Loxodonta_africana Locus L2HGDH
snOPY snoRNA Orthological Gene Database
Loxodonta_africana L2HGDH
Loxodonta_africana
L2HGDH
GeneScaffold_913
SNORA42
21712..21846
55145
ATTAAAGACTGCCTTCGAGCGCAGACAGCGGGTAAGGGTTAGAATTAAACTGGCACGGG
GATAGAGAATCACACAACTTTATAGTTAAAAGGTCCCTTCGAGATTACTGAGCTCACCTC
CCTCATTTTACAGAAAAGGAAGCAGAGGTGAGGTGACTTGGTCATGGGAGTCGCTGGTCG
CACGCTCATACAGCATAACTAAAAGTGTATCTCGGTCCACTATTTAAGGACACAGATTGC
TAAAAGATGGCGGAGACCCAGCTGTCCGGTCCACCCCGTACCCCGGTACCTCGGTGCAGA
AGAGTAGGGCTTGATATTTATAGGACGAATATAATGACTGAATGAATGCCACCCTTAGGA
ACCCAGTCAAAAGAAGCCCAGAAGATCTTCAGAGAAGCAGGCGTTGCCACCGACAAAAGA
ACCGCCTCCGCCTCTGAGCCACATCAAGGGCCGGACAGGGGGCGCCCCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNACCGGCGGCCGCGGGGCCCGCCCAAACGAGAC
TTTCTCCCGCGGCCCTTAATCCGCTCTGCGGTGAAAGTCAAAGACGGGCGACTTGGCAGA
CCAGGCTTTCAGTCAGCCCAGCAGTGGGAGAGGGGAAAGGGCAGAGCATAAGCACTACCC
AAGCCCCGCCTAGCTTCGGGGCCTAGCTCGCCTACTCACAGCGTCTGAGGGAACAAGAGA
GGGAGCGAGCGAGCGGCCCCCACATCTACGACGGCGCCGGCCTCCCTTCCGCCCTCTGCT
GCGCGCGTCCATTGGTCGTCGCCTACCTCTCCCACGTGAGGCAAAGGCGCGCGCCTCATT
GGCCCCGACGTGGGTGGGCGGGGCTAGGGCGCGCCGACCCGGTCAGTGTCGGGCTCAAGT
GGCCTCCTCTGGTGGCTGAGGCAGGGCAGGGGGTGCGGGCAATGCTGGCGGCGCTGCGCT
ACCTGGGCGGTGCCTGCGGGCGGGCCGGCGGGGACTTCCCCGCGCCTTGCGGGCCAGCGC
GACTGAGGCCCTGGCTACTGCGCGGAGGTTGCTGCTATGGCCGTAGCGCCAGCACTAGGT
GAGTGGCCGCTGGCCCGCCCCCGCCACCTTCCCTGCTTCTGCGCTCAGAGGTGCCCTGTG
TAGGACCGATGGTCTTGCTCGTACTTCCCTGTCCCGTCAATCAGAGGTCAGTGTCCTGTG
GAGCCCAGGCTTCCACCTCGGATCCCAGGAATACCTGCAGGTTGCATTCCTTGTATTTGC
GGGCCAAAGGAAAAGAATAGAGGCAATGTTGAGTAGAGGTAAAGAAGAATTCTGGGTTTG
AATACACACCCTGCACATGAATTAACTTTGAGCGAGCTACTTTAACCTCCTTAAAGGCTC
AGCAGTGAATAGGATCCTAGTCTCTCCCGTAGGTGGTTGTTTTGAGAATGAAATGACTTA
GCACACTGCAAGCAATTAATAAATATGCTGTTTATTAGCTGGCATCCCGGTGTTTCTTGG
GAGATCTGGAACCGGTCTTAAATCAGCCACTTCTTAGTGCACACCGCATACGGTTGACCC
TGTGAGAAGCAACTGCAGAATTCGGTGTCCTGTGGTGTGAAGTTAGAGGTCACATTTGAA
ACCACTGTTTGCCTTCTTTAGAGAAATGATCTGTGCGAGGGCGCTAAGGCTAGAAAGCTC
TCTGCTAATATGAGGACTAGAAGATGGGCAATGTGAATGTGGCTAGAGCTTAGTGTAAGA
GATGATGTGGAATGAGGCTGAAGAGGGGCTGCATCACAGCAGAGTTTTTATTCTGTTTTA
ACCAGACATTGAATTTTATTCCAAGAGCAATGGAAGCTATTAAAGGGCAAAGGGAATGTT
TAAATGTTGATGTTTCAAAAGTCGATTCTGCCTGCTGTGTGTTAGTGGATTGGAGGGGCA
CTGGAGTGAGATACTAGTAATAGGATTTGTGATTAATCGTGGTTTATGTAGACAGCTCTT
TTGAAAGATTTCTTAAGAGTAGGGTTAGTAAAGGGTTTTGCTTTTACTTTTTATTTAGAA
ATAATTATAGATCCATAAAAAAACCCAAACCCATTGCTGTCAAGTCGATTCCAACTCATG
GTGACCCTACAGGACAGAGCGGAACTGCTCCATAGGGTTTCCAAGGAGCGCCTGGTGGAT
TCGAACTGCTGACCTTTTGGTTAGCAGCCAAACTCTTAACCACTACGCCGCCAGGGTTTC
TAATAGATCCACAGGAATCTGCAAAAAAAAGTACAGAGAAGTCCCCTGTATCCTTCACCC
AGTTTTCCCCAGTGGTAATAGTTTACGTTACTATAGTACAATATCAAAACCACGAAACTG
ACATTGGTGCAATGTTTAGATTTCACTAGTTTTACATGTACTCATTTCTGTGTGTGTGTG
TGTGTAGTTCTATGCAGTTTAATCATATGTGTAGATTTGTGTAACTGCCTCACAATTAAG
ATACAAAAGTGTTCCATCAGTACAGAGATATCCCATGTGCTACCCCTTTATGGAAACCTG
GGTGGCGTAGTAGTTAAGCACTACAGCTACTAACCAAAAGGTCTATAGTTTGAATCCACC
AGGTGCTGGAAACTATGGAGCAGTTCTCCTCAGTCCTGTAGGGTTGCTATAGAATCACTA
TGAGTTGGAATCGACTCTTTGGCAACAGGTTTGACCCCTTTATAGTCACACTCACCTCTT
CACAATCTCTAATGTGTTCACCATCTCTATTCTTTTGTCATTTTGAGAATAAGTAGAATC
ACACAATATGTTACCTCTTAAGATGGGCTTTTTTTTTTTTCATTTAGTATAATGTCCTTG
AGATTCATCCAGGTGGTTGTGTGTATCAGTGGTATGGATGTACCAAAGTTTAACCATTCA
CCCATTGAAGGACATGTGAATTATTTCCAGTTTTTGGCTATTATGAATAAAGCTACTATG
AACATTGGGCTACAGGTTTTTGTGTAAACGTAGTTTCCTTTTCTCTGGAATAAATGCCCA
AGAGAGCAATTGGTGGGTCATATGGAAACCCTGGTGTTGTAGTAGTTAAGAGCTACGGCT
GCTAACCTTTAAAAGGTCGGCAGTTCAGATCCATCAGATGCTCGTCGGAAATTCTATGGA
GCGGTTCTACTCTGTCCTATAGGGTCACTATGAGTCGGAATTGACTCGACAGCAACAGGT
TTGGTTTTTTTTTTTTTTTTATGGTAAGCACATGGTTAGTTTAGTTAGAAAATGCCATAT
TCTTTTTCCAGAGTGGCTGTACTATTTTATAGCAATGTATTGGAGCCCTGGTGGGACAGC
GGTTAAGAGATTGGCTGCTAACCAAAAGGTCTGCAGTTCGAATCCACCAGCCGCTCCTCG
GAAACCCTATGGGCAACTCTATTCTGTGCTATAGGGTCACCATGAGTCGGAATCAACTCA
ACGGCAGCGGGTTTGGTTTGGGCTTATTAGTGATCCAGTTTCTCATTATCCTCACTGACA
TTTGGTGTTATCATTTTAGCTATTTTGATAGCCAATTTGCATTTCCTTAATGCCTAATGA
TGTTGAACATTTTTCCATGTAGTTCTTTGCCATCCACATATCCTCTTTCGAGAAATGTCT
ATCTTTTGCCTTCTTTCTAATTGGGTTGTTAGTCTTCAGAATCTTTATATATTCCAGATA
TGAGTCATTTGTTAGGTATGTGATTTGTAAATATTTCCTCCCAATAGGTTGGTTGTGTTT
TCATGCTTTTAACAGAGTCTTTTGAAGATCATAAGTTTTAACTTTTAATGAAATCCAATT
TACCTTTTTTTTTCCTTTCATGGGTATCGCTTTTAGTGTCAACCCTCCACCTAACCTTAG
ATCCTGAAGATTTTCTCTTGAAAATTTTGTAGTATTTGATGATTTAAAAATTTATTGTTA
ATTTTTTAGTTATGGTAACAGTATTATGGTCATGTGTGTTTTTGAAGAGGTCTTTTGGAG
ATGTTATTGTTAGGTACCATCAAATCAGTTCTGACTCATAGTGACCTTGTGTACAACAGA
AGGAAGCGCTGCTTGGTCCTGCGCCATCCTCACAATTGTTGCTATGCTTGAGCCCATTGT
TGCAGCCACTGTGTCAATCCATCTCATTGAGGGTCTTCCTCTTTTGCATTGACCCTATAC
TTTACCAAGCATGATGTCCTTCTCCAGGGACTGGTCCCTCCTGATAACATGTCCAAAGTG
TGTGAGAAGAAATCTCCCCATCCTTGCTTCTAAGGAGCATTCTGGGTATACTTCTTTCTT
CCGTGACAGATTTGTTCGTTCTTTCATTCTTTCGACAGTCCTTAGTATATTCAATATTCT
TTACCAACACCATAATTCAAAGGCATCAATTCTTTGGTCTTCCTTATTCATTGCCCAGCT
TTCACATGCATATGAGGCAATTGAAAACACCATGGCTTGGGTCAGGCACACCTTAGTCCT
TAAGGTGACATCTTTGCTTTTTAACACTTTAAAGAGGTCTTTTGGAGCAGATTTGCCGGA
TACAATGCGTTATTTGATTTCTTGACTGCCCGCTTACCTGGGAGTTGACCCTGCACCCAA
GTGAAATGAAATCTTTGAAATGAAATCTTTGACAACTTAAGCCTTTTCTCCATTTGTCAT
CATGTCACTCATTGGTCCTGTTGTGAGGATTTTTGTTTTATGTTGAGGTGTAATCCATAC
TGAAGGCTGTAGTCTTTGATCTTCATCCCAAAAGCCCATTGCCATCGAGTTGATTCTGAC
TCATAACGACCCGGTAGGACAGAACTGCCTCATAGGGTTTCCAAGGAGTAGCTGGTGGAT
TTGAACTGCCGAACTTTTGGTTAGCAGCTGAACGGTTAACCACTGTGCCACTAAGTGCTT
CAAGTCCTCTTGACTTTCAGCAAGCAAGGTTGTGTCATTTGCATTTCTCAGGTTATTATT
GAGTCTTCCTCCAGTCCTGATGCCCCATTCTTCATATAGTCTAGCTTCTTGGATTATTTG
CCCAGCATGCAGATTGAATAAGTATGGTGAAAGGATACAGCCCTGATGCATACCTTTCCT
GATATTAAATCATGCGGTATCCCCTTGTTCTTTTTGAAGGACTGCCTTTTGATCTATGTA
CAGGTTCCTCATCAGAACAATTAAGTGTTCTGGAATTCCCATTCTTTGTAGTGTTATCCA
TAATTTGTTATGATCCCCACAGTCGAAAGCCTTTGCATAATCAATAAAACACAGGTAAAC
ATCTTTCTGGTATTCTTTGCTTTCAGCCAAGATCCATCTGACATCAGCAGTGATATCCCT
TGTTCCACGTCCTCTTCTGAGTCCAGCTTGAATCTCTGGCAGTTCCCTGTTGACGTACTG
CTGCAACCACTTTTGAATGATCTTCAGCGACATTTTACTTGCATGTGATATTAATAATAC
TGTTCAATAATTTCTACATTCTGTTGGATCACCTTTCTCTGGAATAGGCATAAATATGGA
TCTCTTCCAGTTGGTTGACCAGGTAGCTGTCTTCTAAATTTTTGGCAAAGACGAGTGAGC
ACTTCCAGAGCTGCATCCGCTAGAGATAACATGTGGAAATATTTATGGATAAAACAATGT
GATGTTCAGGTTTTGCATCAGAATAATATAGGAGAGAGTAAGATATATATAGATGAAGCA
AGATGGCCCATGAGTTGGTAATTATTGAAACTAGTTGATGGGTACATGGGGTTCATTGTA
CCATTCTGTCTACTTTTCCCTATCTGTCCAACTATTGCGTTTGAACATTTCTATGATAAA
AGCTTTAAAAAACAAAAGAGTTATCTGTTAAACTGCTCATTAGTGTTGACTTGAGATTGA
GTTTTGGAGAAAAATATCCCCTTCAGCGTCCATGATTAACTTGGCCCATGAATGTCCTCC
AGTGATCTTCCGTGACTGTTACTCTGGGCACTTTTCCCCATTGTGGACACTTGGGAGTCT
GTGCTTTAGTTTGTGAAGCATATTTCAATGATTGATGAGGTGTAGGCTCCCTGAATAGAG
TAGTGGTTCTCCAGGTTTGGTAGAAGGGAGTGAAAGGTGGCATGTGTAATTGGAAAAAGC
ATTTTTAGTATTATAGCTTTATGTTTGAAAATCAAGCATTTATTGATGGTTGTAATAAAA
TCTGTGAAAACAAGAGCCAAGAGAACTTTTTGGCTAGGAGGCTGTGCCAAAACAGTGACT
CTCAGTGGAAGGAACGCCTCACCAAAGGGTTTTATGTTTTATTTATCAAAAGGCAGCAAT
GATGAGAAACACAATTACAGAAGTCAAAACTACCCCTGCAAAATCATGCCACCTTTTACA
GAAATGCAAGGCTTGAAGGCAAAGCAAGGCATTATAGCTTATCTTGAAGACGAGAAAGTA
AGAAAAAAACATTATGAAAGACCACGTGCACACACACATTCACAAACATCTTCCTTTCGT
TGGTCCTTGTGGGTAATTTACAGTTCATTGATTGATATAGATATCACCTTGCTATGGAAA
AGAGAAAAGCACACAAAATATAGCTAAGTCATAAACTTAGCAGTATCTTAAGTATTTGTA
AATGCTTTGAACACCTCCTTAGCAGAAGATATTGGCAGTTTTGGGAAAATATGAAGCCCA
TTTTAAACACAATAGTTCAGTTATTTTTCTGAAATTCTTAAAAGCCAGTTTTTTTGTTTC
GTTTTTTAGACTTCATAAAAGATCTGCTTACATGTTTAAGTTACATAATGGGTCAATAGG
TGCAAATGAGTATAAATAACTATAGTGGAATATGAGAACTGTACCTTTAATCTAGTGAAA
TTTATGTTAAAAAAAAGTTTTTAAAGTCTTGGACTTCATGTACACTCTGATCATAGGAAT
TTTTAAGTTGACCACTGCAAGCATTTACCAGTAACCCTTATTGACCCAGTGGACCCAGAA
TCTTGTTTACTTGTGCTGTTCTTTTTATATCCTCTCTTCTTAAGTGGGAGCCTCGATGGC
ACAGTAGTTAAGAACTTGGCTGCTAACTAAAAGGTTGCCGTTCCAATCCACAGGCCGCTC
TTTGGAAACCCCATGAGGTAGTTCTACCCTGTCTTATAGGGTTGCTGTGAGTTGGAATTA
ACTCGATGCAACGGGTTTGATTTGGTCCTCTTAAATGTGGGCCTGTTCACCAGCACATGC
ATGCCTTGGCAACCATTTTACCCAACTAGCTAAAGGTGCTGAAGTGAGAACCACCTGTCA
AGTACCACCTGGAAGCATTCCTAGTCCAAGTTATGAGGCTCGTGCACTGAAGGAGTGAGT
GTTAGACTCTTACAACTTCCAAATTAAGCTGCAGATTTTGATTTATCAGGCACACATGGC
TGTGTCCCTGGTTGTACAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GTACAGTAGCTGTTTCTGTAGCCACAGGTATAGTAACAAATGTAATGACATGATGCACTC
TGCCAATAATTTGAAATTGAAACCTCAGATCATTTTCAAAGAAAGGGCTTTAACTTGAAA
TTTCCTCACCCTATTGTCCTATGAAATCTAGATTTGTTGTCCATAAATTCTCATTGCAAA
GTTAGATATATTGTACATAGCCTTTCAAATTTTTTCAGTGATTGCATAATCAGTGTTTGT
CATGGTGAAAATTGTGTTTCTGAGCCTGTTCCTAGGCCACTTATTTCTCTAAGGTTTGAT
GTATTCACTGGCCGTTTCCTGCACTTGAATTTTAAAAGGTCAGGTGGTAGAGAAGTATGG
TGCCTAACACAAAGGAATCACTGATGTAACTAACCCCGGGTGGCTACTGTGGAGCCTTAG
AGTGGCTTGGGCAGCTGGTCACCCTGCCTAATGGTAGGACATAGGGTATCACTGATGATA
CTACTGACCAGCAATATATGTAACTTGGAGAGGTTTGTTCCTGAGTATAGAGACAAATAG
CACAAAGCCCAATAAATATGTGATTTTAATGATCTCAAATTAATAATGTAATTGTCCACT
GATGATGGAAATTATGTATGTGAAATTTGGTGAGATCTGCTGTAAACAGGCATTACTTTA
AAGGTGATTTTCTCTTAAAGCTCATTTGATGTAGTCATTGTCGGTGGCGGAATTGTGGGG
CTTGCCTCTGCCAGAGCGCTGATCCAGCGGCATTCAGCCCTTTCCATTGGTCTTCTGGAA
AAAGAGAAAGATTTAGGTATGTATGTTACCAGTGTTCTTCTGGACTACCTAAGCACCTGC
TCATTTTGTCAGTGCTGCATCTTTCATGCTGAATGTCGGTGTTAGTATCTTAATATGGAT
TCTGCTGAAAGCAGAATCTGAGGCAAGAACTTGGATGTAGATGATTTATTTGAAAGGCTA
TCCCAGGAGGCAGGGATGAGAGAGTAGGAAAGTAAGATAGGGAAGGAAGAAAAGCCACGT
GAGGGCACTTTATCAGTCTTGATTCCACGTTGACCTCTGAGGAGACACCTGATGTTTCCC
AGAATTGTATCCATTTATCCATCAACTCCTATCCCTCTTGGTTGAGGATTGCCCCTAAGG
GTGTTGAAGTTTCCTGAGCCCCCTAAGACACATTAGAAAAGGCCCTGGGGCAGTATGCAG
AGCCATAGGGGCCCTCAAAGTGATTCGTTGGTAGCAAGAAGTGAGTCTGCACCAAAGTTG
TAGCTGAAATCAGAGATGAACTGGGGGAATATGACGTGAACACCAAGGGGCAGTTGCTGT
AGAAAATTACCAGTACTCTGATTCTAAAAACAAATTCAGGCAGAATTTTAAATGATATGG
TCTCTAATAACTTCAAATATATGTTTGTCCCCCCACTTCTTAGGTTCTGTGTAAGTGATG
TACTTTTTCTTATCCAGTTTCTCTTGTTCTGTAGCTCTTCACCAGACTGGACATAACAGT
GGTGTCATACATAGTGGAATTTATTATAAACCTGCATCTCTGAAAGCTAAATTATGTGTA
CAAGGCGCAGCCCTCATCTATGAGTACTGTAACAAAAAGGGAATTTCCTACAAGCAATGT
GGCAAGGTATGGCAATATACTTGGGCCTAGACTCATTTATAACTAGTATTTTCTTAGTGA
TGTTTGATATTGAATAATAATAATAAAAACCTTGGCTTTTTCTCCCTCTGTATCTATATA
AAACCCACTGCCATCGAGTCAATTCTGACTCATAGCGACCCTACAGGACAGGGTACAACT
GCCCCACAGGGTTTCCAAGGAGCCCCTGGGGGATTCAAACTACTGACCTTTTGGTTAGCA
GCCGTAACACTTAACCACTATGCTACCAGGGTTTCCTTGTATCTATATAAAAAAAAAAAA
TAAATGTCTAATTTATAAACTCTAATATTAGGGAATAATTTAAAGACATTATGGTATGAC
TAACTGATTTTTAAATAACTGCTTCACTGAGGTTTAATTTACATACCATATTATTCACCT
TTTTAAAGTACACAATTTAGTTTTTCGTCTATTCATAGAGTTGTACCACCATCACCACTA
TCTAATTTTAGAACATTTTCACCACCCGCAAAGGAATCTCATACCCATAAGCAGTCATTC
CCCACTCTCCTTTCCCCAGCTCCTGGAAAACACTAATCTACTTTCTGTTTCTATGGATTT
GCCTGTTGGGGACATTTCATATAAATGGAATCATATAATGTGTGGTCTTTTGTGACTGGC
TTATTTTACTTAGCATAATGTTTTCAAGATTCATTTCTATTGTAGCATGTATCAGTACTT
CATGTCTTTTTATTGTCGAATAATGTTCCATTGTACGGATATATCATATTTTGTTTATCC
ATTCATCAGTTGATGGGCATTTTGGTTGCTTCCACTTTAGGAGCTGTCATGGATTGAATT
GTGTCCCGCCAAAAATGTGTGTATCAGTTTGACTGGTCCATGATTCCTGGTATTGTGTGA
TTTTCCTCTATGTTGTAAATCATGCTTCTATGATGTTAATGAGGGAGGATGGGCAGCTGT
TGTGTTACTGAGGCAGGATTCAGTTAATGAGACTGGATTGTGTCTTGAGGCAATCTCTTG
AGATATAAGAGAGAAGTGAGCAGAGAGGCAGGGGGACTTCAAATCACCAAGAAAGCAGTG
CCGGGAGCAGAGTGCGCCTCGCCCTCTGGACCCAGGGTCCCTTCATGGAGAAGCTTCTAG
TCCAGGGGAAGATTGATGAGAAGGCTGACAGAGAAAGCATTCCCCTGGAGCTGACAACCT
GAATTTGGACTTTTAGTCTACTTTACTGTGAGGAAATAAACTTCTCTTTGCTTAAGCCGT
TCAGTTGTGGTACTTATCTTATAGCAACACTAGATGACTAAGAATTATGAATAATGCTGC
TATGAACATTAGTGTACAGGTTTTTGTTTGGACATGTGTTTTTAATTATCTTGGGTGTAC
ACCTAGAAGTACAATTGCTGGGTCAAGTGTTAACTCTATGTTTAACATTTTGAGGAACTG
CCAAACTGTTTTCTAAAGTGCTACACCATTTTACATTTCCATCAGCAATGAATGAGGATT
CCAGTTTCTCCACATCTTTGCTAAACTTATAATTGTCTATCTTTTTTATTTTTTTTAGTG
GATGTGAAGTATCTCGTTGTGGCTTTGATTTACAATTCCTCATTGATTAATGATGTTGAG
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNGAAGAAATAGAAGATTTTTATCAGTTGCTGCAGTCTGAAATTGATGGCAACATGCAAT
CAAGATGCACTGATAATTTACTGGTGATTGGAATGCAAAAGTTGGAAACACAGAAGAAGG
ACCAGTAATTGGAAAATATGGCCTTTGGTGATAGAAACAATGCCAGAGATCGAATGATAG
AATTTTGCAAGACCAACAACTACTTCATTGCAAATACCTTCTTTCACCAGCATAAACGAC
GACTATACACATGGACCTCGCCAGATGGAACACACAGAAATCAAATTGACTACATCTGTG
GAAAGAGACAATGGAAAACCTCAATATCATCGGTCAGAACAAGGCCAGAGGCCAACAGTG
GAACAGACCATCAATTGCTCTTATGCAAGTTCAAGCTGAAACTGAAGAAAATCAGAGCAA
GTCCACAAGAGCCAAAATATGACCTTGAGTATATCCCACCTGAATTTAAAGACCACCTGA
AGAATATAATTGACGTATTGAACACTAGTGACCGAAGACCAGGCGAGTTGTGGAATGACA
TCAAGGACATCATCCATGAAGAAAGCAAGAGGTCATTGAAAAGACGGGAAAGACAGAAAA
GACCAAGATGGATGTCAGAGGAGACTCTGAAACTTGCTCTTGGGTGTCAAGCAGCTAAAG
CAAAAGGAAGAATTGATGAAGTAAAAGAACCGAACAGAAAATTTCAAAGGGCCTCTTGAG
AAGACAAAGTAAAGTATTATAATGATATGTGCAAAGAGCTGGAGATGGAAAACCAAAATG
GAAGAACACACTCGGCGTTTCTCAAGCTGAAAGAACTGAAGAAAAAATTCCAGCCTCGAG
TTGCAATAGTGAAGGATTCCATGGGGAAAATATTAAACGATGCAAGAAGCATCAAAAGAA
GATGGGAGGAATACACAGAGTCATTATACCAAAAAGAATTAGTCGATATTCAACCATTTC
AAGAGGTGGCATATGATCAGGAACCGATGGTACTGAAGGAAGAAGTCCAAGCTGCTCTGA
AGGCACTGGCGAAAAACAAGGCTCCAGGAATTGATGGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTACTACAAAAAATAAAACAAGCATT
GGTTGTATATCTAGTTGCATCTACAGAGTTTGAACATGTCTTGGGTGATAAAAAATATAT
ATGTATATATGTGTATATATGCACGTATGTATGTATATATATAAAAAAAATTTTTTTATG
TATATATATGTACATAAGCTGTTTATCATATCACCTGAAGACAAACTTCAAGGTAACTAC
ATAAAATCTCCATTCCATATTTGTAGCCTTGAAAACAAGGTCTGCAACAAATCAAAGCAG
TGCAGTGTAGACACCGCAAATAACTAGAACACTTAAGTTCTCACTGAGTGTGGATGATGT
ATAATATAAACCCATTACTGTCGAGTTGATTCCAACTCATAGCGACTCTATAGACAGAGT
AGAGTTTCCAAGGAGCGGCTGGTGGATGATTAAAACTGCTGACCTTTTGGTTAACAGCCA
TAACACTTAACCATTGTGCCTCCAGGGCTCCAATATATAATATGCTACTGGAAAAATCTC
AGTGAATCTTATTTAAAATGTAATTGGTGATACAGAATTAGACTCAGAATTAAATATGAT
TCAGATCAGGATCAGTTATGGCGATCAGTTAAAACTGAAGAAGCCCGCTGTAGTAGCCAG
AACGCCTCGAAGAGGGGATATTGTTTCCTGATTATAAACAGAAATGTTCTTATTTAGTTA
GAAATATTTTTTTTTATCTGTTGGACACATTATACATGTACCCAGCATCATTTTTAGGCA
CTTAAAGGAACAAGGTTTTATTTAATTTTTGCTTTAACACTATCAGGCTATTGCCAAGAA
AGGATAATGTATGCTATCTATCAAAATAAACGAGTAGAAAAATTCAGTCCAAATAAAATT
TATTGAACAAACCTATTCTCAGTGATTCTTAACTGTATTCTCCTGATGTTTTCACAATCC
TGCCCCAGGGTCTGATGGCTATTGATTGCCCACATACTGGCATTGTGGACTATCGGCAGG
TGGCCTTGTCATTTGCCCAGGATTTCCAAGATGCAGGTGGCTCTGTTTTGACAAATTTCG
AAGTAAAAGATATTGAAATGGCTAAAGAAAGTCCTTCAGGAAGTCAAGATGGTAAGTAAT
TCTTGCTGTCTTTCTACTGAATACTTGTATTGACCTTTTGAAAAGCTTGGATCTGTGGAT
TTGGATTTATGGCAGGCCCATCACTGTGGGCCTCACATAGTGCCCATGTCAGAGCAAACT
GTAGCCCCAAACCATTGCCTGGCCTCCTTGCCCATAGGCTGTGGGCACTGAAGCAGGTTG
CACAGTTGTAGAAAAAAAAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGCCAGGGA
ATCTGCCAAACTCTATAATGCACATCAGGCCCCCACAATAAAGAATGTCTGGCTCCCAGT
GTCAATAGTGCTGAAGCTGAGATGTTAGATAGTAGGGGGTGATGGGGGAGGGGAAGAATT
GGGATGAATAAAATGTGGTACATATATAAAACACAACATTATTCAGCCATAGAGAGAGAT
GAAGTCCTGATACACGGTACAACATGGATGAACCTCTAAAACATTATACTGAGTGAAATA
AGTCAGTCACAAAAGGACAAATATTTTATAACCCCACTTATATAAAATATCCAGAATAGA
CAGAGTTTATTAGTGGTTACCAGGGGTGGACAGGAGGGAAGGGAAAAGGAGGACTCGTTC
TTTAGGGGACACTGAGCTTCTGCTAAGGGTGATGGAAAATTTTGGAAGTGGATAATAATG
ATGGCCCAAACAACATGATAAACATAATGTCACTGAATTGTACATTAATTACAAGACTAT
TGAAATGGCAAATCTTCTGTTACATGTATATTTACCATAATAAAAAAAGAGAGAAAGAAT
TGGGTAATATATAAACAAATACATTTATTTCAAAGTAAGAAATGTTCATAACTACTACAT
TCCTCATTTTTGTAATTGGTCACAAGGTCATAACCTACTTCCCGCTACTATCAAGTCGAT
TCCAACTCGTAGCAACCCCATAGGACAGAGTAGAACTGCCCTATAGGGTTTCCAAGGAGC
AGTTGGTAGACTTGAACTGCCAGCCTTTTGGTTAGCAGCTGAAGACTTAACCACTGTGCT
ACCAGGGCTTCCATATGGTCATAGCTGATATTTATAATTTCCTTCTTCCACTACCCATTT
CATATTCCCTTTGCCCTTGGCCAGCATCTCAGCTGGTCGTTGTTCCTAGCCTGGTGGGCT
AACCTAAACTTTAATTCCTGAATTATCTGTGCCACTAGCAGGCCTGCCTATTTTGGGTTG
TTGTAGGCTTCCTTAACTTTTATAATAATACAGAGGAGTACTAAGAGGCGCCCCAGGAAA
TCTGTATTCCAGACATACTCCTCTTTATTATCCCCAACCTTCTGTGTAGTAGCAACTCCC
ATTTCTCCTTGAGAATCAGATCAATTACTGACTGAGCACTCAGTCTCAANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNAATAAAATGGGCTTAAAAAGCATGCCAGAATTTTAGAAATTATCAAGCATCAACTA
GTTTAATCTTGTTACTTGGTAAGATGCTTCAGTATGAAAAGTATGGTACAGTCATTGTTA
AGACAAAAAAAATCATTTAAATTTGTCACTAGTATAATATTTCAAATAGTGTGGGATTTC
TTTTGTAAAAATAAATCTTTCACTACGTCTTTTTTTTTTTTTTCAGGGATGAAATATCCA
ATTGTTATTAGGAATACAAAGGTAAAGACTCCTGAGCAAAAACTGTTGTCTGCTTTCATC
CTCTCCCCTTTCTTAAAAAGTTAAATTCGCTGACAGTTCTAAGTCATTGAATGAAATTTA
TCTAATATGAAAGTTACTCCAATAGTTCTTTGAGAGCAATATAATAGCTTTCATTTTAAC
AAAAGTTTCAACTTGAGAAGTCTCCATAACATAACTCAGCTGACAGAGAATAGAATTATA
AGCACATGGAATGTTTAATTTTAAGGCAAAATTGGTAGATATTTTAATGATCTGTCTTCC
GATCATCATTAACTTATTAGCTCTCTACTAATTCGAAGATTTTTAGGTGGGAGGAGTGCA
GAGAGAGATGGACTGCTTTCCTGCATCTCCACATAGTCTGAAACAAGAGCCATCGACTAG
CATAGAACATTGCATTTACTGTATGTCCACTGAGTCATCAGGGTTCAGTCAGGGAAGCTG
AGTCGTTAATGGGTATTTTGGGATTGATTATAGGAATTAGACCTTAGACAATTATGAAAG
GATCTGAGGAAGTGAAGGTGCAGAATGGGATTTGGCAAATCAGAGGAGTCTCCAGCCAGT
GTGAGAAGCAAAGTGTGTCCAGCTGCCATAGTGAGAAAGGGGAAGCTCATGGGGAGATTT
GTGGGAGACTGTTGCCCCTGTATCTGTATCTAAGTAGGAAGCCTGAGGCTTCTCTTGGTC
AGTAGGATCAATAGTTGGGATGCAGAGCTAGATATGGAGCTAGAACTTGCTGGGCAGCAG
GTGTCTGTCTGTCACCACGTCAGAGTAGGGTGACCTTCAGAGAATAGTGGCTGCTGCTTT
ACTTCTGGCTGCCAAATGGTATGTACTTTCTCTTTTGGTCAACTTCAAGTTGGAACCAAA
TAGGGGAGGGGATTCTGTCAAGCATAGTTCCCAGCTTAACCAAGTTGACACAGTACAAAC
CCCCCACAGTCTGCCCTTTCTCAACTTGGGATCACTACACACCACTTATAACCATATTTA
ATTTCCAAATACAGTAGCAAATTATGTTTCCACCTAACAAGATGCCACTATCCCTCATAC
AACAAAGACATACCAACCCTCTCCTCAAAAAAGAAACAAAGGCTACTTTATCCATCTCTG
GGTGATGTTTGTTCATTTTCTAGCTGAGTCACATTCACCCTCTGAGTCTCTGTGATTTAT
ATACAGAGATACAAGATTAACCTTATATTAGATCAGTGGTCTCAGATGGAGGCACTTTGC
TCCTCTAGGGAATATTTGGTAACAGCTGAAGACATTTTTGGTTGTCACCACTGGGGGTGG
GTGGGGAACGCAACTGGCATCTAATGATAGAAGCCAGGGAATCTGCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NATGGGTTTTGTTTTTTTTTGGTCTTAGTGGTAGAGTGCTGCTGTACACACCCGACATTG
TGACTTGGTTCGTCAGACAACACCCAGTTAATAATGAGTAGCTCATTTCACGTGGTAACT
TGGTGGCCCGTAGTCAAGTGTTCCGGTCAAAGCCAAAAAGTCTCAAAGAAGGATAATTAT
CTGCAGAGGAGGGTATGACTTTCTTCCAAAATACTAAAGTTCTGTACTGCGATTCACCTA
TGGGGGCCTGCCAAAGACTCCATGAAATATCCTTATCTGCCACAGTCACTTTAATTATCA
TCAGCTCTGCTGGGTCATGTGGCCCAAGTAATAGAGCAACCGTGGACTCCATTTAAAGAA
AGATTAAAAGTGTTTCTGTTTGTGCCCTCATCTAAGGGACATTTTCACTAGAGTGTGGCC
TCATGTGGTGCCATATGGCATATGCAGAGCCTTATGGGTTACCAAACCAAACCAAACCAA
ACCCATTGCTGTCGAGTCAATTCTGACTCACAGCGACTCTATAGGAGGGAGGAGAATGAC
CCCTTAAAGTTTCCAAGGAGTGGCTGGTGGACTCAAGCTGCTGCCCTTTTGGTTAGCAGT
CAAGCTCTTAACCACTATGCTACCAGGGCTCTTACGGGATACCGGTGGATATGTATTTCA
CCCAGAGTTGCTATATTTGCTTTTTGACATCCTTTAGTATAACTTCTGGGTTTAAAATAA
AATATTTGGATACATTTATCAGGAAATATGCTTTTACAAGAGCTTAAAAGAAAAGGAATT
TTTAAAATAACTTTCAGGGGAAGGATTTGCAAGCCAAAGATTTATAGATTGAATATGGGG
GCTGTCATGGATGAATTATATCCTCCAAAAATGTCTGTCAACATGGCTAAGCCAGATTCC
CAGTATTGTATGATTGTCTACCATTTTGTCATCTGATGTGATTTCCCTATGTGTTGTAAA
TCCTGTCACTATGATGTTAATGAGATGGATTAGCAGCAGTTTATATTGATGAGATCTATA
AACTAGATAGTCTCTCAAGCCAATCTCTTTTAAGATATAAAAGGGAGAAGCAGCAGAGAG
ACGGGGGGTGGCGGGGGGGGGCCGTATACCACCAAGAAAGCAATGTTGGGAGCAGAGCAT
GTCCTTTGGATCCAAATTTCCTTCACAGAGAAGCTCCTAGACCAAGGGAAGACTGATGAC
AAGGACCTTCTTCTAGAGCTGACAGAGAGCGAAAGGCTTCTCCTGGAGCCGATGCCCTAA
ATCTGGACTTGTAGCCTACTAGACTGTGAGAAAATAAAATTCTCTTTGTTAAGGCCATCC
ACTTGTGGTATTTGTTATAGCAGCACTAGATGACTAAGACGAGGGCAAAGGGCAGTATTT
CACTTATGAAATAACAATAGAGTTGCATAGCTTATTTTTTAAAAGAAATTTATGTTTGAA
CAAATGTATTATTCAATGTTTACCTAAATTTCATTTTGGGAAGTAAAATTAATGTTACTG
AATTTAATAACTCTTTAATGTAAAGAGTAACATGATTTCAGAGATCTATAATAGTTTTTA
ATCATTTCTTTCTTTGGAATTATTGCTTGAGTTAAAAAAAATTAGATTATTTTATGTGGG
TGCCATTGTACAAATTTCATTATCTTTATATTATTTATCATTAGTCTTATCTGCATTTTA
TGTTCCAGGAACAAAATAATTGCTGACTTTTCAAGTGGGAACTGGTAGATTTATATCACA
AAAAATATTTCTTGTACTTCTGGTATATAATTATAGATGAACAGGAAACACACAAACCTG
TTTAGAAGAAGGTATTATTTTGTGCTGACATAGCTCTTTTGACTTCGAGTGTCTTAGAAC
TGCCATCATTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCCTTTGAAATCTT
CTGTTCGGTTCTTTTACTTTATCAATTCTTCCTTTTGCTTTTGCAGCTCAATGTTCAACT
AGCAAGTTTCAGAGTCTCCTCTGACATCCATCTTGGTCTTTTCTTTCTTTCCTGTCTTTT
CAATGACCGTTTGCTTTCTTCATGGATGATGTCCTTGATGTCATTCCACAACTCGTCTGG
TCTTCGTTCACTAGTGTTCAATGCGTCAAATCTATTCTTCAGATGGTCTCTAGATTCAGG
TGGGATATGCTCAAGGTCATATTTTGGCTCTCGTGGACTTCCTCTGATTTTCTTCAGAAA
GAAAATCAGAGCAAGTCCACAAGAGGTTCTTGGCATAGAGGGAATAAAAACAAAAACTTT
TACCTGCGTCAGAAGTAAGAGAGATTTTGACAGCCTGTTTGTGCGTTCGTTTTATCTTTC
TCTTGAGGTTAAATCCCTACTGATCTTATGGTCATTCCATTGTAATTAGTTGCCCACAAG
TACGAGTATTCAGAAAGCATCAGTGCACCACGAAAAGTGCTATCAAGAAAAACCTGATTC
TTCCTCCTCTGTGCTGGAGGGAGCATCCTAAGACAACTTTCCCTTATGGCAGTCCAGATA
CCCAGCCCTCTTTTCTCTATTCACCTTTCCGTGCAGGTATAAAAAAGGAGATGAGGCCAA
CCTGTAGTTGTTGTTTTTTTTTTTATTTTAAGCTGTGGTTTACGGAAAGTTTACAGCTCA
AGCTAATTTTTCATACAAAAAATGTATAACACACACCTGTTATGTGACTCCTAGGTGGCA
ATCCCCTTTAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTATACATCCCTAGCTGAAGTAGGACAGTTCATCTT
TTTTTTACTGCAGGAAGATGAGATAGGACAGTGCACGCTAGTGGCAGTAGCGTCAGCGTT
TCCTATGTGCTATTTCTAAGCAGAAGCGTGTTAATAGGAAAGAACATCTGAGTACAGATC
ATAAACAATACAGATTAAATGTATAGGAAGAAAGTGTCCCATATTACCAATTGAATGCTT
GTATCTGTAGGAAAATGGATAACGAAATGGAGTTTATCGTTCTTTGCTGTGTTAAATCCG
TAGGTCCCAGATAGCCGGTTTCCTTTCCTAGGAGTTCACTTCACACCAAGAATGGATGGC
AATATTTGGCTAGGACCTAATGCAATTCTTGCCTTCAAACGTGAGGGTTACAAACCCTTT
GACTTCAGTGCCAGAGATGTTATGGATGTAATTGTCAATAGGTAAAGACTTTATTTACTT
ATAAATGATTTTAGGTGCTTATGTTTTTAACGTGGGAAATGTTGTTTTTCTTGGTATCCT
ACTTATTGGGTAAGTCTTTGTATTTGTGATTAGTATATTAAATTTTTTATTGGTAAAAAT
TAAGAGTTTTGTGAAAAAACTGTAATGTCTTAACTACTTCAAGAAAATTCTGATGAGCCA
GGGCAATGGCTTAGCTAAAAAGCATAAGACCAAGAACCTATCACGCATCTGACAATCCAA
ATCTTACATTGCTAACCTCCTAGTTGAAAAAAAGTATGAAATGGCTTACTTTGATAACAT
CATTTCAAGTCAGTCACCATCATTTTGTTAGCTACTGAATAAATTGCTGGTAACCAACGT
TGTTTTCTTTTGTGGAAAACTAACAATACTGTTGTGTTGACTTGGAATGCAAGTCATTAT
AAGAAATAATGAGGTATTTTGTTTGGTTATTCTAGTAGTGTTTCTCTCCTGAGGGTTTCA
CATCAAAATCACTGGAAAGTTTTTTAAGCTATACTTGGGTTTCACCCTCCAGAGATTCTG
AACAGAAGATTAAGGGAGGGGCTTCCCAGTGTGTGTGCTTGTAAAAATACATACATACCA
GTTGTCAAATTGATTCTGACTCATGGTGACCCCATGTGTGTCAGAGTAGAACGGTGCTCA
ATAGGGTTTTCTGTGGCTGATTTTTCAGAAGTAGATCCCAGGGCCTTTCTTTTGACAAGC
CTCTGGGTGGACTAAACCTCCAACCCTTTGGTTAGCAGCTGAGCACATTAACCATTGGCA
CCACCCAGGAACTCCACATACGTACATACACATATGTAAATAGGCTCCAGTAGGCTGTCC
AGATTCTCACTTTAGGCAAACTGCTAGAGTATTTTATCCCTGGCTGGCTAAAGAAAAGGA
AGGTGAATGTCCTTACTTGTTTAATGCTCTGACTTGATGATTTGTTAATGCCTTCTAGGT
GTTTTGAAAACACTTAATATTTGCATTAGAAAGCCTAAATGTTGGCAGGGTTAAAGAATC
CAGTCTGAAGCTAGCACTCCATGGGAATGCTTTCAAATTTGAGTTTGGAAGACATTGTTT
ACCTCTTGATTGGCCTTGTTTACCCCTCTCTTATTGGCTTAAAGTTTATTTTCTTTTTGT
ATATAGTTTTTCTAAGTTTGCCTAGATTTCTTTCAAGCCCTCCACCACCCCCAAATAAAT
AAATAATGGTTGTAAAAATGTCTTGTGGTGGCAAAAATTTATTTTCTCTTATCAAGATTT
TTTTCTTGATTTTCAGTGGATTGGTTAAGCTGGTGTTGGAGAATTTCTCCTATGGAGTTA
ATGAAATGTACAAGGCCTGTTTTCTCAGTGCAACAGTGAAGCACCTCCAGAAGTTCATCC
CTGAAATTACTGTCAGGGATATACTTAGGTAAGGAAGAAGCGGTAAGGATTGTAAATACA
GGCCTGACCTAGGTGAATGTGAAAGGTCAGTCTGACTTGGTTATTGGGAAACAATACTTT
TGGAGTCAACCAGTGTGTCCACTAAATTTTTGCTCCTTTTTCTTCCCCAACAAATTGTTG
AGTTCCCTTTGCAGCACATGTATTGCTATATCATGGCCCTTTTAGTGCATAAACTAGGTT
TATTTATAATTGGGAAACCCTGGTGGCCTATTGGTTAAGAGCTACAGCTGCTAACCAAAA
GGTCGGCAGTTCGAATCCACCAGGTGCTCCTTGGAAACCCTGTGGAGCAGTTCTACTCTG
TCCAATAGGGTTGCTATGAGTTAGAATTGACTTGACAGCAACGGGTTTGGTTTATTATTA
TTATTTATAATTAGACGACCTTACTGTGTTAAACTGAAATCTTCATTTGCAACTTTACTG
CAGTGATGTTAGGTCTTTACCTTTTTTTCTCTTACGTTAAAAACATCTTACCTAAATTTT
TTTTTTTATTAACCTTTATTGAGCTTCAAGTGAACGTTTACAAATCAAGTCAGACTGTCA
CATATAAGTTTGTATACACCTTACTCCGTACTCCCACTTGCTCTCCCCCTAATGAGTCAG
CCCTTCCATTCTCTCCTTTCGTGACAATTTTGCCAGCTTCCAACTCTCTCTATCCTCCCA
CCCCTCCTCTCATGATCAGGAGATGCCAACACAGTCTCAAGTGTCCACCTGATATAATTA
GCTCACTCTTCATCAGCATCTCTCTCCTACCCACTGTCCAGTCCCTTTCATGTCTGATGA
GTTGTCTTCAGGAATGGTTCCTGTCCTGGGCCAACAGAAGGTTTTTGGGGACCATGACCG
CCGGGATTCCTCTAGTCTCAGTCAGACCATTAAGTATGGTCTTTTTATGAGAATTTGGGG
TCTGCATCCCACTGATCTGCTGCTCCCTCAGGGGTTCTCTGTTGTGCTCCCTGTCAGGGC
AGTCAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1137, 8180..8295, 8974..9125, 20321..20452, 21488..21650, 37606..37640, 43612..43779, 52563..52720, 54016..54145
1001..1137, 8180..8295, 8974..9125, 20321..20452, 21488..21650, 37606..37640, 43612..43779, 52563..52720, 54016..54145
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved