Loxodonta_africana Locus KIAA0907
snOPY snoRNA Orthological Gene Database
Loxodonta_africana KIAA0907
Loxodonta_africana
KIAA0907
GeneScaffold_3889
SNORA42
7244..7378
12514
GTCATTTTAGTAAGATTTTGTTTATTTCATTTATGAAGAATGACCAAGAGTTTTTCCAA
GTGTGTTTGCAGCCAGATGAAGGGAAAGGTAGGGAGGTGGTGGGACTTGGGAAGGGGTAG
TTGTAAACCGTACAACTAAAAGATTTTACTCCGTTTTGTAAACTTTAATTTCTTTCTCTT
TTTGTAGCTTCAGGCCCCTGGCAAAGGCCTGACTAGCAATAAGAGCAAGGATGACCTGGT
GGTAGCCGAAGTCGAAATCAATGATGTGCCTCTCACGTGTAGGAACTTGCTGACTCGAGG
ACAGACTCAAGATGAGGTGTGGAGGAGTTGGGCCTCTTGTTTGGGGAAGGTGGTGGGTGA
ATGTTGTTTCCGAAAAACAGGACCTCTAAACACAAACCAAAAAACCAAACCTGTTGCCAT
CAAGTTGATTCCAACTCATAGCGACCCTGTAGTACAGAGTAGAACTACCCCATAGAGTTT
CCAAGGAGTGGCTGGTGGATTCGAACTGCCAACCTTTTGGTTAGCAGCCGAGTTCTTAAC
CATTGTGCTGCCAGCGCTCTGCTAAAACAGGAGTCGAATATTTGTAAGTGGGTTTTGGTT
ATAGTCTCTGAAGTCAGGATTAGGTATAATTTAACTTTGGAGGAACTTCTTAATGAAGGT
AATGAAACAGATGAGTGAACTTCCTGGGTTGGTTTGAGTAAAAAAAAACAATGGAACTGC
AATTTCAAGTATTAGAGAGAACTGATTCCTATCTTAGTGGTGGAATGAATGAATGGGAAA
AGGCTATCCTGCCATCTGCCATTGGAATCCACCAATCACCACGTCATCTTTTTAATAGCA
CATTTCCCTCTTTAGATCAGCAGACTCAGTGGGGCTGCCGTATCAACTCGAGGGAGGTTC
ATGACAACTGAGGAGAAGGCCAAAGTGGGACCAGGGTGTGTATGCTTTTTTACTGGGGGA
AGAGTTGGGCGTACAAATAATATTAGCTTTGTATTTTTCATTCTTGGGGAATATATGTAA
ATATCTGGTTAGTAGTTTGATACATATGCACTAAAGGAGAATCTCGGGCATCTTGAGTAG
GTGTAAAAAGTGTTGGCTGCTATTTTTTTTCCTATGGCTTTTTGGTTTTTCATTTTATAA
CGTTTTTATTGGAGGGAATTTTAATTACAAGAAAGTGTAAAAGAAAGTCGTTATTAACGT
TTAATATGTATACTTCTAAACAATTTTTACTCCCCTATGGGAACATTTTCCCCTGTAGGA
GCTCATATTTTGTTGTAATCTCCTTTTAAAAAGGACTGCACGTCCTTCTATCAAATTCCT
GATTGCCTCGATGATGATTGTGGGTTGTAGGTTATGAATGTAAACATTTATTATCAGCTT
CATTGCTTCCATTATTTAATGTTTGAGCTTCTCTCCACTATAAGTTGACAGGTACTTGGG
GGCATGCAAGATTGTTAACATTGGCTTAAATTAAGTATAATTAGGGGGTAAAATTTGCTC
CTACTCTAAACCGAGGATGTACTTCAAAACCAAATATGAAAGTATTATCTGTGTGCTAGT
TGCTGTTTTGAATTTTGTCTTTCTTTAAACACATTTGTTTTTTTATCTACTGCTTTCTAC
TAACCGTACGGTTGTTGACCGCTTTCTTCACTGTTATAACCAGAATTTGAGCTACCTTTT
ACATTTAGAATCTAAAGAGTGTTTTTAGTTGGCGCGGGCCTTTAAAAATGTGCCTCGTTA
ATTTGGATGGCCACGAACACCTGTGCCTGTAACTGACTAGGCATCCAATAAAAGGAATTC
TGTTCTTGAGCATTGGATCATTTCACTTGATCAGATACTAATTAATGAGTCTGTAAGAAC
AGGTTTGATCCCCATCTGAGCAAGTTAACTTTAAACAACAAGAAAAATTTGTTCTACAGT
TGGAAAACCATGATCTCAGAAATTAACTACCGATACTCCTTTCCGTGTATACAGTGTCTT
TTTCTTACCTGGAAATTTTAAACATCACAGATCAGAGTTAGGAACTCTTTGACTCCTTCT
TTGGGTATGCAGTTTGATAATCGGTTTATATTTCTTCTTACAGGGATCGACCGTTGTATC
TTCATGTTCAGGGCCAGACCCGGGAATTAGTGGATAGTAAGTAATGTTTTTAGCTCATGT
ATCATTTTTTGTGAAGGTTGAAAATTCAGGGCTTTGCGTAACAAGTTGACAGACTCCCTG
ATGGCTGTTAAAAGTCCTGTTTTTGCAGTGCGCACAAATGTGTGCATGGGGGCTTGAAGA
GTAACTCATGAAATGGATTAATGCTTGAGTAATTTAGCATTGTCCTGTCTTTTATCTTTG
GGCACTGGTCAGTTCGTTTCATTCTTTGGTTATCTTACTATCTGTGTCTTTCCCTAGGAG
CTGTAAACCGAATCAAAGAAATTATCACCAATGGGGTGGTGAAGGCGGCCACAGGGACAA
GTCCAACTTTTAATGGTGCAACAGTCACTGTGTATCACCAGCCAGCACCCATCGCTCAGC
TGTCTCCAGCTGTTAGCCAGAAGCCTCCTTTCCAGTCAGGGGTATGTTTTGTGAAGGGAT
CATTAACAGCTGTATCATTTCTTGAAATTCTAATCTGAAAGTTACCCACTGTTAATATTC
AATTAATGGACGTTTAGGTTTTCATCCGAGCCACACCTTTTCATACTGTCGTATTTTAGA
AGGAAGATTGATAGGATCAAAGGGTATAAACACTGTACATTTTCATATTAGTGGTTTGAA
TTTGTATTTGTGAACTTACTGGCAGCTGGAGGACTAAGAAAAGCTGATTCTGATGAAGCA
AGACTTCTGCTGATACAATCCCTCCTTAGAAAAAAGGGGTTGGAGAGAGCAGCCCCTTAT
TGGAGAGTATCACAGGGGCTGACTGTACTGCCCCAACATTCCTGGTCCATTTTTTACAGG
AGGATTGGCCTTTGGCTATTAATTTTCTCTACTGACTAACGCTTTACTGGTCAGGTTGGG
GCGGAGGTAGAGTGCTTTAAATATTAGATCTTGGGGTTTTTCTCCTCTTCAGCATCTTTT
TTGCAGAGCAGACTGAGGTGTTTATGTTGTAAGAAGGGACATGGAATATGTAGTTCTCGT
TTAAATTAAGTTACTTGATAGAGTTTATTTTTATGTGCTCGTGGTAGAAATTATAGGGGT
CATTATTCTGGAAATGATTAAAGATATCTGGGGAATTACATAATTTCTACAAGATTAGGG
TTTATTTATATTCGCTATTTAATCTGAGGTACTCCTTTCTTCTTACAGATGCATTATGTT
CAAGATAAATTATTTGTGGGTCTAGAACATGCTGTGCCCACTTTTAATGTCAAGGAGAAG
GTGGAAGGTCCAGGCTGCTCGTATTTGCAGCACATTCAGATTGAAACAGGTGCCAAAGTC
TTCCTACGGGGCAAAGGTTCAGGCTGCATAGAGCCAGCATCTGGCCGAGAAGCTTTTGAA
CCTATGTATATTTACATCAGGTATGGATGGACGGGACAGAGAATGTTTTAATCCTTTTTA
GCTGATTATTGGTGCAGGTGGAAATGATTCAGAGGGACCAAGAGAAAATGGGCTTAATTA
GCAGTAATGTGAGGGATTTAGGTTAAACACTAGGAGTACTCACTTGATCATTAGTTAATA
AAACTGTTGAATTTGGAGGGGGAACTGTGTCTGAAAGCCCTTACATGCTTATCTAACAGA
GAATGATTTCAGTATTCAAGGGCCTTGGGTTTCACACAAATCTTTGATCCTAAAATAAAT
GGTGCTGAGCTTAAAATAAGTTTCATTTAAACCTATGACAATTTAAATACGTTTTATAGT
AATTTTAATATCCCTTTATATCAAGAAATACCGTTACTCAGAGAAAGAGGCCAGTAAAAT
GCTTGTGGTAATGAAACTAGTTACATCTAAAAGGGCTTCTGTGGCACTATTTTTTGATTT
TCAGAGGCTTAGATTTGAGCTACAGTGAATATATTGAAGTAATCATAAAATTAGCGTGAA
AGGGAAGGCTGAATTCTGTCTTTTATTTTTCTTCCCTTTGAATTCTTGGTTATTTCTTTG
TAGCCACCCCAAACCAGAAGGCCTAGCTGCTGCCAAGAAGCTCTGTGAGAATCTCTTGCA
AACAGTGAGTTACGTTTGTGTCTTTCAGAAGAGTTACTGCCATTTGGGGGTATGTCTTAG
CTATTTTTTTCATCCTAGTAACTAACATCCTCTATAAAGAAGTCAGGCTCACCTAGTTGG
GGTTACAGTTGCATACATTTCTTATTCAAGAGCGATTGCAGTGTGGAATTTTGAAGCCTG
CGGTATATCGGTATCAGAGAATCTCAGTGTTGTCAGTTATGTAACTATTTCAATCCTGGT
CAGTTTGTGATGAGCATTCTAAATTCTTGCTAAGATTAGCTTTAGCTAAAGGGTAGAGCA
ACAGTAGTTTAAAAGCAATTAGCAGTGCCTTTGGGATAATTGCTGATTTGATTATCCATC
CTTTTTATTCTATAAGTAAATAACAAAAAGTTAAACTGTGTGGCTATTTCTGTAGCATCT
AAAGGAAGTCAGGCTTCAGGGTCGAATATGTTCAACCTTGTATTTGGATTAAGGATACCC
CATTGGGAGGTTGCTTTCTTCTAAGCAGATAACCTGTTGGCCAGTCCTTGTACCGGATAA
CTTCCCTAGCCAATCCCTGTTTTTTTCTTTGCTGCTCCTTGAAGTTATGGGCTTAATAGG
ATGCTTACAATGAAGAACGGAAGGGAAAAAAGAAAATATAAGAATCATATCTTACTTATC
TTCAAATTTTTAGCATCTAACATAGTACCTTGCAAACAGTGGTCACCTGTTAAATGTTGA
ATAAATAAATTAACGAACTCTTACAATTATAGTAAAAACTTAGAAATTTCTTAATTGCTG
AGTTTTGGTGGCTCTCTGGATGAATTTGTACCCCAGAATTGGATCTAGTTTGGGGGATTT
AGGATTGTCCATGCTCCTGATTCCTAAAACCTAGCTTAATAATTTACAGACTTATCTGTT
ATTATAAGTTATGTTAAACAAGTCTAAATTTGATTGAAACGTTTTAATCTAAACACTTAA
ATTTCTAATTGTTCTTCATCTTAGAGTTCTATAATCAGAGCATTATAAATACAAAGTGAA
TTGAAACTGCCTTATATTAAGTTGTTTTTCTCTCTTTCAGGTTCATGCTGAATACTCTAG
ATTTGTGAATCAGATTAATACTGCTGTACCTTTGCCAGGTGTGTATACCTTGAAGTATTT
TCATTTTTAAAAATTGCTAGTTATATATAAATGATGATACTTGAGGCTAGACTAACTGTG
CCAGGGCACTAATGTTCCCTTCAACTTGGGGTAATTTGGAAAGTCATTCTTGCCTCAGTA
TTTTTCTTCCCTAGATATTAAGTTTAATATTCAACTAAAATGTCTCATTCTGCTGCAGCT
GATTAAACACTTTTTTTCTTCCCCCTCAGGCTATACACAACCCTCTGCTATAAGTAGTGT
CCCTCCTCAGCCACCATATTATCCATCCAATGGCTATCAGTCTGGTTACCCTGTTGTTCC
CCCTCCTCAGCAGCCAGTTCAACCTCCCTTTGGAGTACCAAGCATAGTGCCACCAGCTGT
TTCATTGGCACCTGGAGTCTTGCCAGCATTACCTACTGGAGTCCCACCTGTGCCAACCCA
ATACCCGATAACACAAGTGCAGCCTCCAGCTAGCACTGGACAGGTAGGATGGCAGGACAT
GCAGCATACCAGTGAACTAGGGAAAACGGGGGTGGGCAAGGGGGGTGGTGGTATTTATTA
CTCATAAAGAAATCATGTAACGTGAAACATTTTTTTTTTTTCCTATTGTCTTCTTTCTGT
GGTCCCATCACCAAACGACCTGAGTACTTTGGGGCAGTGTGTACATGTGTGTACATCATC
CTAAAGTTCCGGTTGGTTCTACAAGTCTTGCCACCAGAGAGTTGTTCAGAGCAGGGATCC
AGCCAAACTGTAAAGGGCCATATAGTAAATATTTGAGGCTCTGTGGGGCGGGGTTAGTGT
CTTCCACTTTTCTTAGTGTGGTATGAAAAGCAACCCATAGGCAATACCTAAAGGAAGGAA
CTTAGTAGTGTTCTAATAAAAACTTTTATTTGTGAAAGCAGGTGGGTGGGCTGGCATCAG
TCATGGGCCGTAGTTTGCCGACACCGGGCTTGGCAGTATAAAAAAAAGGAGAACCAGGCG
GCCTACACCACACCTCTACATGATTGGAACTTAGCAGTTCTCATTTTAAAAAGAAACGTT
ATACCATGTACAGGTGTTTCTAACTTTCCAGACTTAAGTATTGTAAGTGCTGGTGTATTT
CTCAATTTAAGAAACTCAAATTTTCGGAGGAGAGTAGATAGCTCATTTGGATGGGGAAAG
ACTGGTGAGAGCATGGTAATGGATTTATGATGGGCCCTTCTCTGTGAGTCTTTCATAGTG
GACCCATGCCAGAATAAACTGCAGCCTCAAACCATTGCCGAGCCCCTACCCATGGGCTGT
GAGCACTGACGAGAGCTGTACACCCTAAGACAAAAATAGGGGGTTTATGAGCTAATTCTG
CATATGGCCCTTAGTCATTATTACTTTACATTTTGTATTTAAGCAGACCTAGAGTTCCCT
GGTGGCATAGTGGTTAAGGATTCATCACGCCATCTCATATTTGAGCTGCGTGATTTTGGA
ATGTAACTTAACCTATCCAGACTTTGGTTTCCTTACATATAAAATTGGCACCGTTATATT
ATCACAGGGGGTTGTGAGGATTATGTAAAAGAGCCAAACTGTCAATTAATGTTAGCTGTT
TATTATTAATAGTAATAGCAGTTTATTTTTTAGAAGTGCTTACTTTTTAGAAGTGTAATA
CAGATTTTATTTTGATCATCCCTTATTCTTTTTTGGAATAACCTCTTAAAACATTAGACA
GACTTGCTCTTGAAGCAGCAACCTAATAATAACCATGGAAGTGACAAATGAAGTTGCCTT
TGCCACGAGCATTAGCAGCAGTTACGACACAGAAAGAGCTAATCACATTGATAAAAGGAC
TTGAAATAAGTGAATATTGTTGCTGATGTTGCGGGAACTAAGTCCTCAGGTGGAGTTTTC
ATTGTTAATGAGCGTATTTGTCCCTAATGGCTCAAGGGACACTACAGGTTTTTCCTGAGA
GTTCAAAGTAGTACTGTATATAGATTGTCAATTTCATTTCCTCTGGGATGAAGGTGGGAC
GGCTAGGAGACACCGTTAACAAATTTTATGTGAAGGAAATTAAGGACCAGGAGAGGAAAG
ATTCAAATAATACATGTTAATCACTAAAGTATATCGTAAGCATTGTTTACTTATTTGTTA
GTTGGGCATTCTCACACTCCTTTTCCTCCCTTGATTTGTTTTGGTCCCAGAGTCCGCTGA
GTGGTCCTTTTATTCCTGCTGCTCCTGTCAAAACTGCCTTGCCTGCTGGTCCCCAGCCCC
CGCCCCAGCCCCAGCCCCCACTCCCGCCTCAGCCTCAGGCACAGAAGAGGCGATTCACAG
AAGAGCTACCAGACGAGCGAGAATCTGGACTTCTTGGATACCAGGTTAAATAAAATACCT
TGTCTTGCTTTCCTCTTCTTAATCTCCTACCATATGCTCCCTCTAAAGAAAGATAGATTC
ACATCTATATCAACAGTCTTCCCAGTTCAGTGCTAAGATTTCTGCTTTCTGGAATCCATT
TAGGTTAGGTTTTTATCAAACTTGGGGGATTACTTTAAAGCGTGAATGTTCCCCTTCGGG
TGGGTTTTTTCTTAGGTTTCATTAGGGCAATGTGGTAAGAGAATACAAAGCTCTCCACCT
AGAGAGAAGTCTTCTGTAACTGGCATCTGGAAGGAGTTCTGTAGAATTCCGTACTTCCTC
TTTTTTCTCTTCAGTTTTCTTTTTTTTAATAATTTTTATTGTACTTTAAGTGAAAGTTTA
CAAATCAAGTCAGTCTCTCATTTATAAACTTAACATACACCTTACTACATACTCCCAATT
ACTCTTCCCCTAATGAGACAGCCTGCTTCCCCCTACCAGTCTCTTTTTATACTTCCTCTT
TTTTATACAACTGATTTACCAATTGCTTTGAGTCAGTTTTGAATCATGGCGACCCCATAT
GTGTCAGAGCAGAGCTGTGTTCCATAGGGTTTTCAGTGGCTGATTTTTCAGAAGTAGCTT
GCCAGGCCTTTCTGGCATACTAGGTGGACTGGGTGGACTCAAACCTGTAACTGAGTGCGT
TAGTTAATGCACCACCCAGGGACAGTCGTACAACAGACTTTTGAAAGCCTGTCATAGTTC
TTTCTTCCCTAAGATTTCATCAAAAGCCTCCATTCTACCAATATGTGTTTTGTATTTAAA
ACCTTGGCTTTAAATTTGGTATTTTTCTTCCTGAAAAAGAGGATGATTTCTATCTGTATC
ACCCCCAATCCTCCATCCCTTCCTAAAAAAGGACTGCCAGAAACAGACTGATTTGTGCAC
ATATATAATTGTACACATACACTGAAGAATTAAAAAAAGATTATTGAAATATTTTGTTTG
GTGCAATTTTGCTTTGTTTTAGCAGAGAAGAAGCACTGTTGCTTTTTGCCAGAACCTGTA
AAGCATTCTTTGAAACAAATTTTGAGGCATTTTAGAGTTTATACAAACTAGTTGAATTAT
GGGTAGTCAGTTGAAAACAGACAGACGTAACAAAATGAATCACAGCATCCCTGACCAAGA
GAAAGTCATCCCTACTTTGACCACTGTTATAATTCAAAATCCTAAAGATCTGTGTAGTTC
AGTTTAATTTACTGCAATTTATAAGAAAGATGAGACACTTGACAGTCTACATTTAAGGAG
CTAAAGCCAATACAGTAGTTGTAGGTTTGCTAATGCCACTGTATTTTTCTGCTCATAGCA
TGGACCCATTCATATGACTAATTTAGGTACAGGCTTCTCCAGTCAGAGTGACATTGAAGG
TGCAGGATCGAAGCCGGCAAGTTCCTCAGGCAAAGAGCGAGAGAGGGACAGGTAAGTTCA
TGGAACATCATTAAGTGAATACATTTTCAGATGTCATTTGCGTCATTAGCTATAGTAATG
ATCATTGCCACAGGCTTCAGCATTCTGACTGAAATCATTTGGATCAAACAAGCTCTGGTT
TGTTGTAATTGATGCATTAGTGGAGAACAATAATATGCCTTTTAGAGTCTTAGAAGGAGT
TACACTCAGCTTTAAATCAACACTTGCTTATTCAGACTTCTTCCTTTGCTTTCATTGTCT
GCATCTTGGCATTTTCCTGAGGGTAGGCATAACAGAAGTGTTCAACAAGTGAGCCATTTT
TTACTACCTGGCATCATAGAATATCATGGGTGGAGCCACTTCAATGGGAGTCCAGCCTCC
CATCCAGTACTTTAAGTCTCCTTTCTTATTAACCTTGATAACTGGGAACTGACTGCTTCC
CACAACGGCTCATTCCACTTTTGGCATGTGGGCCTGCCTTTTAATTCTTAAAAACTTGAT
AATAGTTTAAAGGATCAGGTGGAAAGGGTTCATATTAATGATTAAAATTCTTGTCTGTTT
GATAAGTTAGATTGATAGAATTTGTTTGAGAGAAAATTTCATTTTGTTTTTTAACAGGCA
GTTGATGCCTCCACCAGCCTTTCCAGTGACTGGAATAAAAACAGAGTCTGATGAAAGGAA
TGGATCTGGAACCTTGACAGGGAGCCATGGTGAGTAAGGTGTAGCTGGGGGAACAGGGAG
TGACTAAGACTGGTCTGAAACTATTAGTTTTCTAACCTGATATTCATTCAGGTGTTTAAT
CCAACCTCTGTAATCTACTGGCTAATAGGGCACCCTTTTTTTTTTTTTTTTTTAATACAG
ATAGCATATAGTTACATACCCTTTTATTTTGAACTGACCGGTGTCTAGAAGAGACTCAGG
CAACTTACATTTTGGAGCCCTGGTGGCTTAGTCTGGGTCCTTGGTGGTGCAGTAGCTAAG
AGCCGTGGCGTCCTATGGCTGGGAAACAATAATGTTGGCGGTTCACATCCATCAGCTGTA
CTCTGAAAGCCTGTGGAGCAGTTCTGCTCTGTCCTGTAAGGTTGCTGAGTTGGAATCAAC
TCAGTGGCAACGAGTTTGGTTCTTCTGCTTTTTTGGTGGCATGGTCGCTGTTAATAGCTA
CGGCTGCTAACCAAAAGGTCGACCGTTAGAGTAATCCACCAGCCACTCCTTGAAAACCCT
ATAGAACAGTTCTACTCTGTTCTGTAGGGTCGTCGTGAGTCAGAATTGACTGGATAGTAA
TGGGTTTGGTGTGGGTATAGTTACACAGCCCTTTTATTTTCAACTGACTTGTGTCTCGAA
AAGAGGCTGCTTACGTTGTATACATAGCATTGGTGACATAAAAACCCTAGGAAGTACTAA
TGATTGGTCATTTCCAAATTTTATTGCTTATGATATCTGAAAACCTGGAGGTAATCTGAT
AGAGACTTAATACAGATTGTTTTGTCTTTGCCTGGGGAACTGAGCCACATCTCCTCTCAT
AGCTGTAATGGTTGATAGTGGTAGTCCTATGGCTGTTGGGAGCAATGTCTCTTAGTATCC
CAGAACTCTACGTCCTGTAGAGGTACATGCACTCAGTTTTGGTCATTGCTTAGAGTCATA
ATAAAAATGAACGGAAGAAAATAATTTTTTTCTTTTCTTAACTTCTTTTCTTTTAACTCT
TTAAAAGGTGAAATATCAGCCCCTAGAGTCTCACTTGCTAACTTTCCTTTTTGTTTTTTT
TTTTTTCTTTTTTTTTTTTTTTTGTGTTTCTTTTTTCTTTCTCTGTTTTCTTACATGGTT
CTGGTGGATTCACATTTGCTGATGCTGGTGCTGTTTTTCGTGTGATCATCAACGTTTTTG
GGTGACCGTTGACCATGTGACCTCAAAATGGTGTCCAACTAACCACTTACAATTAACATC
CTTTTTTTTATTAACGATTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGATGCCATTCTGGATGGCCCCGTAGGAAAC
GGTAGACCAGAATTTTGACCCTCGATGACTCTTCTTTAGCAATAATGCATGTGTTTGATT
TATCAAGACTCTGGGGTCCTGTACTGAGAACCATCTTGGACTTTTGCAGAAGTTAGAGAT
ACAGTGTCCCCTTGCTAAAAGGGGCTCCATTCTTTTTAAAAAACACCTTATTTCTGCAGT
GGCATAGCATCTGTTAAAATTTACTTAGAATCACAAACTTGTCTCCGAAGCTTTTTTTTA
ACAGTGAATGAAATGTCCTTGTTCGACAGAGCATCCCAGCAGGGTCATTCCCATATACAT
CTGACTGGGCCCAGCGTTTTCCATGTGGAGAAACTTTTATTTGTATTTTACTACTGCCTA
GTCAGTTTTGATAATAACTGGTTACAAACAAAGCCTTACCGTTTATTAGTGGGGAAGTGG
TTTTAAGACCATCCTTTACCTTCAGTACTTAATTCTAAGAGATCCTCATTCATATTTCAG
TTTTGAACTCTTTCTCTTTGGAAAATGCCGTGATTTTACTAAATTAAAATTGTTGGATAT
AGCTGGATCCTGGGTAGGAAAATGAAGTTATTTTTTCATTGTGTCTTTTTATTGGGATGA
TCCAAAGCTGGCACCTTCAGGCACACTTGTCTCAGATAGCCATAGTTCTTTTTTTTTTTT
TTTTTTAATTGCCCTCCTAAGCTCCTTCTTTGTCTTCACCTGGGTCAGAGACAACTACTT
GACCAAAAGCTGGTCGGAACTCATCACAGAAGTGAAACACAGTGGCCTATCTCTCTCAGA
ACTGGTTGCAGCTAAAATAGAGAGATTTGACTGCACATGATAGGATGGTGGACTTAGTGA
CTGAAATTGCAACTTGTCCTTTTTCTTGGCATTACAGGTTTTGCCAAAAGAACTTTTTTG
TATCAAATATTGATGTGTGAAAGTGAAGGAGCTAGTCTGCTGAACCAGAAGTAGTTTGAG
ATACTGAACTGTCATTTTTGCACATTTGAATACTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1129, 1669..1748, 2897..2949, 3211..3374, 4102..4313, 4897..4957, 6014..6071, 6303..6556, 8244..8417, 9752..9864, 10471..10562, 11972..12144, 12302..12328
1001..1129, 1669..1748, 2897..2949, 3211..3374, 4102..4313, 4897..4957, 6014..6071, 6303..6556, 8244..8417, 9752..9864, 10471..10562, 11972..12144, 12302..12325
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved