Loxodonta_africana Locus EIF4A2
snOPY snoRNA Orthological Gene Database
Loxodonta_africana EIF4A2
Loxodonta_africana
EIF4A2
GeneScaffold_4698
SNORA63, SNORA63, SNORA4
2479..2607, 4212..4344, 4533..4673
9196
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGCCACATTTGCTATTT
CCATCCTGCAACAGTTGGAGATTTAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCA
CCAGAGAACTGGCTCAACAGGTATTGATAGTGTAGTTCAAAAACTGCTTGCGTGTTGCAT
AGGTTTCAGGTTTCACAACTGAAGGATTTAACTTAGTGTAAATTGGTCCTATCAGAGCCT
TCCTTTTAACTGACCATGCATGCAGGGAGTTTTATAGGTAGTTAAACAGGAACTGGGTAT
GCAGATGATTGTTTCTCAACGTACTGAGAAACCAGAAATTTCCTCAGAGCTCACTAGATA
AATGCCCGTTTTTAAGTTTGAATGCAGTTGTGCAACATGAAAACTGCAGTGTCACGTTAA
CATTCGACTGTCTTGGTAGATTGTGATGCATCTCTTGTATGCTGTTTTCAAAGCTCAATT
GTATTGGCCTTGAGGTAAATCTTCCTAAATAAAAATAAGCTTTATTAAGGTCAAGATCAC
AAGCCACAGTATACACCACGGGAAATTTAAAAACCGTTAACAGTTTTCCTTAGTTGTGTT
AACAGCTTGTTTCATTGTTTACACTTTCCTACACATTGAAGAATAGGGAATATCTTTGGT
ACACTTAGCTGATACTTGAAGGGAGACAGAACCCCAAGTTTGACAAGGTACAAACGTGAG
ACATTTTAAGGAAATTTTATCTTGAAGCAGTTCGTAAAGTCTGCATTTTAAGCTTGGGAA
GTAGTTAATGTGCTGTGCATGCGTAAAAGCTGTTTGCAGACCACATATTTGGCCTTGTTT
TGGAAGTTTTTCGATAGAGCCTGTAATTCAGTAGGATAATAATTGAGGCTTCTGGTTTTT
AGATCCAAAAGGTAATTCTGGCACTTGGAGACTATATGGGAGCAACTTGTCATGCCTGCA
TTGGTGGAACTAATGTTCGGAATGAAATGCAAAAACTGCAGGCTGAAGCACCACATATTG
TTGTTGGTACTCCAGGGAGAGTATTTGATATGTTAAACAGGCGGTATCTTTGTAAGTATT
GACCTTTTCTTAGAGCATAATTGGAGTTTGCTATTGATAAATTGGAAACCCTGGTGGCGG
AGTGGTTAAGTGCTGCGGCTGCTAACCCAAGGGTCGCAGTTCGAATCCACCAGGTGCTGC
TTGGAAACTCTATAGGGCAGTTTTACCCTGTCCTATAGGGTTGCTATGCGTCGGAATCAA
CTCGACGGCACTGGGTTTGGTTTTTGGTTTATTGATAAATTGAATAGGGAAGTCAAATTG
TATCCAGGAGAATCCAGAAATGATAGTATAACATTGTTTTTGACAGCTCCAAAATGGATC
AAAATGTTTGTTTTGGATGAAGCGGATGAAATGTTGAGCCGAGGGTTTAAGGATCAAATC
TATGAGATTTTTCAAAAATTAAATACAAGTATTCAGGTGAGCCTTTTCTCTCTTGTCCTA
TAGCTGGAGATTTGGTGGAACGCAGGTACTGTTAAAGTATAACTGAAGTGTTTATTGTCC
TTTCCCCTGCTTAAAGCAACTGATGTATAACTATAACTGTCTCTAGCTCAGTCACATAGT
AAGATTGGAGATGCTTGGTCTCAAACATTTTTCCTTGAGTGTTATGGTGAAAGCTTGTAA
TGTGTGCCAACGTAAACATTGTCCTTTTTTTCAGGTTGTGTTGCTTTCTGCCACAATGCC
AACTGATGTGTTGGAAGTAACTAAAAAATTCATGAGGGATCCAATTCGAATTCTGGTGAA
GAAGGAAGAATTGACCCTTGAAGGAATCAAACAGTTCTATATTAACGTTGAAAGAGAGGT
AACGTGTTTAATGGTTAAACATAAAGAAAATTAGCCCATTTTTTCCTTCTTGTATAAGCA
CTGTGCTAAAATTACAGAAACGAGGACTGTGTCTTGGTTTTTGTAATAATGCTAGCAGAG
TACACACAGGAAGAAAAGTAACTGCACTAGATCGGAAAGACTGGGGTGGACCTCTTTCTT
AATGTCCAGTGTCCTTTGTCTTAAGATTGGGTGCGATAAAAGCCTTTAGAAATAGAATGA
ATGTTTACTGAGAAAGTTGGAAACTAAATGATTAAACTGTATTTTCTACTTGAAATTCTG
TAGGAATGGAAGTTGGATACACTTTGTGACTTGTATGAGACACTGACGATTACACNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGCAT
GCTAGAGACTTCACGGTGTCTGCACTGCGGTTGAGGAGGCATCCTAACTTGGCGCTAATT
AAAATGTCTTTATAGCAGGATTTAGACTACAATATAGCTGTTAAGTGCTGTGTTGTCGTT
CCCCCTGCTCAAAATAAAGTTGTTTCTTATCTATCCCTGTCTGCTAAGCCCTTGTAGCAG
CCCAGGGACGCTTGGTCTCATACATACTGATGAAATTAAGTACTGATTTCGACTGGTAAT
TCTTGAATTAAGGTTTGTTAATTTGCAGCATGGTGACATGGACCAGAAGGAGAGAGATGT
GATCATGAGGGAGTTCCGATCAGGGTCAAGCCGTGTTCTCATAACTACTGACTTGTTGGT
AAGTGAATTTTTTGCTGCTGCTTTTAATCTATCCTACCAAAAGTTATTTTGGGGGCAAGG
TTTTTTTTAATAACCTTTACCATTTCGGGCTATTTGGGAGAATAAAGAAAAGACCACACT
CCACAGTGGGCTATACCACTCAGTATAGTTCGCTACTATTTTGTGGCCTACAGTACCTAG
GTGTCCCACTTTGTTACGAAATAGGATTTGAATATACACTGTTGTCTTTCAGGCTCGTGG
GATTGATGTACAACAAGTGTCTTTGGTTATAAACTATGATCTACCTACCAATCGTGAAAA
TTACATTCACAGGTGAGTAAATGGCATCTTGACTATTGTTATAATAATGAAATAAATTGA
CAAACTGTTGCGATTTTTCTGAAAGGTAACGTCACATCAGGGAATTGATTTTATAAAGGA
TGACCTTTGTAACTTGACACATGATAAAAGTTGCACTTGGGCAGACCTAGAGTTTGGTCA
GAACTCAGTGGGAAGACTGGTCAGGACACAGTGGGAAAACAGTTGTGTTGCCCAAATTGG
AAATTATAGAGAGCAGGTTTTAAGTATGTTGGTCCTAGCTTACGTTTGAGTGTTTTTTAG
TCATGTTGCTCGTGTCCATGCGCTTTTCTTGATCATTGATTCCTCTATAGTGGGATGTTC
TTGGTGGCGTCTGGTAGCAGTTTGAGTGATCCTTGGTTTAGTTGTAGTGGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACAGCTGCTCTTTGCTGGCCCACTTTG
GTATGGGCTTTAATTCACTACCCCAAACACAATACTGTCATCTGCTTTGTAAAAAACAAA
TGCTCAAGACACCTGATAAAATCTCATTTTGCAGCCAGACAGCCTTTGAATCCTTTTGGC
ACTAACTGCAAAGGAAGATTCTCTTCTCTAGATACTTTTTGGTTAGCAGCTAGTGCTCCA
ATTAGAAGCACGAACTATAACCTTGATAAGTAAACAGCAGCTGCTGGTTAACAAGTGGAT
CGTCATGTGCAGTAGTTCATGCAGTGCTGGAGAAACAACGTTCTGATGGTTGACTTTTTT
TTTCTCTCACAGAATTGGCAGAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTT
TGTTACTGAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTTTCTACAATACTACAGT
GGAGGAAATGCCCATGAATGTGGCTGACCTTATTTAATTCCTGGGATGAGAGAGTTCTGA
ATGCTGTGCTCGCTGTTGCTGAATAGGCGATCACAACGTGCATTGTGCTTCTTTCTTTGG
GAATATTTGAATCTTGTCTCAATGCTCATAACGGATCAGAATTAACAGATTTTGATAGCA
AAGCGACATTAGTCGTGAGCTCTTGTGAGGAAAGCCACTGGCTTCATCCTCCTTAGAGTT
AGACTGTTGGGGTGGGTATAAAGATGGGGTCTGTAAAATCTTTCTTTCTTAGAAATTTAT
TTCCTAGTTCTGTAGAAATGGTTGTATTAGATGTTCTCTATCATTTAATAATATACTTGT
GGACTAAAAGATATAAGTGCTGTATTAAATCAGCCAATTATGTTAAACTAGCATATCTGC
CTTTATTGTGTTTGTCATTAGCCTGAATAGAAAGGCCTTTAAGACTGATTTTTTCCTTTT
TTTTTTTTAGAAAGCATTTGAATGCATTTTGTTTGGTATTGTATTTATTCAATAAAGTAT
TTAATTAGTGTTAAGTGTGAACTGGACCCTGTTGCTAAGCCCCAGCAAGTGATCATATCC
TAGGTAGGGTTAAACCCCCAGTAAAATTGCCATATTGCACATGTCTTAATGAAGTTTGAA
TGTTAAATAAATTGTATATTCACTTTAAAGCTGCTTCCGTCATTTTTTATTCTTGCCAGA
ACCCCATGTTTACAAAGGATTTAAACCACGTTCAGTTGAACAGTTCTGGGTTAACTGCTG
CATCACGGTAGCACAGAGGCTGATGAGCTGCAGGTGTTCGTCAGCACCGTCTGCTAAGCA
TTGATCTACTTCCTACAAGGAATGACAGGAAAAATGTTAGCAAGTAAACCTCCTTCAGGC
GTAGTTAGATAAGGGCAAAGTGCCTGCTTACCGCAAGCTTTTCTGTGATAACAGACTTCT
GTTTATCGGAGAGGTGGTGGTTCTCTACAACCACATCATGAAACTGATTGACAAGCTGAG
TTGCTGGGTGACCCTCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1042, 1046..1099, 1862..2030, 2326..2435, 2674..2817, 3123..3228, 4135..4166, 4408..4497, 4732..4811, 8052..8196
1001..1042, 1046..1099, 1862..2030, 2326..2435, 2674..2817, 3123..3228, 4135..4166, 4408..4497, 4732..4811, 8052..8193
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved