
GTCAGCCATTCTCTGTATATGCCGCGTTCTCATACCAGCTTCCTGGGCGACTGCTCCGCA
AGCAGGGAAGGCTGGTTGGCCTGCGATCGGATGGCTATGTGGAAGTCTTGGGTATAATGT
TGGGTTATATCACTCAGGGCTTCATCCAGGGTCTTTTGGGACAGAGCCTAAAAGCCACCT
GCCTAGTGAGCATGGTGAAGAGAGGGGTGGGGGAGGCCCTTTCAGGAAGCATCCTGGGCC
TGGTGTCTGTCTCTCTGTGACCTTCCTGAGGGAGGAGTCAGAGGAGACTTGGTTCTGTCC
TGTGCTTGTGTGGCACCAAATACAGGGCTTGGTGACAAAGAGCAGCATTTGTGCCACAGA
AGAGCCTTGAGTGCTGCCCGCCTGCACGTGTGACTTGCTTTCTTGTAGCGTGAGCATGGT
TTAGCACACTATGGTGTTAATATCACGTGCTCTCAGTGCTGAGGTGTTGTCTGCCATCTG
CTAGGCACTAGCTGCCACTCGCTTTTGTTGTCCATTGTTGCTGCCAGTCCCGGCCTGTTC
TGCCCTGAGGGCACTGTGGTAGGTTGCACACATCCCCCATCTCTGCTAGCTTATTATGAC
TGGAAGCCTCCTTGGACCTTGAAGTCATTGGCTCCCTCATCACCTGTGTTACCTCATGGG
CCTCATTCTTTAGCAGGTGTGACGGAAACAGGAGGAGCATGTTAGGGCTGTCTGGAGATA
TGGGTCTTGCCTAGATACTTGTCAGTTAGACTAGGAATGAGGGAGGTAGAAGCTGGGAGT
CCTGACGCCTGCTAACCGCCGACAACTTCCGCAGGCCATCAAGAATAAATACGCAAGCAG
CAAACTTCTGAAGATCAGTGCGATTCCTCAGCTGAACTCCACGGCTGTCAAAGACCTGGC
CTCACCACTGATGGGAAAGCCATAGGCTGCGGGGCTCAGGCTGGCAACTCTTCACTTTGT
ACATAGTCCTTGGGTCTGTTCCACGAAACCTTTCTGAGACCTACTTTCTAAATGTATATT
AAGGAAAAATAAAGCTATTGATTTTTCTTAAGGTATTCCGTGCGTTTTCATTTGTGCACT
CTCCATGAAGAAATCAGTGTCAGTTTGCTTTGACTAATTTTTTTTTTTTTTTTAGCTATC
GTGAATAGCACATACATTGTTGCCTTTGTGGCTTTAGGGAAGACCTCCCTACCATTTCTC
AAATGGAAAAACTAGAACTTGGCTTCCAAACCAAAAAAACCGCTGCCATCTAGCCTATTC
TGACTCATGGTGACCCTATAGGGCAGGGTAGAACTGCCCCATAGGGTTTCCGAGGAGCAC
CTGGTGGATTTGAACTGCCGACCTTTTGATTAGCAGCTAAGCTCTGAACCGCTGTGCCAC
CAGGGCTCCAAGAACTTGGCTTCAGTGAACACTAACTCATCCCTAGACTTCTTGAATGTA
AGAGGGTTGATTCATTACACAGTTGAAAATGGAAGGATAACCATTTCTCTTTCTTGAACT
TACTTGATTGCTCCCTAATTCTTACATAGGAACACCCAGCCCCTGGGGTGCTGGCTGCCA
GAGTAACCCTCATGATGGGTCTCTCAAAGGCACGGCTGAGATCAGGAATAGCTGTCCTGA
GGGGCCACTGCCGGAGGAACAGAATGAGCCTGTGACATCCATTAAAGCTCCTGTCATGCC
GTTTCAGCTACATTAACCAAACCCAGTGTGTCGAGTTGATTATGACTTATAGCGACCCTG
TAGGACAGAGTAGAACTGCCCCATAGGGTGTCCAAGGCTGCAAATCTTTAAGGAAGCCAA
CTGCTACATCTTTCTCCCGCAGAGCAGCTGATGAGTTTGAACTGCCGGCCTTCTGGTTAC
CAGATGAGCACTTTAACCAGTGCTCCACCAGGGCTCTTTCAGCTACATCGTGGGGCCCTT
CCTGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1024, 3385..3513, 3903..4016, 12376..12546, 12648..12806, 14356..14592, 14912..15052, 20564..20674, 21694..21804
1001..1024, 3385..3513, 3903..4016, 12376..12546, 12648..12806, 14356..14592, 14912..15052, 20564..20674, 21694..21801
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved