Loxodonta_africana Locus ENSLAFG00000012948
snOPY snoRNA Orthological Gene Database
Loxodonta_africana ENSLAFG00000012948
Loxodonta_africana
ENSLAFG00000012948
GeneScaffold_6931
SNORA19
28026..28155
44458
TATTTAAACGTCTCTCAAATTCTAGGTATGCTAATTAATTTGGGAACACTAAAAGTGTT
AATCAATAGTAAAAGACTGTAGCAGAGAGCCTGTTATAAATGGATTTTTTTCACTAACAC
TCGCTTTCTTACATTCGTTTGTGACGTGCGCTCGGTAACAGCGACCACCCTCCCCTGTAT
TTGCAGACATTATGCAAATTTGTTCTGTTCCAAGGCTTTTGCTCTCTGCCAGATCGCTCT
GTCCATAGACCCTTCCCATCCTTCAGGTCTCACCTCAAATCGAGGTGACTCCGACTTTTT
TATTCTACCAAGATATGAAATAATCTTGCTTATTTGCTTACTTATTGCGTCCTCCCTTCC
CCGTGCTTGTTCCTCACGGGGCAGGGCAGTATCACTTCCCAGGGGTCAGTAGCTCAATAC
ATCCCGGTTAAACGAATTAAATTTAGCATTTCATTGAGCTAAGAGAACCCATTCCCTGGC
CGCAGGGAGCCTTATTTATTTTAACTTTGTATGACTGCAGAAATGACGTTAAAAATCAAT
CTGTGCAGACGCCTGCCTTTTCGCCAGGCAGAAACTCTGACCCAAATCTCACCTTTCCCA
CCCCGATTCTCGCTCAAGGAGAGGGAAGGGACCTGAAGCAGGTGCCTAACGCCACTCTGC
GAAGTCCGGAGGTAGCGCCGGAGCCCGCCGGCCTCGACTCCCAGCGCGCGCGGAGGACGC
GGCCACAGCCACATCAGCGGACGCGCGTGACGCCAGCGCGCCTGCGCGCGGGGAGGTGCG
GCGCGCGCACCGAGGCCCGCCCCTACATCCGGGGCCTGGGCGACCGCGGCGGCGCCGCTT
CGGGGTCACGTGGCTCCTTCTTTTCCGTCTCTGGCCGGCTGGGCGCGGGCGACTGCTGGC
GAGGCGCGTGGAGCCCTGCGCTGGTTCCCCTTCGTCTCCGCTCCCGGCCCCGGGCCGCTA
CGGAGTTCGCTGAGGCCGGGTGAGCTGAGCCTGCCGCCAAGATGCCGGCCTACTTCCAGA
GGCCGGAAAATGCCCTCAAACGCGCTAACGGTGAGTAGGGAATTGGGGCGGCCCGAGGCC
TCGGAGGTCGAAGAACCGGGCCTGCTTCCCGCTGCTCCGCCCGGGCTGCGGCCGGAGACG
AGGCCGACGCGGCCTGCCCGCCACCGACACCGCCGCGCCCGGGCAGGGTGTCCTCTTCTC
GAGCCAACCGACCGGGGGTGGGAGGCGCGGAGCCGGGAACCGTCGCTCCGGGGCCCTTCG
GCGCCCCCTCCGGCTGCTCCGCGGACACCGCGCTCCCGGAGACGGGCCCCGCTCGGGCTC
GACTTCCTTCCCCGCGTCGCCTGCGGCGGGGTCCGTGCGCCTCAGCCCGCGCCCCCGGCC
GCCATCTGGGAGTGCCGGGCCGGAGGAAACATGGCTCCCTCCCGGGGACAATGCACGCGA
GAGCCCCGGCTCCACCTCCCGCCGGCGCCGGGGGCCTGGCGGTGCCACCTCCGGCCCTCC
CTCAGACTCGGCTGCTCCCAGACCCCGCGGCGGACTGCGCTGGGGCGCGGTCCACTTAGC
TTCCCCCGGCCACTGTCTTCCCGACTCGGGGCGTCTGACCTACTTAACCTGGTTCTAGCT
TCCAGGTGAAGATTAGGGCCAGTTCCAAACTTCGGAATCGCAGGAAGTTGGAACAGAGTC
AGTACTGTTGAAGGGTTCACGTCCTCGCTTACAGACTGCGTCCTGAGGCCTAGGGAGGGA
GGATGGTTGGCCCAAGGAAGCTCCAGGACTTAGTTGTTGAGCCAGGAGAAGAAAACCAAG
GTCTCTTGACGTCCAGACCAGTCCCTTTTTCTCCAAAGCTCTGCTGCCTGGCGAGTTCTG
TTTTCATACGTGTAATTTAGCCGCGGCCGCTTGCGGGAAAACTTGTGTGTGTCCCGAAAT
TAATTTTCTTTTCCGGAGTTCAAGTCTCCATCTAGTCAGGAGGCATTTACGTTGCCATTA
TGGGGGTGCAAATGTATTTATGCACGTCTCTGCTCTTTTAAGAAAGTTCCTGTGTAGGGT
TGATTAATTTTTAGGCGTTCGGGCGTCCGTAGGGTTTATTTCCACTTTTCCCCACCCAGA
CAAGCTTCCGATCGCGTCCATGGCTATTGCGTGTTTCTTACAGTTTCATGAGTTTGTTTG
GAAATGCATCAGGTAAGAAGGTCAGTTTCAGTTAATAGGTAACACTGATACCTACTGATA
GATAATCTGTCAAGACAGATTTGTGTTGGTCACATGCTTGTTTGTTAATAGGCTAATCCC
ACAGACTATAAAATAGAATATTTGTTTAAAAAAAAAAACTACAATTTGAATCTGACTAGT
GGTCGTTCTAACCAGCGGCCTAATGGTTAGAACAGGCATGGAGTTTAAAGATGTCAATTT
ATAGGAGGTAAAGTAGATTTAAGTTAAAACTTAGCACTACAAAATTGTAGCAAAGCTTGA
ATTTTTTTTTTTTTTGGTGTTTTGAAATTCAGAAGGACATAAAAAATTTGTATGGTATAC
AGAATTACTTAGATGAAATTACTGCTCGACGTTGCTGTTGTAGATTTGTTTTACAGTACT
TTTTTTGTGTGCTTTACCAGCAGGTGTTCTCCACAGGCTGATAGATTGAAGCACTGTAAT
CTTAATGGCCTAAATATGACACATTTGGTGTGTTCAGGACATCTGCATTATTCCTCCTCT
TTGAATCTTATGAATTTAATATTTTAGTAACTTTTAAGTTAGGAGAGCTATATAATTTAT
GTAAAATCTTGTTCTATTGACTGCTTTTGAAAAGGACTTGTACAGCAAGTTGGGGAGAGT
GTCCAGAATTAAAGTAGGCAAGATGAGAAAAGGATATTTGTGTATTTGTGTAGCTTTTGT
TTTTTAAAATCTGTATTGACTCCTTTCCGCGGAAGAGATTCTTTTTTTTTTTTTTTTACC
TTCCAAGTGGTAAACTCTCCTGTCCCTTTGATCTTGTGAATGAGGGTTTCCTTTTCAAAG
TCTCAAGGTGAGCACATTGTGGGTGAAGAAATCATAAGGCACTGCTTATAAAACTTTAAA
ATGGGCTTATAAAAGTACATTTCATTCAGTGGAAATAATTTTATTAAATTATTATTTTTT
TTTAAATCTATAACATTTGTAACTCCAAGCATTTAGGCCCAAATTATTGCACTATCTTAA
TAAAATACAAATTTAAGTAGAATAGTCCTTAAAGCCTGTTTAAGTCTGTATATCAAAGCA
ATATTTCATAAAAAAGTTACAGTAATCATTCAGGAAGAGGAGAATTTGGCTCAGCAGTTA
CAGCAAACTCATACTCCACAATAAAATGAAGAAAGCTCCTTTTCTAGATTATATCCTTAG
TATTGCTGAAGAGCTGCTCCTGACCCTATAAAAACCTTTTAGTTTGTACCCTACAACTAG
TGATTTAAAAAATGATAAAGTTGTTATAAACCCCACAAATAGAGTAATGTTATAGCTTAT
TTACTTTGTCTGTTGCACTATTAGTAAACTAATAGATGAGAATGGCTGGCTTACCTATAC
TTTTTTTTCTTATGGATACATAGTTTCAGTTATTGTATCTGAAAGGTAAATCAGAATGCC
CACAGTCCCAGTAAAAAAAAACTAGTAAACTGTAATTCCAGATTTAAATTTTTTGTTTGA
AGACTATCAATCTGGAAATCAGTGTTTCCTAAAAATATTGGAATAGGGTCTTTAGTGTAT
GTATGATAGTTTTTTTCTGGCCTCAAAAACTTTTCTTTCCTTCTAATTAGATAATTCTGA
GGAATTTAATCTCCTTATATGTCAATTAGGATAAAGACAGAAGACTCAAATCATGGATTA
TTGTGATTAGTTTTTAGGCAGATTTTCAGTGAGCTGAATTACTGAATTTATTTACCATTT
TCATATGTATTGCTCATATTTGAACAATATATTCCCATTGCATATTCTTTTTAAAAAGAT
ATCCTTGCCTGATATCCAAATTTCCATTTAAAAAAAATTTTTTTTTATTGAGGGGGCTTT
ATCTTAAAAATTTTTTTTTAACATGTTTGGTTTAACTTTTTTGAACCTGTTCTTTCAACG
TTTGAAAGTATGGTATTTGGAATCGTAAATTTTGATTGGTTGTTTAGGTAGTGAAAAACA
CTTTATCTCTACCCTCCAAAAAGACATTTTATTTTGTAGAATGACATTGAGAAACCACAC
TTCTGTCACTTTTGAAAATAAGAGATTGGGAAAGTGAATTATTTTTAGACAGTTTTGTAC
TTGGCATCATTCCCTGCTAGGACCTGCTCAGCTTGAACTCGGTTTGTGCCTGTCTCGTCT
TGCAAGCATGTTGACCATATGTAGTAGTACAAGATTTAAACCCTTAATGTGGGTTTGGGA
GTTGAATATGATGTGTCTTTTTAGTGTCGCTGTTGTGATTTTCTCAATGTAAAAGATGAA
TTCAATAAAAAGCCTTTACTTCCAAAATTTTGGCTAATAAAGATTGTTTTTGTTAAATAA
CTGTGAAAAACACCTAAAATATGTAGGGTTGTAGGAAATAGCCTTGTGGGCACTCGAGGA
AGAAAATAGGAAGGACGCACTGTAAAAGAAACAAACAAAAAAGTTGTCATTGAGTTGATT
CTGACTCATGGTGACCCTATAGGACGGAGTAAAACTACCCCATAAGGTTCCCAGGGAGTG
GCTGATGGATTCCAACTGCAGACCTTTTGGTTAACAGCTAAACGCTTAACCACTGTGCCA
CCAAGGCTCCACCTTAAAACAGGAAACGTTTATTATTTCAAGAAAAGTATCTAGTTGTAT
TACATTTTTGGTTTGTATAGTAGGATTTTTTTCTTTGTAGTGAGATAGATTCAATCGAAG
GTGGACTACAGTATTTCTCCTATGATGGCCGAATTATGAGATTATTAACTTGCAGTATTG
AAAAGAGTCTGATTTTCATTTTCATGTGAAGGATATGATTTGATACTATGAGGGGTGACC
TAGAGTATTAAGTGATGATACCAAATATTCAGTATGTTGTTTGTGATTTATCCTGTTGCA
CATTGTTTGAAATACTGCATGTGGTTTCCCTAGAGAAAGGAATGTTGGGAAGCAACATTC
CTGGAAGATGTGACAGTTGAAATAAGAAATTTTAGAAAGAGAATTACTAAATCTGTAGAT
GGAGTAAAGCCCCCAAATAAGGGATGTTTTTGCTTAGCAGTTAGGTGATAGTTATTAGGT
AGATACATTATTAGGTTAACTCGTAAAGTAAAAGTAGTCTTTGTCCAAGATTGTTTTTCT
TCTTAGGAAGAAAATAAACAATGACTTTTAAAAATGGAGATATAGTGTTTTAAAACATTT
TTATAATATAAACTAGGATTGTAGTTCCCGCAGTTTATTTTTCATATGTGTAATAGAAAG
ATTTTTGTGTGAAATTTTGACAGTCATTTCAAGTTGGATTTAAGTGGATGACTTAGGTTA
AATAACTTTTAGCTTTAAAAAAAAAGGTATTTTTAAAAAGTATATATATAGCCTGTAAAA
TGTTTGTAAAAAAGAATAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTAATATTAACTAAAGTCCATACTTTTTTCAGTTTCT
CATATGTCTTATTCTTTTCCAGAGTCCAATCCAGAATATGCAACATGATATAGTCATGTC
TCCATTAGTTTTCTCGTTGTTGTTACAGTTTCTCAGACTTTGCTTGTTTTTGCTGACCTT
CACAGTTCTGAGGAGTGCTGGTCAGGTATTTTGTAGAATGTCCCTCGATTGGATTTTGTC
TTATTTTTCTCGTGATTAGATCAGGGTAAGAAGTTTTCCTGTCCATGAATTGGAAGACTC
AGTATTTTAAGATACCTTTGGGTTATTTATCTTTAGATTCAGTGCAATCCCAGTCAGAGT
TGCAGTAAGGTATTTTGTAGATAGGGGCAAACTGATTCTAAAGTTATGTGGAAAGGGAAA
GGACCTAGAATAGGCAACACAAGACTGTGGAGAACAACAACAAAATTGGAAGGCTCAAAC
TACCTGGTTTCAAGACATAAGTCTACAGGTAATCAAGACAGCATGGTATTGGTGAAAGCT
GACAATTAGATCAGTGGATTAGTATAGAGAGCCCAGAAGTAGTCCCACACCAGTATGGCC
AGCTGATCTTTGACAGCAGAGCAAAGGCAATCTGTATGCTTTTTTGACTCAAGATACAGC
CAAGAGCTAGTAAAAATTTCGTTAGCCAAATCAGTAAGACTATTTAGAGGGGGGAATTTT
CTCTTGTGACTTCAATTTCTGGGGTTTTTAAATCACTGCATAAGGTTGATGAGTGGAATT
GGGTGGAATCCAGTTTAACCTGTAGACAATATTTCAAACACTACCAGCTTTCTCCTTGGA
TCACTATGGCGTAACTTTAGAAGTAAACAATAAGTGTGATCTAAAAATAAGGTGGTAATG
AGCTTAGAAATTGAAGTAGTTAAAAAAAGGAAAGTTCGGACTTTTGTGTATTGTGTAACC
AATTTTAATTCCCTTGAATTACCTTTTCAGAGTTTCTCGAAGTTGGCAAAAAACAACCTG
CTTTGGATGTTCTTTATGATGTTATGAAAAGTAAGAAACATCGAACATGGCAAAAGATAC
ACGAGCCAATTATGTTGAAATACTTGGAGCTTTGCGTCGATCTTCGCAAGAGCCACCTTG
CAAAGGAGGGATTATACCAATATAAGAATATTTGTCAACATGTAAGAAGAGGAAAATGGA
GTTTTATATTTTTTAATAAGTGTTTCAAATAATTTTTTGGGAGGGGGTTACCTTTCAGAA
TTTTATTGAGCTAATAAGAGTCTTGCTTCTTTAAGCATTTTTTCATTGGGTTGGAAAAGT
GCTTTAAAGTTTTTTATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTCAGGACCGTACTGACAGATTACTTTGACTCCATGAGTTAATTCCTGTGGGAATCAT
ACAGGCAGTGTCTGGATCTTCTTCGAAACAATTCCAGAGTGGGAGCGTCTCTACCACGAT
ATCGCCCAGCAAGGTAAACGAGAGCATGAACTCTGAGTAAACTGAGTTGAAAAGCTGATT
TAGAAATAGACTTTGCAGAAGAACACTTATTAAAGTTGAGTAAAACCTTTTCTCTGTAGT
ACTTCAAAAACGAACTAGTTTTTACCCCTATTGAAAGATTTATTTTAGTTTAACTAGTAA
ACAATTTTCTTAACTAGTAAAATAATTTCTTAATCACTTATTTGGATTTATAAATAAATA
AGCATTTTATTAAAATGTTAATATAAGTATGTATAAATATTACATCATTATAAATTACTA
AATAAGAAATTATCTTATTAGTTAAGGTAGTTCTGTATAAAATTTACTCCAGTAATGTTT
GAGGGGTCTTTTAAAATTCTTGAGAATTTTCCAGGCTACTGAAAAAGTAAAACTCAACCT
TCTGATTTCTCTCTGGTAAACTGAAGTTCTGCTTTTACCTCCACTGCGTATCCTTGGCAG
GCTGCTTACTGTGTGTGCACTGTCTGTCTCCAAGGTCTCTTTAAGCTCTAGACTTAGAAC
CTTCTGTGGAAAGTGCATATTTTTCCTGTTTTAAATAGTATTACGGAATATAAAACTAAG
CCTTCTTCATGACTCAGGATCATCATCGTGAACATCCAGTTATGATACTGTGTTCAATAC
TTGGAATCTATGAAGGATGGCATTGGAAGTCTGTTTTTCTAACTTTGTCTCTCTCTTTCC
TTTGCTGTCACTTGATACTGTTTCCCGTCGTCAGAGTAGCTCCTAAACTGTGTGTGACTA
GGCAGAACTGTTTGAAACAGAGTAGCTCTCTGCTTTTTTTCTGCTTTGGCCTTCGCACAA
GCTCCTGTGCCCAGTCTCGCTAATACAAACACGACTGACATTAGTTCAGTCAAGTTTTAA
ATGACTTTTTGTGACTAAAAATATTTTACTAGGAATATCAGAGCCTGTGTTCTGTTTTGC
TTCCATGGCTAGTATATGTGAATTTTTCACTTAGTGCAAGTAAGCCTGGGCTTTTTGATA
ACTATTGATGGATTGACTTAAACTGCATCCCTTTGTTTTAAGCCTGTTGAAATAGAAATA
CCTGGGGGGGGGCGGAGAAGAACAAAGGAGCAACTAGCGTTAGGCATTTCACAGCGTTAG
CAGGGAGCATTAATGACCGACCAAGTAGTTCGTACACACATCCATAACACAGTTGAAATC
AGGTTACCACAAGCTCTCAGTTTGTGTTACACACTGGTAATTAGTACAAAACATGTCACT
GTATTTAAGACTAGAATTTTCCGCAGTTTTAGGATTTGAAAGGGTGGGTCCTAGTAAGAG
GAGTCTTTCCTAAACCAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCAGTGCGTTTACAATTGCCCAGTGTTGCTAGTAGCACTGTCAGTGTCGTGCGTGGA
CTGGCGCTACTCTGGGAGCTGTTACTGGTCCATGATGAGACACCTACAGATGTGAATAAA
CACTTAGAAAAATTTCCTAGTAATTTTATGTCTGTTTAATAAAAAATTTGAGCTCGTCTT
TTTTTTTTTTTTTTTCCATATTTTGGTGTTTTATTGAAAGTACTGGTTGGCTACATGTTG
GAAATTAAAGACAAAAACAAAACTTACCTCAACTACAGTTAGTTTGAGAAGTGCTGCACT
AGGTAATCTCCTAGACCTCTCAGCATTGCTTTGAGTTAGTATATATGCATCGTGACTGTC
ATACATGGGAGTTCTACTTGCTTTTTTCCTTCAGAATCTCACAAAGACTTTGACATGATT
TAGTAGCCATATAACTTGAAGCTCATATGTATCTGACACAAAAAGTCTAATTAAAATTAC
AGAGGAGGAACTAAAAATTGATATTCTTCAGCCAAGTGAAAACAGGATTTGATATTTTCC
ATTCTCTCCCCATGATATTTTCCTTTTGTGTAGGGACACCCATCTTAAAATACTACCTGA
TGAACTAAAAGAGGAAAAAACCTTCTGTAGAAGACAAGTAAACATGCTCATTATAGAAAA
AAATGGATGTGTGAAAAGAAGAAAATTTTCATCTACTATCTCATCACTCAGAAATAACCA
GTATAAATTCTCTTCTACATCCATCCAGATTTATTCTTACGTATATTTTCCCAAGTGGTA
TGATAGCATGCACTTTTTTAAAACAAGTTTATCTACTTCACAGTACTCCCTAAAAAAATT
AGAGTTTGAGGATTTAGTGTTTTTGGAATAATGGCAGTTTTGTGAAGTAATCTATAAAAT
GGATTAAAAAGAACCACACACGAAGGCATTTTATTTTCTACTTTTCATTTTCTTAACTGT
TTCGTACAAAGATTTGAATTAGATTTTTTGTTCGTTTGTTCATTTAAAAGGCAATGACTG
TAATTTATACTAATTTTAGGAAGCATTCAAAGCTGTGGAAGATATTCATGGGCTATTCTC
CTTGTCTAAAAAGCCACCTAAACCTCAGTTGATGGCAAATTACTATAACAAAGTCTCAAC
TGTGTTTTGGAAATCTGGAAATGCTCTTTTTCATGCATCCACACTCCATCGTCTTTATCA
CCTGTCTAGAGAAATGAGAAAGAATCTTACACAGGAAGAGATGCAGAGGTAAGAATGTTA
CAGTTGGATAGGGCTAAACTTACCAAACCGATAGATTTTCCGCTAAATGGTGTGGTAGTA
TGTTCTAGGTCAGGGTTTCTGGAACTCAGCCTCTGGGCATTTTGAGTGATCATCTGTATG
AGGGGCTATCCGTGTGTGTAGCTGTTCACAGCATCCCTTCTTCATACTAGATGCCAGTAT
TAAGTAGCCCCCTAGTTGTGACAGCCAAACATGTTTCCACAGGGTATTATTTTTTTGGCA
CATTCTTGTTTTCAGTAGCTGTCTTTTGTCCAATAATTAATACCACAAAAAGACCAATTG
AGAAAATTAATTGAAATTTAGGAAAGACAGTGTTATGGTGTAAGCTTCCTGTCCCCATCC
AGATATTTAGAGTCTGTTTTTAGACCAAACTAGACAGTTGAGAAGATATTTACTCTCATC
CAATCACTTTTTCTGTATACAATATTAACTGTGGAGCATTTGGGAGATGAATGTGTGTGT
GTGTGTCTATATAAGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACTTTGATGATGCAGTGGA
GACTTGGGCTAAAGGAAGTATAGACTATCCCAGGAAGAGGAGGAATGGTAGACAAGAAGG
TTCATTGCTCAGGGGGCTGTGCCAAAGCTAATCTAGGTGAAATATGTGGGAGGTGATGGG
TGATGAGGTGCAGAAAGAAGGCCAGGTAGGTGTAGGCCTGGCCCTGGACAACTAGGATAC
TTCCAAGTTTTTTCTCTTTTATACTTTAATTTTCTTAATCAGGGCTTTGCAGTATAATTG
TGTGTGGAGTGTACTTTTTAAAAGGCACATTTCCAGATTTCACCCACCAGACCTGCTGAA
TCAGTTGAAGAATGTGGAGCCTTAGATACGTATATTTTTACAGTGTTCCATATTGATGGG
ATCTTTCACTCAGCGGAAATCGTATCGAGTGTTCATAGGCAAGTTATACTGAAGTGGAGA
GTTTACATTCTAGGGATTCTGGTTCACAATAACCTGACTTAGTGCTTATTGCAATAATCA
CCTCCAGCAAATTACATTGGAACAAGAGAAAAGGGACAAGTGCAGGAGAAAAGTCCTAAG
GAAAGCCAACTTGGCTTAATGAAATTTGAGCATTAACAGTCCCTAACTGGTGAATAGAGC
AACTAAAGAAATGCCAGAGAGAGAATAGGAAGGAGAGCTCCCTTTTAAGTAATGGGAGCA
TGGACTCTGAGATAACACCTGTAGACATTCTGGAAAAAGTCAGATAGAAGGCCTTACTTT
GCTGGAAGAATCAGTCATTTAAGGTAAGAACTATGTAGGTAGTGCCCAACTTGTGACGTG
TTCGATTGAGTATGACGAACCGCACTTGAACTGTGTATTTCGTACGTGTTATTGTTGGTG
ATGTGTACTACGTACTGTCACGGTGCATAATTTGCTGCAGTTGTCGTTATTCTGGTAATG
TTTCCCAGTCCCCAAAGACAAAAGATTGGGTTATAATACAAGGACAGTAATGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAACTTAGGATGGAGTT
GTCAGAACAGAATCTCGTCGTGAGTTCAGCTTGGTGTGCTTTCGGACAAATATTTTAAGG
GACAGACTTAAGATTAAATGTAACAAAAAGCAAGAGCAGTGTCTTTGGGAAGACGTTTTA
TTAGCAAATGTATTGAAACACATGTTTTTTTTAAAGCCAAAAAGAAATGCCCCAAGCTGG
AAGTATACCCTGCACTTGAACCTATGTCTCAGCACACCACCCCACACCTTGATAAAGTTG
GTCTGTTCTTTAGCTGACTCAAGGATCAGTGTTAGAGAGTATTGGACCAGCAATCAATAA
TCTAGATTTGGATTCTACGTGCCCATAGCTGATGTAGAAGTTTAAAAGAAGGCTATAGGC
TGGTGTCAGGTGACTAGATTAGCTGGCTGCTAAGAGGCATTTATATAATGGTGAGTTCAC
CCTACGTTTAGGGTCAAGATGTGAGTTCTGGGTTCACGTGACTGAACTTGTGAGCGCAGA
GATGGATTCCGCACCTCAGGAGCACATGTAACTTTTATCAGTCTAACCTATCTTACCATA
GTCCTTATTTGGAGGGGGAGCTAAGTGGAGAATCTTAAATTATTTGCTTGGTGGGAATGA
AATCAGAGCTAGGGGAGTTTCATTTGAGTGCTTACACCCATCTTACTTTAATAAAGACTT
AAGGACCCTTATGGGGCGTGTATTCAAATATTTAGGACATCAGTCATACACCCATTTTGC
ATTGGGGTTAAACTTAGACTAGTGTGCTCAGGCCTGCGGGTATCCTCCTCTCTTGGGGCT
GAGCTCTGCCGGAGCATGCTTCAGTCTCTGAGCCAGCCTGTGTTGGTACAGGCTGTCCTT
TCAGTCAAGTCTCACTCCGGCCCAGCAGTTACTCTGACCTTGGGTCAGTACTCTAACATG
CGAAGGATCAAGGCCAGATGCCCTGCATGTTCTAGGGTGAAGCACAGGCAAGAGAGGATT
TGGCTCTGGGGTGTTGTTGGCTTCATAAGATTATTCCACTCTTGTCTCCCTTGTAAGAAA
AGTTAAATAAGTGTAATCTTTATTGTGGAAGGAAGTTGAGTTTTATTCAAATGCAAATTT
AAAAACTTTATTGAGTATAACAGAGTACAAATCATGAATGTAGTTTGGCAAATTCTTACA
AAAGGCCCCTTCCAGTGACCTCCCTAATACTCCCCCAGGATAACCACATCCTGACTTTCT
AATACTGCGGATTAGTTTTTGCCTATTTGTGTATTATAGATAAAACTTAAATTTTATGTA
AATGGGATGATAATGTGAACTCCTTTTGCTCACCAGTATGTGCGTAAAAATTACACACGT
TTTATGTAGGTGCTCTTTGATGTTTTTGTATATTGCTTGAAGGTGCCACTGTTTATCCTG
TTGATTAGCATTTAGGTGGTTTCCAGTTTCTGGCTATTATAAATAATACTGCTATATTTT
ATGTGTATATATATATGTGTGTATGTGTAGATATATACACACACACACATAAAAGTAGTT
TGTAAATTCTGGTATTTGTTTTTGGTAATAAATTAGTCTACACAGGCCATAGGAGATGTC
TTTGTGAGTATTGTGTTGATTTAGAGTTTTTATTTAAGTTCTTGCAAGGCTTTTCTCTAT
AGGTAGATGAGTAATTTGGGGCAAGAGGTTGAATGTAGCAGTGCTTTGGATTCCTCTTTG
GTAAATTTAAAGGGGCTTGAGATTAGACAATCTTTAACTTTCTAGATTTCAAGCCTATAA
TTTTCTTTGTACTGAATTCAGTATCCCAGTTTGAAAATTTCCTTTAACAATTATACCTTT
TGTTTATTGTAGGTCAGATTCAATGTACTACAGTATGTTGTCCCAGAAGTTAAAGATCTT
TACAATTGGCTGGAGGTAGAATTTAATCCACTAAAACTCTGTGAGAGANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTAAGAAAGTTAAATAAGTGTAATCTTTATTGTGGAAGGAAGTTGAGTTTTATTC
AAATGCAAATTTAAAAACTTTATTGAGTATAACAGAGTACAAATCATGAATGTAGTTTGG
CAAATTCTCAAAAGGCCCCTTCCAGTGACCTCCCTAATACTCCCCCAGGATAACCACATC
CTGACTTTCTAATACTGCGGATTAGTTTTTGCCTATTTGTGTATTATAGATAAAACTTAA
ATTTTATGTAAATGGGATGATAATGTGAACTCCTTTTGCTCACCAGTATGTGCGTAAAAA
TTACACACGTTTTATGTAGGTGCTCTTTGATGTTTTTGTATATTGCTTGAAGGTGCCACT
GTTTATCCTGTTGATTAGCATTTAGGTGGTTTCCAGTTTCTGGCTATTATAAATAATACT
GCTATATTTTATGTGTATATATATATGTGTGTATGTGTAGATATATACACACACACACAT
AAAAGTAGTTTGTAAATTCTGGTATTTGTTTTTGGTAATAAATTAGTCTACACAGGCCAT
AGGAGATGTCTTTGTGAGTATTGTGTTGATTTAGAGTTTTTATTTAAGTTCTTGCAAGGC
TTTTCTCTATAGGTAGATGAGTAATTTGGGGCAAGAGGTTGAATGTAGCAGTGCTTTGGA
TTCCTCTTTGGTAAATTTAAAGGGGCTTGAGATTAGACAATCTTTAACTTTCTAGATTTC
AAGCCTATAATTTTCTTTGTACTGAATTCAGTATCCCAGTTGAAAATTTCCTTTAACAAT
TATACTTTTGTTTATGTAGGTCAGATTCAATGTACTACAGTATGTTGTCCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTTTATATGTAAACGGTTTTCATTGTATAA
GTGGACAACGATTTATTTATTCAGACACTATTGATAAAAGTCTGTTTCCGTGTTTTATTA
TAAAAGTAGCAGTCAGCATCTTCTGTACATGTATCTTTGCATGCGTCTGTGACTCTGTAG
TGTGAGAAGTGGATTAGCCACAGAGTTTACATACCTAAAGCTTTAATAGCCATTGGAGAT
TCAATTCATGGTCCCTCCCACCAACAGTCAATTAGAGAGCCTTCTAACACCAAGTATTAC
CAATCTTTTAACATATTTTATTCCTGCTTCTTAAGTAAGTTTAAATGTTATTTATAATAT
GGCTTAAATGTTTCTGTTCTGGCTTCTCTTTGTTTCATTCTTGGGGGCCTCTTTTGTGTT
GCATTTGTGCACATTTCACTGACCTGCTTTCTTTTATATTTGTGAGCAGTGTTATTTCTT
TTGTGCTATACAAATAGTTGAAGGTTAATTAGCAGTATAACTAAGTAGTAATGCTGCCAG
TCTCCTTCAGACAAACGAAATTTGATAACAAATGCTCAGATGAATTAGTTAAGCAGCAGG
TTTTTATCTATAAATATGTTATCATTTAGGCTTCTTATTTTACTAAACTGGGATGAGAAA
AGCTTATTTGAGGAATGGTGTAATGTGCTGCTTCAAAGCAGGGCTTTGGAATAGATAGCC
TTGAATTAGAACTCTAGCTCTAGTAATATACCGTTAAACAAATCCTCTGAGCTTCATTTT
TTTCCCCTGATGAATGGGCATAATTTCCCCTTCTTAGGGCTGTCGTGAGTCTGCACGTAG
AAGCTGCTGAATAAATGGCAGCGACTAGTGTTAACCTTGTGTTTTTTACGCAGGTGGCAC
AAATTTATCAGAGCATTGTAGTTTTCTCGTTTGACTTCTCTGGTTCCTTTTGTTGATGCT
TTCCAACTGGAACGGGCCATAGTAGATGCAGCCAGGCACTGTGACCTGCAGGTATGTGCT
GTAAGGGACACTGAGGTGTGGAAGGCTTTTGAGGATGGGAAAGTCAGATGTCCTTTGTTT
CTTAGCTTTTGGTACAGTGGCACTCTTAAACCTTTACTGAAAAGATCTTCTAAAAGATTG
GCTTATCTTTTTCTCAGCTAGAAGTTATTTTGTGGAATGACTTCATGTTTGCATGCAGGT
TTACCTGCTGACGATAATTTCTTTCAATTTTCAAAGGTTCGTATTGACCACTCTTCTCGG
ACCCTTAGTTTTGGATCTGATTTGAATTATGCTACTCGAGAAGATGCTCCGCTTGGTCCT
CATCTGCAAAGCATGCCTTCAGAACAGATAAGAAATCAGCTGACAGCCATGTCCTCAGTA
CTTGCCAAAGCGCTTGAAGTTATTAAGCCAGCCCATATTCTGGTAGGCATCTATGGGGTA
TATGAACTATAGGAATTTTTGAGGGATTCTTAGGTCATGTCTTTCACAAAAAGGTTTGAG
GTGATGTCTGAGAGAAGGGATTTATATGTTTTCTATTTGGTTATGCTTGGTAGTTATTTT
TGTCAAATGTTGTTGTCAGATATGTGGATTATTGAGCTACGGTCCATGAAATAAATCACA
GATAATGTAGTAAAATATGGATACCAAAACTAAAAACCCGTTAACCATTGAGTCAGTTTT
GACTCATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTGCCTGGTGG
ATTTGAACTGCTGACCTTTTGGTTAGCGGCTGTAGCTCATAATCGCCATGCTACCAGGGT
TTCCAAAATAGGGGTAGTGCTACATAAAACAGCAGGCTGTACGCGTCATGTTCCCCAGAA
TAATTAAAAGTATTACCATTGATGGGGCTTTTTCTCTCTGCTAAAGTTCTTCTCTTGTTT
GGCTTAAACACTTTAAAGTAGATTTGGGGTAGAGAAAAGTTGACTTACCAGTAAAGATTC
TCCAGCTTCATGGCTGTTAAAAGATTGACTAGGAGTAGCACCACAGTATTGGGTATAAGG
AACTAGTAGCTCGAATAATGTCATTTTCCATTATTAAATGCAAATACAGTAGAGTAACAT
ATATGTTTGTACATTTTGTTAATTTTTGAGAGGCTTTAATATACTATATGCTATGTAACT
TTTAATGCATTTTTTAAATTTGTTTGTTTTTGAAGCAAGAGAAGGAAGAACAGCATCAGT
TAGCTGTTAACGCATACCTAAAAAATTCACGAAAAGAACATCAACGTATCCTGGCTCGCC
GTCAGACAATTGAGGAAAGGAAAGAACGGCTTGAGAGTCTGAATATTCAGCGTGAGAAAG
AAGAGTTGGAGCAGAGGGAAGCTGAACTCCAGAAAGTACGGAAGGCTGAAGAAGAGAGAC
TGCGACAGGAGGCTAAGGAGAGAGAGAAGGAGCGTATTTTACAGGAACACGAACAAATTA
AGAAGAAAACCGTTCGTGAGCGTTTGGAGCAGATAAAGAAAACGGAACTAGGTGCCAAAG
CATTCAAAGATATCGATATTGAAGTACGTAGCATATGTCCGCTCATTAAATTGTTCATTT
TATCCAGGTCTTTTGTAATCTTAGAGCCGGAGTTCTTTACCGTTTACCGATTTATTGTGG
ATTACTGGGTTATTTTAGCAGTGTACAGCTGGGTCATTAACTAAATCTGTGAGTACACAT
TTGTTTTTTAATTGTTCTGTGAACTTTTTAGTCACTGCATTCATTGTGTCAGTTGAGTTT
AGGTAGATACCATGTTTATTGCAGAGTGGAGGGAGAGGTAGATGTTAAGATTGTGTATTT
TTCCCTGTTGTCTAAATTGACACTCATTAAAGAAAAGTAATTTAGGACCTGATTCTAGGA
AGCTGCTGTGTTGACTTTTATATTCTCATTAAAGATGGTGCATGTTTTTTTCAGGACCTC
GAAGAATTGGATCCAGATTTCATTATGGCCAAACAGGTTGAACAACTGGAGAAAGAAAAG
AAGGAACTCCAAGAACGCCTAAAGAATCAAGAAAAGAAGGTAAATGAATAGACTGGTAAA
TTTTTAAGGAAAAAACGAATACACTTTATTTTTCAGAGAAGTTTTAGTTTGCGGAAAAGT
TAAATAGAAAGTTCAGGGTTCCCACAAACCCTTCTCCCTCCTGCACATAGTTTCTTTTAT
TATTAATACATCCTGCTTTGGTGTGTTACGTTTGTTAGCACTGATAACCAGTATTGATAT
GCTGTTAGCTAAAGTCCCTGGTTCACATTAGAGTTCACTTTGTGTTGTACAGTCATGATG
TCATGTATCCACTGTTACAGTGTCCTGCAGAATAGTTTCACCACCTTTAAAATGCCTTGT
GCTTCACCCGTTCATCACTCACTCCCTCCCCCTGAACACCTGGCAGCCACTGAACTTTTT
TATTCTCTCTCTAGTTTTGCCTTTTCCAGAATGTCATAGAATTGGAATCATGGAGTGTGT
AGTTTGTTCAGACTAGCTTCTTTAATTCGCAATATGTATTAAGGCTTTTCTGTCTTGTCA
TAGCTTGATAGCCCTTTTTTTTTCCCCTGAATAATACTCCATCGTATGGGTGTATCACAG
CTTATGTATTCACCTATTGAAGCACATCTTGGCAGCTTCCAGCTTTTGGCAATTATGAAT
AAAGCCATTAAAAATACAAACATAGGTAGATTTATGTGTGGACAGCTTTAAATTTATTTG
GGTAATACATAGTAGTGTGACTGCTGGATCATCGGTGGTAAGCCTGTATGTTTAGCTTTG
TAAAAAACTGCCAGACTATCCCAAAGTGGTCATACCGTTTTGCATGTCTACCAGCGATGA
ATTTGAGAGTGTCTGTTCTTCCACATCCTCGCTGGCCTTGGGTGTTGTCGGTGTTTTGTG
TTTTAACCATTCTAATAAGTGTGTAGTGGTATCTGGTTTTTATTTGCGGTTCCTTAATGA
CATACAGTGTTGAACATGTATTCATATGCTTATATGCCATCTTTGTACCATTGGTGAGGG
TCTGTTCAGTGCTTTTGCCCATTTTCATTTGTATTGTTTGTTTCCTTTTTCTTGAAAGTC
CTTTATCAGATGTGTGTTTTGCAAATTTTTTTTCAGAGTCTGGTTTGTTTATATCTCTTA
AAAAAAAAAATCTCTTAAGACTGGTTAATTTTTTTTGTTTGTTTGTTTTCAGATTGACTA
TTTTGAAAGAGCTAAACGTTTGGAAGAAATTCCTTTGATAAAGAGTGCTTACGAAGAACA
GAGAATTAAAGACATGGATCTGTGGGAACAGCAAGAAGAAGAAAGAGTAAGTTTTTCATT
TAATTGTAGTATTTCTAGATTGTAAGCGATAATTAAATTTTCTGCCAGTAATGGGACTGG
GTTTCAAAATTTGTTTTCTGGTGCTCTAGTGACTGTGTATAAATTTTCACAGAGATTGAA
AATGAACCTTATAAATACAAATGACAGCTAAACAGCTCATTTTTAAAGCAGTTTTATTGA
GATATTTACATACCATACAACTCACCACTTAAAGTGTGCAACTCGTGATTTTTAGAATAC
AAAGGTGTGCAGCTATCACTCAATCTAATTTTAGAACATTTTCATCACACCAAAAAGAAA
CTGTATCCATTAACAGTCTCTCCCCACTTCCCATCTCTACGCCCCTCAGCCACTAGGCAA
TGACTAATCTATTTTCTATACATAGATTTGCCAATTCTGGACATTTCATTTAATGGAATC
CTGCAGGATGTGGTGTTTTGTGACTGTGCAGCTAATTTTATAATTCTGTCGTTTTGTGTT
ACATTTACCTGGTGATACCAAAACAGGGTTTGCAGATGCCTGCAGAGGCCAATTGTGTAA
CAAAAATGAGTGAGCTGATCCTGTTTGGAAAACAAACAGGTAACCACAGGCAGGAGGGAG
CACGCACCTGTGGAGACCTGTGTGGAGAATGCAGCCCGTTTTTTGTTTCCACCTGATTGT
TGCCTCTGAGGGGTCTGGAACAGGAAGTGTTGGCTGTTCTTCCAGTTTTTTAAAGAAGTT
GGACACGTTATGCTGACTCTGAATGTATGTCAATACTGTGAACGTATTAGAGGAAGGAAA
GTGCTGCAAATCATGTGAAGTAGCTGGGGTGATCTGCTGCAGCCTCTGCCCTGGGGAATT
CTGCTTTTTCACTTGGGCCCCAAAAGGAAAAGCCACCTGCCTTGACCTCCAGTTGTTTTT
GATGAAGAAGAAATGTAATTACACCGCACACCATGTGGTAAGGTCCCTGAGTGGCACAAA
TAGTTTGTGCTTGACTGTGAACCTCAAGATTGGTGGTTTGAACCCACCTGGTGGTACAGC
AGAAGAAAAGGCCTGGCGATCTGTTAAGGTTACAGCCAATGGTCCCAACCCACCCAGAGC
AAAGGAGGATGAAGAACACCAAAGACACGGGTAAAATGCTAGCCCAAGAGACAGAAGGGC
CACATAAACCAGAGCCTCCATCAACCTGAGACTAGAAGAACTACATGGTGCCCAGCTCTT
ACCAGTGACCACTCTAACAGGGAACACAACAGAGAGGCCCTGACGGAGCAGGAGAAAAGT
GTGGGGCAGAATTGAAGTTCACATAAAAAGACTAGCCTTAGTGGTTTGAGACTAGAGGAA
TCCCAGAAGACATGGCTTCCAGACTCTCTGTTAACCCAGAACTAAAACCATTCCCGAAGC
CAACTCTTCGGACAAAGATTAGTCTGGACTATAAAACAAAATAATACTCGTGAAGAGTGT
GCTTCTTAGTTCAAGTAGATACACGAGACTAAATGGGTGGCTTCTGTCAAGAGGTGGGAT
GAGAAGGCAGAAAGGAATAGGAACTGGTTGAATGGACACAGCAAACAAGGTGGGAAGGGA
GAGAGTGCTGTCACATTATAGGGATTGCAACGAGGGTCATAAAACAGTATCTGTATAAAT
TTTTGTATGAGGAATTAACTCGACCTGTAAACTTTTGCCTAAAACACAATTAAAAAAGAG
TACAGTCAAAACCCTAGGGAGCATGTCTGCCCTGTAACACACGTGATCGCCGTGAGTCAA
AATCAACTTGGCAGTAACTGACAACAGCAAACCGTGTGGTATTTAGTTTTATCACATGTG
TTACGGTTTTTACTTTGTAACTTCTGGCGCCAGCGGGCCAAAGAAAAACTCATTTTACAG
ATGTCCCAGGCCTCCTTTATCTGCTCTTTGTCCCTACTTGTCTTCCTGAGGACTTCTTGG
CACAGATGGTAGCTTCCCTTTCATTTGATGGCAAGATGGAATGGGCTAAGGAGCTGCTTC
TAAGTCTCCAGATCTTCGGGCATCAGGAATTTTGTTGAGGGCTAAATTAGTAATCCCATA
ATGAACACTTTGAAATTAACTTTGTATTATGTATTTGCAGATAACTACCATGCAGCTAGA
ACGTGAGAAAGCTCTTGAACATAAGAACCGAATGTCACGAATGCCTGAAGACAGAGATTT
ATTGTAATGAGACTCAAGGCCGCGCGGCAGTCCGTTTATGAAGGTGAACATACTGGTTTC
CGGGAAGAGTTAATTCATGAACTTTTTAGTTTTGCCTTAAAAGTTTTACTTTAATACAGT
GATATATTTTGAGTTAACATTTGTAATAGTCATTCAAATAATATTCTAATAGAGACTTTC
TTGACAATATTTTAAAGGCTAGCCAGCCATCTCTAAATTTTTTTTCTGAAGGCTAAAGTG
GACTGCATGGAGTCTGCTTTTTAAAACTTTGTTGTTTGATTCAGAAAGACAACTAAAGTA
TCTTGGTCTTAAGTTCTTGTTTAATCATTTGACTTTGTGTAAAAGTGAACCCGTTGGGTA
TTATTTTTAAAATATAACAATTTTTAAAAATGTTTAGATTTTTTAAAAAACCACTGGCGT
ACTAGAAAATCTGCAACAGTCATTTGGAAGTTTTGTTTTTTTGTACTTGAAGGTTATTTT
TTGGCATTTTAAGAAACATGACTTGCAAATTTAAAGGTTACTGTTAGCTTCTAGCTCTTG
AAATGCTTTTTTGGGGCTGCTTATTCAATTGCAGGAGAAACTTAAACAATTCGAAGAGCG
ACTAGCAGAAGAAAGACATAATCGTTTGGAAGAACGTAAAAGGCAACGTAAAGAAGAACG
CAGAGTAACTTACTACAGAGAAAAACAGGAGGAGGAGCAGAGGAGGGCTGAAGAGCAAAT
GCTCAAAGGTATCTGTAGCCTGGGACTGCCAGGTAGGGGAAGGCAAGGCTGATAGTAGAT
CCAGCTGAGAGCAGTCTTTCTTTAGAAAATACAGCAATCAGGGTAGTTGACTTCTTAGTT
GTCCTGGTTCTCAGAGCCCGGGAACCTAACTTAATCATCCCCAGTTTGTTTTATGTGAGG
ATGTTACATCCTCTACCAGTTTGTTTCCACTTTTTAAATATTCTGTAAAAATGAAGGCTT
TTTATCATCATTCCATTAATGTTCATGCTGAGTGGCATAGTATTTTGTTGAATGTTTTCT
GCCATTTAGCAGTTTTAAAAATTTTAAAAGGAATTTACGTCTATAAACACTGCGTGTTTG
GTACCAGGGAAGCAGATAAGCACCAGGGGAAAGACGCTGGTGTTAGGCACACTTTCTAAC
CTAATGGATTATTTAGAGCGCGAAGAGCGAGAGCGAGCTGAGCGAGCAAAGCGTGAGGAA
GAGCTGCGAGAATATCAAGAGCATGTCAAGAAATTAGAAGAAGTAGAAAGGAAAAAACGC
CAGAGAGAGTTGGAAATTGAAGAGAGAGAACGTCGTAGAGAGGAAGAGAGAAGGCTTGGT
GATGACCCACTTTCTAGAAAGGTGAGTATAAAAGCCATTGTGTTTGTTGTGAGTCTATCA
GCCAGTTTTCTTGTGTGAGAGTTTTGAAAGACTAATATCAATTTGTCTCTCGAAGACAGA
ACGTTCCTAAAGTGAAAGAAGCTAGACGTGTCTTGGCAGAACTGGGCGTTTACAGGCTTC
AGTTTAGATTACTCGTCAGTAAGAATGAATCTCACGAAACTCTTTGTCAAAAGTTAGCAC
TCCTTAGTGCTGTGGATGAGGGTCTGTTCCCGTGTTCCCTCAGAGAAGGTGCTGTGACTT
TAGAGGATGATGGATGTTCTCTGAATCCTTGGCACTCAAAGGTGTGTGTGCATCACATGG
GAGTTGGCTAGAAATGCAGTCGCAAGCCCAGCCCCAAACTTTCTGGATCATTATCCCCAT
TCCCAGGTGATTCAAAAGCTGCTCAGTTTTTTTTGTTGCTGTTGAAGATACCTGAGTATT
TTTAATACCTCCTCATGTCCAAAACTGATCTGTCTTTGCCTCCCTGTCTTTTGTTTCTGG
ATTTCCCTCTCCGATTGCTGTTAAACCCACTTATGTACTGCGTTTGGCATCTAACCCTTC
CCTTTCCTCTCTGTCCCTACAGCTCTTGCCTTAATTCAGATCCTTTTCTTTTGCCTGTGT
TGCTTACTACCCTTCTGTCTCTGATCTGTTGATATTTAGCCTGTCTTTGGTCTTCTTCTT
AACGTTTGATTTGGAACTTTATAATTGCTCTCTCAGGTCCCTACTCATCTGCTTCTTGTC
TTGAGGTGAATTTATAAACTTTTCTCAGTACATTTTCATATTCTCTGTTTCTTTTAGTGA
TTACTGTTAATTTTTCTGCTCAAATCTATCTGTACTTCTCAGAGCCTGTAAATTGAGAAC
TCTCTTTCTCCTTAGAACGAAGCACATTTTGAGCGTGCCTGTGTTTCTTGTGTTTTATTG
CAGTCAGCTGGATATTTTTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGATGAGTTTTATTTTAAATAGCTGTCGTAGACAAAAATGTCTTTGTGTATGTT
TCAGGAGTTCTTGTTTTTCTCTCACAGTTGAACAGTAGTTTGTCCGGTTGCGAACCATCT
TCCCACAGAGTATTAGAGATCTTCCACAGAGTTCTTATTTGTCTGAGTATGCCCTTAGCT
TACCTTTGTAGCAGCCCTCAGTTTCTGTTCTAGGGTGCATGTGTTTAAAATTGTGTGCTT
TTTCCTTTGTACAGGTTGTAGCAGGTTTGAATGTAAGTGTTGCGGACCTCCCCCACACCC
TTTACATAAACTTGAGTGACCATGTAAAATTTTGAAGAGGGACATACTGTTCATATAATC
ATTCCCTTTCAGACATTTCATTTACTTTTTCTGCCTAGTAGGCACTGTGATGGACGTTTG
GGGACACTAGGCTTTTTTTTTTCTTTTTTTTTTTGCGTAGTCTCTAAAGAGAGTTTCCAG
GTCAGAGAAAATCTGTGGAGTTTAAAATATCAGTTTCACTTTACTGTCAATCTGTTCTGC
AGATTTAAAAAAAAAAATTAAAATTTAAAAATTGCTTATATTTAAGGATCTGAGATCATT
TAACATAAGTACAAAAATGTTCACTTGGTAATACTGGAAATTGTAATAAACTGTTGCCAG
TGTATTATTTCTTGCTGACTTTGGTAAATGTAGGATTCTCGCTGGGGAGATTCAGAAAGC
ACGTGGAGAAAAGGACCTGAAGTAGACTCTGAATGGAGAAGAGGCCCACCAGAAAAGTAA
GTAGAGTTAAGGAAAATAGTACCAACTTATTATAGAGTGCGCGTGTTAATATCTTATTCT
GGATATTTTATTTAAGTGGGATCATGCAACATTTGTCCTTTTGTGCCTGACTTAATTCAC
TCAGCATAACGTTTTCAAGGTTCATCCGTGTCATGGTGCGCATCAGAACTTCCTTTTTCT
TTATGGCTGAATAATACTCCATTGTATTGCAGTACCACATTTCATGTACCCGTTTATCTG
TTAATGGGCACTTGGATTGTTTGCACCTTTTAGCTGTTGTGAAAAAGTCCAGTTTATCTG
TTCTGTCTTTAGTTGCTTATACTTTTGAGAATCTGTTACTGAGAAGAAGATCTTGAAGAA
TAATTCCTGTATTTTTCTCTGTAATTTTGCTTGTTTTAAGTTCTTACATGTAGGTATTTG
CTCCATTTTGAGCTAATTTTTGTATATGGGTCCAGCTTCTTTTTTTTGGTATGTGGAAAA
CTAGCTCAGGCAGCATTTATCAAAGAAACTGTTCTTTCCCCATTGGGAGAACTTAGCGTC
CTTGTCAGATCTATTGGCCACGGACGTGAAGTGATTTTTTTTTTTTTTTTTTTGAAGTGC
CTTTTAATAATGAGTAAGATAAAAAATTAAAAAAGGATCATATGTTCTTTTCATTTACTT
TTAAAAATGTTTGGCTTTTGCACTATAGGGATTGGAGACGTGAAGGGCGGGATGAGGACA
GGGTCCTTAGAAGAGATGAAGATCGACCACGGCGCTTGGGGGACACTGAAGAAAGAGAGT
CTTGTGTCAGAGCAGAGGACGATCGGCTTCCCCGTCGAGGCACGGATGAAGATAGAGGCC
TTAGACGTGGTCCTGATGACGATCGGTTCTCCCGCCGAGGGACAGATGACGACAGACCTC
TCAGACGAATTGGTGACGAAGATCGGGCAAGCTGGCGTCACACCGATGATGACCGACCAC
CCAGACGAGGACTGGATGACGACAGAACCTGGCGAACAGCTGATGAGGACAGAGGACCAA
GACGTGGGATGGATGAGGACCGGGGGCTGCGGCGAGGCGTTGCTGACGATGAGCGATCAT
CCTGGCGCAGTGCTGACGATGATCGGGGTCCCAGGCGGGGCACGGATGAGGACCGGGGTC
CCAGGCGTGGGTTGGATGATGACCGAGGACCTTGGAGGAATACCGACGATGATAGAATTT
CCAGGCGTGGTGCAGACGATGACAGGGGGCCTCCTCGGCGCAGCCTGGATGATGATCGGC
TCTCCAGACGTGCTGATGACGATCGGATTCCCAGGCGAGGCGACGACTCCAGACCTGGTC
CCTGGAGACCATTTGGCAAGCCAGGTAAGATTCTGAAAACCAGACTGGGTGCATCATAGA
CTCCACTCCGTGTGTTTACCTGTAGAAAGCTAACTTCTGTTGGGCAGATAACGTACAGAG
ATTGGGCTACTTACTCGCTATCATTTTCTGGATAAAACCGGCCCGTCATCCATCTATCCT
TGAACACCCATGCAGTGGCTTTTATGTTAAACGGTTGCCTTCAGTGTCCCACACACAAAA
GCAAGCTAGATGACCCCCTTTTCTGCTTTGCTGATATCATGCTTTTTGTTTTCCTTCTGC
CTTCTTGACTGCTTCTTTGCAGGATCTTCTTCCTGTGCCTATCCTTTAAGTTTTCTTTGT
AGGTTCTGTTCTGGACTAGCCTCCTCTTAAAAATAAATATAAAATGTACTCTTACCAAAT
CTCTGTACTTCTGTCAACCAGGGGATGGGATGGCTCCTGGAAGAGCTGTTATCTCAGTTC
CGGCCTTTCTCCGTTTGTTTCTTTTCACACATCTTAATTCTTGAGCAACTGTATACACGT
CTGTGGTTTCTTCTTCAGGTGACTGCTGCTTCCCTCACTGTCAGTCCTGTATTTCCAACT
GCACACTGCATATTTCCATCTGGAAGTCCTGTGGGCACTTGAGACCCAACCTGTCCAAAA
CTGAACCCACGTGCCCCCTCCCTCCCGGTGGCTCATGCCTCAGTAAGGGGCACCGCTGCC
CACCTAATTGCATGAGCTAGAAATCTGGGCTTTCTCCTTGACTCTGCTCTTTTCCAGCCT
TTGTCTTAAATCTTTCACGTAGTTCACGTTTGTATTTTAAATGTTCTTTAAATCTGCTCA
CTTCTCTATTTCCTCTGCTTGTGCTTCGTTTGGGCCACCATCATTCTTTTTGGAGCTCTG
GTCTTTGTTGGCCCTCTCATGCCCACTTCCATTCTTGGTGCAGTAACCAGAGCAATCCCT
TATAAAACGCATTTAAGTGAGTGGCTTTCCTGCCTTTACCCTTGTCAATTTCGGTTGCAT
ATGTCTGAAGCTACCTCCAGTCTCATCTCATTCCACTCGCCTAACCGTGAGCCACTTTGT
TATCCTTCAGGTAAAGTGAGGATAATAGTACTTCTCAGAGCTCTGGAGAGGATTGAATGA
GTTAATATATGCATAGGGTTTAGACTACTGCTTTGGCCCACGGTAATACCGATGTTAACT
ATAGTGATACTAGCTTTGCAGCCGTAGTATATTTTCATTGAAATCGATAGTTCCTTTGGC
CTCTTGAGTGCGTAAGTGTGTATATATACTTACACATACATAATGTATTTGGACATCCCG
TGGCTAAGTGCGATATTGGGCAGGATTAAAGGATTTAGCCTTGTTTTATGACCAGGTGGG
TGGTAAATGGTGGAGGGCAGGAATATGAAAGGAAAGAGTCTTTCTTGCCATGAAGACTTT
GAAAATGTTGCAGGGTCTAAATGAACTTAAAATTTGAGCTGTATCTGCATCTCAGATTTC
TAGATCTTACCCCTCACCCTTTAAGTTTTCTGTTTAAATGAGCAGTCTGTTTACTGTGAG
AACAGATTTTAATACCCAAAATCTCTGCATTGCAACAATTAACTATCAGTTTATCAGTGA
TAGTATTTCGTGGGATATCCAGTCCAGACGGTAAATTTTCTCTAAGTATACAAGGTAGGA
AAACTGTGATAGTCATAAACAGGAGCTGGTGGTTCTTTGAAGTGAGGTAAGTGGTGGTGG
TTTTCTTTTTTTGTTTAACGAGGTGGGAGTGGCTTAATTAGTCTTTAGAATGCTGATGGA
GCAGTGTCAACATTAACTTCGCTGCTCATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGACTTAGCGAGTTTTAATTTAT
TTACTATTTAGTAGCCACATTTGGGCAGTGGCTGCTGTGTTGGACAGCACAGATCCAGGT
CTTCTCATTTGTTATGTGTGCCTTGAGCATCAGATGGAGGTTAAGTTAGGAGTTTTCAGC
GTTATCCCTGTGACATTTGTAAATTCTCAGAGCACCAACTTGTATATGATGTATTCACTT
AAAAGTATCCACATAGTGCTAACAGCAGAATGTAACTTGTCATTTCAAATGGCCACAGAG
ATGAGGGTGGCTGGAGAAGAGGACCAGCTGAGGAATCTTCGAGCTGGAGAGATTCGAATC
GCCGGGATGACTGGGATAGGGATGACCGTCGTCGTGAGAGAGACGACCGCCGTGATCTGA
GAGACAGGCGGGATGACAGAGACCGAAGAGGCCCTCCTCTCCGATCAGATCGGGAAGAAG
GTATAGATGTTACACACAGTTGCTGAGTACAGAACAATAATTTCCAAGGGAATTTGGGTT
TTATTTAATTATCTGTTAAATTGTATGTATACCACAAATAAGATTTTAACAGATACTTAT
TCAGTTTAGAATTCATGGTTTTCACGGACTACTTGATGGCTAAACTGTGAAGTAAACTCA
TTTCTAAATTCAAAGTACAGTAGTAGACTAATCGTAAGGAGCCCTGGTGGTGCAATAGTT
AAGCACTTGGCTACTAACTGGAAGGTTGGTGGTTTGAACCCACCCAGCGATTTTGTGGGA
GAAAGAGCTGGCAATCTTCTCCCGTAAAGATCATAGCCTAGCATACCCTATAGGGCAGTT
CTAGTCTTTAACATGGGATTGCTGCGAGTTGAAATCAACGCGACGGCACCCACAACTGTA
GACTAATTAAATTGTATATTAAGCAGCGTGTCTATCGATAAAGTTTACTCTATGAAATTG
AATAGTTGATTATTTAAAGTAAGCCCAAAGTGTAAAACGTTTTTTCGGAAATTCTAACAA
TTGAAACTAATTAAAAAATACTTAGGTAAAAAATGCCTGTATCACTTAAGTATGTGTCTT
GCAAGCCTTTGTACAGTTGGATCATGTGGATATTTTTTCTATTATAGCTGTTATTGAAAA
CTTCCCTATTCTGTGGTTAATTTGCTGTTAAAATTTCTTCAACAAGAACCAAAAAATCCT
TTTAATTTCAATTTTTTTCAATCAGCCAGAGATTTATCACCTCATCTGGAAGGTTTATAG
CAATTAGGACATTTTTTCTTGTTCACAGGTTTTGAGTTATAAGACTGTGTACTGTTTTAA
AGGTCTTATCATAGATTATATCAGAATCATTAATATTATTTAGTTTTTATTGCTTTTTAG
TTCTGTGATTCTATATTGTTAACTTCACTGTGACATATCTGAGTAATTTGAGGTATTCCT
TTTGCTTAGGTTCTGTTTATTCTGAGCCAGTAGGAAACGGTACAAACTTAACCCTTTTTT
TTTTTTTTTGGGTAACTTTTTTGCAAGCTCTTGGAGGCGTGCTGATGACAGGAAAGAGGA
CCGGGCAGAAGAACGGGACACCCCTCGCCGTGTTCCTCCCCCAGCTCTTTCAAGAGATCG
AGAAAGAGAACGAGAACGAGATCGGGAAAGAGAAGGTGAAAAAGAGAAGGCCACGTGGAA
AGCTGAGAAAGATAAGGAATCTCTTCGTCGTACTAAAAATGAGACTGATGAAGATGGATG
GACAACAGTGCGACGTTAAGTCTCAAGATGATGGATTCAAACTGGTGTCTTACATAGGTT
TGATCACATTCAAGGATTATTGTACTTGTGCTTCAACCAGTCTAAATTGGATTCTATAAC
TAATGTTTCACCATAACACGAAAAGCATGAACTTGTATTAATCCTATATGATAGATTGAT
CATGCACCGTATCTACAGAAGGTTGGAAAACCATGCCATTTTCTGAAATTTAAGGTGTTG
CATTATTTCACCAATCATTTGTTTACAAAAAAAGAAAAACTAAAAAATAAATTGAAAATG
TGAACTCTTCAGGTATTGTGTAACACCTATATCTTGGTATAGAACTGTTCTTTTTTCTTT
TGATTTTGAAATAATTTGGAGTGAGGTAAGGTTCTGTTATAGAAAATGTGTTTGAAGACT
GTCTAAAACGGTGGAGCTGAACAATTTTCACACCATTAGCTGTTGAAATTATACCTCTTT
AGATACTGAGGTATTTACTAGTACTAAATTAAAATTTTTTNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1049, 6690..6880, 7426..7562, 7950..8007, 8010..8015, 8019..8021, 8024..8079, 8081..8112, 9992..10191, 11779..11987, 13711..13882, 26659..26763, 27147..27245, 28493..28517, 28519..28610, 28836..29021, 29855..30202, 30594..30698, 31852..31965, 34060..34140, 34143..34180, 34182..34182, 34714..34867, 35296..35480, 37233..37315, 38008..38663, 41003..41204, 41998..42179, 43223..43458
1001..1049, 6690..6880, 7426..7562, 7950..8007, 8010..8015, 8019..8021, 8024..8079, 8081..8112, 9992..10191, 11779..11987, 13711..13882, 26659..26763, 27147..27245, 28493..28517, 28519..28610, 28836..29021, 29855..30202, 30594..30698, 31852..31965, 34060..34140, 34143..34180, 34182..34182, 34714..34867, 35296..35480, 37233..37315, 38008..38663, 41003..41204, 41998..42179, 43223..43455
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved