Loxodonta_africana Locus EP400
snOPY snoRNA Orthological Gene Database
Loxodonta_africana EP400
Loxodonta_africana
EP400
GeneScaffold_6562
SNORA49
59434..59566
81003
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGCAGCTGATGAGCAGGA
GCCCGGTGGCCCGGGCAGAACGTGAACATCACCCTGCAGAATGTGGGGCCAGTTGTGGGA
GGCAAGCCAGCAGATCACGCTGGCACCCTTGCCGCTGCCCAGCCCGACCTCACCCAGCTT
CCAGTTCAGTGCTCAGCAGAGGCGGTTTGAGCATGGGTCTCCGTCTTACATCCAAGTCAC
CTCTCCACTGTCCCAGCAGGTCCAGACCCAGAGCCCTACCCAGCCCAGCCCTGGGCCGGG
CCAGGCCCTGCCAAGCGTGCGGGCCAGCGCCTCGGGCCCCGGGCTGGGCCTGTGCAGCAC
CAGCCCCACAGGCGGGTTCGTGGATGCCAGCGTGCTGGTGCGGCAGATCAGCCTGAGCCC
TTCCAGTGGGGGGCACTTTGTGTTTCAGGAGGGGCCCGGCCTCAGCCAGCTGGCCCAGGG
CACCCAGGTGCAGCTGCAGCACACAGGCACACCCATGGCCGTACGGGAACGGAGACTGTC
GCAGCCTCACGCGCAGTCTGGAGGCACCATCCACCACCTGGGGCCCCAGAGCCCAGCTGC
AGGTGGCGCGAGCATGCAGCCCCTGGCCAGCCCTGGGCACCTGGCCACGGCCAGCCTGCC
GCCCCAGATCAGCAGCCTGATCCAAGGGCAGCTGATGCAGCAGCAGCAGGTGCTCCAGGG
TCAGCAGCTGAGCCGGCCCCTGGGCTTCGAGAGGACACCAGGCATGCTCCTGCCGGGCGT
GGGCGGGTCCTCAGCCTTTGGCATGACGTCTCCGGGCCCCCGCCCACCAGCCCCTCCAGG
ACCTCGGTGCCACCTGGTCTGTCCAGCCTTCCGGTCACGTCTGCAGTCGGCACAGGAGTG
AGGAAATCAGCCAAGAAGCTGGAGGAGATCCCCCCGGCATCTCCAGAAACGGCCCAAATG
AGGAAGCAGTGCCTGGACTACCACTACAAAGAGATGGAAGTGCTCAAGGAGACCTTCAAG
GAGTATTTGATTGAACTGTTTTTTCTGCAGCATTTTCAAGGGAACATGATGGATTTTTTA
GCATTTAAGAAGAAACATTATGCCCCATTGCAAGCATACCTTAGACAGAATGACCTGGAC
ATTGAAGAGGAAGAAGAAGAGGAAGAGGAGGAAGAAAAATCGGAGGTCATCAATGATGAG
GTACGTAATCAGTAGTTTAACCGTCTAGAGGACGTATGCTAAGCAAAGCAGAGTCTGTGC
AGCAACAGGAACTGAGAAAATCACTCGCAAGTGACTGGGCTTTTTCTAAGATTTTGGCTT
CATAAGGATTTGACCCATGAGTCAAAGGAAAGAATGCACTTTAAGCTTTTTTCCTTCATG
GAAAGGAAGATCTATTTCAGAAGAATAGTGTGTTGGGAGGAAGATAAATAATATTGCTGT
GATTAATGGTTGTTTAAAATCCAAATATTTTCATCTAGTACCAAGGCCTCATCTAGGCTC
AGAGAATGAATCCGATGTGATCCGGGCTTTCCCCTGTTAGCCTAGGTGGGTAGGTGTTGG
CTAGAACTTTGACAGTGAGCATAGGACCAGGTGCGGGGACTAAGAGAAGGGTCTCCAGAA
GCCAGACCTGAAGTTTTAGCCCCATTTGGCTGGTATTCCAGGTTCACATTTTAGATAGTT
CAGCCCAGAAAAACCTTGTAAACATTGCTTTTAAAGAAGGAATTTAAGTTTCTAACCTTT
TACAGTACATCAGCTGTATTATAAGTTATTATAATAGTTATTATGTAACTTAAATACGGC
AAAAAAACTACATTTGAGAATTTTTTCAATTTTTAGGTATAGTCTTAGGTTTTACATCAG
ATTTCAAACCCTCAAACTCTCGCGATTACCTACTGAGCTATAGCTAAGATAGAGTCTCCT
TTAGGCAGTGTACTTTTTGGGTGCCTGAAATCGGTGTTTCATAAACCCCCTCATTGAGAT
TTGTCAGTACCAGCGAATTCCTAAGGTACTTTTCCTGTTCCCAAGAAAGCGAACCATGGG
AACAGGTGGACGGTCTGTTGTCCTGTAGTGCACTGTATTTGTGCCTTTGTGTCATGTGGT
GCACACTATGTTGGTGGAGCTCATTTTGTTTGATGATACAGTGAAAACAACCTAAATCTC
TGTCAGTTCTTACCGTGCAAAGAAATCAGCCTTTGGTGAACAAAAGCTAGTCTCTTTGCT
TCAGCAGTCCTCATGACATTTATGGATGTATCTGTGTGGCTTTGCCATTTGTGTTTTCTT
CAATACTGTTCCAGGATGAACCATTTTTATTCTTCAAAAGATTTATCTGATTATTTTGAG
GGTTCCACCTCTATTGCCATGAGTAGTATATTCAGTCCTCTTTATGTTTGTACCAGTGAC
ACCAATGTTGTCTGTAAACTCAATCCGTCTTATCTGTGCTTAAAGAGAAGAAAACAATCC
TTTTAAAACATCCTGCTGAAGTGGCCCTTTGCCATTCTGACCCTACGTCTAGTAGGGAAC
AGGATGGCTGTTGTGCAAATTGCCCATACAGATGTCAGGGCTTTTGTTACTGGAAGCCTG
TCTGCCACTCCAGTTTTAAAATTGGCAGTGAGAGAATCTGAGGGTGTCTCCCTGGTGACT
CATACTGGCGCTTCTGCGAGGGTGGCCGATGAGTGAGGTGTCACGTGATAAACTCTGTGA
GCTCAGCATCCTTTCACAGGATTCCATTCAAAACCGTTCCATTTTTAAACACCGAACATC
CGTGAGCTATCAGCAATGAAAGTCTAACAACATTTTGAGCAGTCTTAAAAATTATGTTGC
CTTTTTTTCTCAAAATATTTCCTCTCAGGTAAAGGTTGTGACAGGAAAGGATGGGCAGAC
TGGGACTCCTGTTGCTATAGCAACCCAGCTTCCGCCAAAGGTTTCTGCTGCTTTTTCATC
CCAGCAGCAACCACTGCAGGTACTTTTCGATGGTTCTCAAATGTAGTCTCATCCCAAACT
TTTCTTTCATCCAGAATATTTTAACCTTCAATTTACTATTTGCTCTTCAGCATTTTTTTT
TCCAGAGCCCATTCCTTATTTAAAAAAAAAAAAAAAACTTCCTGCATATAAAATTTTAAA
ACTAAATTGCATGAGTAAATGACAACACAGACCCTAATGCATTATTTTTTTCATGTTGAC
CTTAACGCAGTAGTAGCTTTTAGCATGCATGCCCCCTGCCCCTCCAAGCCCTGTTGAATG
TGTGCGCAGGACTTCCCGTGTGCTGTGCTTTACATGTCGTTCCTCCTCTGTCTTTTGACC
TGTGTTTTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAGCTATTGTCAGCTTGTCGACCCATTTGC
ATTATTCACTCTTTCCTTTCCTCTCTCCCTCTGTGTGTGTGTATACATGTGTGTATATAT
AGACGTATCTCCTCCAACCATTGGAGAATAAGTTGCAGACAGTGTATTATGCCCCTTTAT
CCCTAAATACTTCAGCACATATTAGGTAAGGCTGTTAGGTAAGGGTTATCTCACCTAACC
ACAATACAACGATCAGGATCAGGGAATTTTACGATGACACAAGACTATTAAATAGCCCAC
GGTTCATGCCCACAGTGCGCCTGTTGTCCCAACAGTGTCCTCTGTGGCTATTTCCCGAGC
CCAGGACCCTGTGTTTCCTGATCTTTAATGTGTACCAGTTCCTCAGTCCCTCATGACCTT
GATATTTCTGAAGGGTACAAGCTGGTTGCTTTGTACAATGTCTTTTGATATGAGTTTGTC
TAATGTTTCCTGTGTTAGACTCGTGTCATGTATTCTTTTTTTTTTTTTAATTGTGCTTTA
GGTGAAGGTTTACAGAGCAAATTAGTTTCTCATTAAACAATTAATATGCCTATTTTGTGA
CATTGGTTGTCAACCCCACGACGTGTCAACACTCTCCCCTTCAGACCTTGGGTCCCCCAT
TTCTATTCGTCTAGCTTTGCTGTCCCTTCCTCCCTTCTTGTCCTTGCTCCTGAGCTGGTG
TGCCCATTTAGTCTTGTGTACATGGTTGAGGTACATGTATTACTGTTTGTTTTGTAGGCC
TGTCTAATCTTTGGCTGAAGGGTGAACCTCAGGAGTGACTTCAGTACTGAGTTAAAGGGT
GTCCAGGGGCCATACTCTCAGGGCCTCTCCAGTTGCCATCAGGCCAGTAATTGTGTCATG
TATTTTTGAGAGGAATGCATGGACATGACAATGTATCTCTCAGGGCATCGTAGCAGGAGG
CCATGGTGTCCGTTTGTCCCACACCTGGTGACGTTAACGTTGACATTTGGTGAAGGTGGT
ATCCACCAGGCTCTTTCACTAGAAAGCTATTGTTTTTTCCTTTTGTAAAATTATAAATAA
TTTGGGGGAGATACTTTGAGACTGCATGCATGTATCCTCATTATATTTTCACCCACTGAT
TTTAGCATCTGTTGATGAGTCTTGCATGAATCAGTTACTGCCTTAAAAATGGCACAGTGT
ATTGTCTAACCTCAGTATCCCTTCTGTGTTTATTAGTTGGCATTCTGCTGTAGCAGGAGC
TCTCCCTTTCCCCCAATTACATATTCAATCCTGCGTAGATTCTGATGTTAGTCAGTGGGT
TATAGTACATCACTACCAGTATTATTTTTATGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGTCAAATGCATAGAGTTGTGTAGCCATTATCGCAATCAAGAGACAGAA
CAGTTTCATTGCCCCGCAGAAGTTCCCGCACACTGCCCCTTTGTAGCCAGACCCTCCCCC
CACCCTTAGTCTTTGTTCTCCATCTCTGATTTTGCCTTTTCCAGAAAGAAATATAAATGG
AATTATCCAGTATGGAGCCTTATCAGTCTGTCTTCCACTTAGCACAATATAGTTGAGATT
GCCCATGTTGTTTTATTTACCAGTATTTTGTTGAACATCTTTCCATTTGCCTGTTTGCAT
ATCTTTTGTGGTGAAGTGTCTGTTCATGTCTTTTGCCCATTTTTTTCATTGGGTGGTTTT
CTTTTTGTTTCGACAGTTCTTTATGTAATCTGGATACAGGTCCTTTGTCAGAGATGCAGT
TTGCAAATATTTTCTCTTATTCAACGGCTTGTCTTTTTATTGTTAACACTGTCTTTCACA
AGCAAAATTTTAAATTTCAATGAAGTCCAATTTATCAGGTTTTTTTTCCTTCTGTGGATG
TACTTTTGATGTCCTGTCTAAGAACTTTTAGCTTAACCCAAGGTCACAAAGATTTTCTCT
TATGTTTTCTTTCTAGAGGTTCTATAGTTTGTTCTACGTTTAGGTCGGTGTTTCACTTTG
GGTAGACTTTTGTGTCATGTGGGAGGTGTAAGTACAGGCTCTTTTTTTTTGGCATATGGG
TGTTCAGTTTTTCCAGTACCGTTTCTTGAAGAGACTATCCCTTCTTTGTTGAATTGACTT
TACGTCTTTGTCAAAAATAAGTTGATCATATTTGTGTGTGTGTGTTTCTGGCCTCCCTCT
TCTCCTCCGTTGATCTGTGTGTGTGTCTGTGCCAGTGCCACGCTGTCTTGATGACTGTAG
TTTTGTAATAAGTCTTGCAGTCAGGCAGTGTGAGCTCTTCAACTTTGTTCTTCTTTTTTA
AAATTGTTTTTGCCCCTTTAGCTCCTTTCCCTTTCCATGTGAATTTTAGGTTCAGCTTGT
CGATGTCTACAGAACACCTTGCTGGGATTTTGATTGGGATTGTACTGAATACGTTGACCA
GTTTGGGCAGACTTGATATCTTGGCGATACTGAGTTGTCGAGCCCATGAACATAGTATAG
CTCACCATTTATTAGGTCTTTGATTTGTTTCATCAGTGTTTTGTAACCTTGAGCATACCA
ATCCGGTACATATTTTGTTAGATTTATAACTAAGTATTCTAATTTTTGTCTGGTACTATA
AATAGTACTTCATTTTTTTGAGTGGGGTGCCGGCTGCTTGTTACAAATACATAGAAACAC
AGTTGATATTTGAACTGGTATTCTGCAACATTGTTAAACTCTTTCTTACTTTCAGGAGCT
TTTCTGGTAGATTCCATGGGATTTTCTGCATAGACAATCATGTCTGCAAAGAGAGCGAGA
CTTTTTCTTCTCTTTCCAATCTGTGCCTTTTCTTTCTTTTTCACCCGGTTGCGCTGACAA
GGACTTGCAGTGTGGTGTTGAGCAGGAGTGTCGTGTTGCTGACCTTCGGCAGAGCGTTCA
GTCCTCACCTTAAATGTGACGTTAGCTGTGGATTCTGTGGATGTTTTTTTATCTGATTGG
AACCCTGGTGGCGCAGTGGTTAAGAGCTCGACTGCTAACCAAAAGGTCGGCAGTTCAGAT
CCACCAGCTGCTCCTTGGAAACCCATGGGGGAGCTCTGCCCTGTCCTGTAGGACCACTAC
GAGTCCGAATCGACTTGGTGGCAGTGGGTTTATCAGATTAAGGAAGTTCCCTTCTACTCC
TATTTGTTGAGAGTTTTTATCATGAATGGATGTTGAATATTGTCATAAGCTATTTCTGCA
TCTATTGAAACAAACGTGATTTTTCTTTAATCTGTTCATATGCGTTACGTTAAATTGAGG
TATAATTTATATGTAGGGAAAGGCACAGATCTTAAGGGTTAGTTTGCTGAGTTTTGACAG
ATGCGTGCACCCATGTAACCCACGTGCTTGTCCAGGTGTAAGTTCTGTCGCTTCAGAAGG
TCTGCTTGTGCCGCTGCTCAGCCTCCCCACTCACCACCGTTATTCTATCATTACTCATTT
TGATACTCAAATTATAATTTGACCAGTTGGCGCTCCTTCAGGCTGGCTCTGGTGTACTTC
CGACACTTCCCTCTCACTTTTTGAGCACTTCCTCACTTTCTGGCACAAGAGGTTTCCCTT
GTGTAATTCCTTCCTCCAGCCCTGGAATCGGCCATTTCTCCAAGAAGACTGGTTCCTTTA
CTGGGGACTAATTGAAGCCAACATTGAGGTGTTTGTTGTGATGATTTGGATACTATTTGA
AGCTAAGTCTTAAATTGAAGATTGTCTGAAAATTTATCAGTGGGGCATCTTTCCCGTTGC
TACATGGAGGACCGTAAAAGAATAATGCATGTGGACCACATGATAAATGCTTGAACTTAC
AGAAGCAGAGGGACAAGAGCGGCCAAGGAGTGCCTGTAAGGACGTGAAAACAATGTGCAG
TTCTGTTCCCACAGTGATGTCAGTTAACCACTCGGAGTTCTGTCACGCTCACCAGCTTGT
CAGAAACTCAGCTAGGTGGACCGTGATGGAGGGCAGTGGTGGTTCTAGTGCACGTTAGGT
GGGAACATCTTGCCTTATCTGGAAGAGGTGAGCACGAACTCAAGATACTCTTGTATGTGT
GCGCCAGCCAACACAGATCATGACGTCCCAGCAGCATTGTCAGGGATCCAATCTGGAAAG
AACCGGAATGTCCACCGGCGTAGAAGGGCTGAGGGGCTCGGGTACTGCCCCACAGAGGAG
TGCGGATCAGAAGTGAGAGTCTGTGAACTGGAACCACAGCGCGCGTCACCATGGGTTAGA
CATTCTGGAAAGGGTGAAGATGCCCTCAGGATGAGTTCTGCTCTTGGCATGATTTTTATC
ATAAACTAGTGTATTGCTAAGTCAGTTCTAGAAATAAGTCCAGATTTCTCAGCATTGGGT
GTGTGTATATCACGTTTCATCTGCTTCCAAGAGGCTTTTTTGGATAGTATTGTTGAGTGT
AGTTACTACATACAAAATAATACTGGTATGGTTCCAGTTATTTAGGTCTTAAAAAAACAC
CCTAATTGGAGATTATTTTTCAGAAATGCTAATGTTAGGGACGGTGAATTATTATTTATA
AGCATGTAACTCTAACCTAGTTTTTTTTTTTTTATATCGTGTTACATACATGTTCATATT
TTAGAATGTATTGTTAAAAATTTAGAGGTATAAAGCGGTGTCTCAGCTTGTGTGAATGTG
CTGTAAAAAGAAGGCACAAGTGGCTTTTTTGTTTGTACTTTGAGGTTTCCCGTTATCTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGCAGGACTGGGCAGTGTTT
CGCTCTGTGTACGTAGGGTCGCTATGAGTTGGAACTGACTCGAAAGGTACCTAACGACAA
CGTGATTTTCCAGCACCATTGGTTGAAGACTTCCCATCCCCCATGAGATTGCCATTGGGC
CTCAGTTGGAGATTAGATGGTGTATGAGTGTGGCCCTGTCTATTTGCTCTCCATTCAGTT
CTTTGGATCTGTCTGTTGACCCTTCAGCCAGGACCACACAGACTTGATTACTGTAGCCTT
AGATTGAGCCTTGAAGTTGAGTCCTCCAACTTTGTTCTCCTTTTTCAAGTTCACCAACTC
TTTATTCTGTACCTCCAATTGTCTGTTAAGCCTATCCAATGAATTTTTTGTTCACGTGTT
CTGTTTTTCAATTCTAGAATCTCCATTTTGTTCTTTTAAATAGTATTTTTTTGTTGTTGT
TGAGATGCACTGTCCTCACTATAAACATGTTTTTTCTTTATGTCCATGGGCCTAATTATT
AAAGCTGCTTTAATGTCCTTGTCTGCTAATTCTGTGTTCTGGGTCGTCTCAGAGCTGGAG
CCTGTTGAGCATGGGCCATGTTTTGTTTTCTTGTTTCTTTGTATTCTGGAGTAGTCTCGA
ATGGGATTTTGGACATCGTGAGTGATATGTTATAGACTCTGGATTCTGGATTACGTTCTT
CTGAAGAGTACGGATTGTTTTGCTTTAGCAGTTTGTTAAATAACTTTGTTGAAGTGAAAT
TGCCAGCCCTGTTTGCCTTGTGGTAGGTGGAACTCTTGGCCTTGCTTGGAGTATGTCCCA
TGGAGCTGTGGTGTAAGAGCCAGCCAGGGTCATGGCAGCCATTACGGAGAGTGTGGGGCA
TCTCTCTGTTTCCTTTTGTGTGATTCCCCTTAACTTTCCTGCCACTGTGGTCACCTCCCC
TCCCTATTTTTTTCTGCCGAGACTGCATTTCTTCGCGTTTTAGCTGTCCCATGTATCCCA
GATGGGTGCCTGCCCTCATGCCAAGTTCCACAGGAAAAAAGAATCTCATCTAGTTCCTTT
CTTGCAGGTATTGACTCCCTGCCTGTCTGCCAGCCTTTTAACACTTTTTATATTTTTTCT
AGAGTTTATGGTCACCTGCAGTGTCTGGTGTGATAGGAAGTACTTGGACATTACTGGAAG
CAGAACGCTTTATCAGTTTTTTTAAATTGAAAAATAACTTGCTTTGGTCCCGTAATACAC
GTTCATTGTAGAACATTTGGGAAATTCAGGAGAGCACTCACGTGCGCGCGCACACATAAG
CGCACAGAGTAATCCTGCGCCAGGATAATCACCCTGAACACACTAGTGTCTGTCCCTCCA
ATCATTCTTTTCTTCCCTTCCTCCCACCCTCCCTCTCTTTGTTCACCCCTGCCCCCATCT
CTGTTAAATGCAGATGGGGGCCATCAGGCTGGATGCACTGTATTCTAGCCCACTTCCTTT
ACGGACCTTGTGTGGCTTTCCCCGCGGGTGAATAGTCTGTGGCAGGTTTGCAGTGACTTT
GATCAGGCACGTGTAACTTCTGCAGTTAAAACGCCTCACTAAGTAGGGTGGATGTCATCT
CATCATTAAATAATAACGCAGCAGCTAGCGATGGTTAAGAAACGCCACCACTGGCGTTCG
CTGCGTGCAGGGGTGGTTGGCGCACAGAGGTGGAAGGTAAGGACACCGGTTAGATCGGTA
CTGCCCCAGGGTTGTTTCTTTCTTTTAAAAACAACCCGACGGCCTTTTCTTGAAACATTT
CGAATAACCGGTAACCTATGTTACCATTCCCATTATCTGTAGATCAAGTAGGGTGCTAAC
TGCAAAAATTATACCATCTTGAAGATCCAAGCTAGATTGTTACTAACGGGGGTTTTAGCG
TCGGTTTCCCGTAGAGGCACAGTCTTACATTTCTGTTTATTATGCAGTTTTGTTTTGCCT
TGTTTTCCGGTGCGAAGGCATGCTCGGCTTTGTGACTTCTCAGTGGGCTGAGCTGGGTCT
CGGGCGAGCCTGCTCCTCCCGCATGGGCCCTCTGCTCTCATTTCATATGCAAAGCCAGCT
AGTTTCTCAGGGACTCTAGATTTGCATTGATTTGAAATCCATTTAAAGTCAGAATGTATT
CTTTACAAGGCCTTTCTTTTTCCTCCACAGGTAAGTTAGAGTTTTAAACTAGTATGTGTA
AGTAGACGTTGCAAATGTGTTTTAATTCTACGTTGTTCAGATCACATTTTCTTATTAAAG
AGGAATGAGGCCAGGGTTTGGGTAAAGATAGTTGCAGTTTACGTTCAAGTCTCATGTCTC
ACTTTTCCATTTCCCCAGCAGCAAGCACTCTCAGGGACCCTGGTGGCCGCAGCGGGCAGC
TCGATCGAAGTGGACCCCTACCAGAGGCAGCAGACGTTGCCTCCGGCAGCAGGTATGTCT
CAGCCAGGCTGCCAGGCCTCAGGTCTCACGTTTTCTGAGAATGGGAGTCACAGCACATGC
CTCCACATAGCGAGCGCTGGGGAAGTAATTTTTGGTTAATTTCTCTCCACTTTGAAAGTT
ACTTTTTTCTGGAGGGAATTATCAGCTGGACAAAATACCTATGTGAGTGTGCGTGTGTGC
GTGTGTGTGTGTGCCGAGTTGAACAGGCGTGTTCTGTGCTGGTCGTTCCGTCACCCCCAC
GAGAGCGTGACTGAAATCCTCCGTGTGGTGAAGTTGTCATTCTTTTTCTCAAACTGATTT
TTCCTTCAAATTATGTTACGTAAAAGATTCAGACAGGTCAAAAGGGTGTAACTCAAGTCT
GCCTCTGGTTAGAATTACCTGCCTAGTCCCTAGCCACAGAGGTAACCGTTGTTAATGTTT
TGTGTATTCTTGCAGACGTTTTTTCTGTGCCTCCACAAGCATTGTTATTTAAACAAGGAT
TCAAATGTGACCACACAGGCACTGTTATGTGTCATTATTTCTTTTACCTAATAGGCTGCC
TTGGACGTCTTTGCGAGTCGTTACACCTGGTTCTTTGTGATGACTGCACAGTAGTCCGTA
GTGTGGATCGGTCCCTGTTCAGTCAGACCCTTACTGTGCTCATTTGTCGGTACTCTCCTT
TTTCTGCTGCGGTCAGCGCAGGATTGAACATCTAGCCTCGTATTTTTCCGCACGTTTGTC
AATATAATCAAAGGCGAGGTTCACAGAAATGCAATCACCGGGCCACAGGTTACATGCGCT
GAAGTATTAATGCTGCCCCGAGGTCCCCAGTGGGGGCAACAACTTCCGGTTCTCTCACGT
TTGCCATTTTATTAAGGATGACCAATCCTTTAATCTTTGCTGGTCTGATGGGTGAAAAAT
TATACCTTGTTTTGATTTGGATTTCTTTAATTTTGAGTAAAGGAACCCTGGTGGCGTAGT
GGTTAAATGCTCAGCTGCTAACCAAAAGGTCAATGGTTTGAACCCACCGGCTGCTCTGTG
GGAGAGAGATGTGGCAGTGTGCTGCCCTGAAGATTAAAACCTTGGAAACCCTATGGGACA
GTTCAGCTTTGTGTCCTATATGGTCACCGTGTGTCAGAATTGATCAGACAGCGGTAGATT
TAGTTTAGTGTGGTAATTTCAAGTCAGGTTGTACAGTGTCTTTTCATGTTAATTAAACAT
TTGTGAACCTGTTCTTCTGAACTAACTGTCCCTGTTCTTTGCCCATTTTTCTCTCTGGTC
GTGGGTATTTTCCACATGAACTTCTAAGAGCTTTCTGAGTGTTAAATACATTAGCTCTCG
TCCATCATGTGCTGCAAATATTGTGTCTCAGGTTGTTGCTTGTCCTTTGTCTTTTAATGA
TGCTTTTTTTAATATCTGCAAATTTTTAATTACAAGAAATTATACTCACCAGTCTTATTC
TTTATGGCATTTGGGTTTTGGTTTATGCATAGAACGCCTCCCTGTTCAAAGATTCTAAAA
ACACTTACACATGTTTTTTTCTACTACTTTGTGGTTTTATTTTTACATCACACTGCACCT
TTTTTGAAAATTATTCTAGAGCAGTGTAAGAGGCCTCGACTTGAAGTGGGTCACCAAGGG
GTAGTTTTCCAGCACCCAGGGGTGAACACAGGCGTTCCTCTTCAGCAGTTAATGCCGACA
GCACAAGGTAAGCCCTAGCGTGAGAAGAAGCCCCTTTAGCTGATAATCAACACCAAACTA
TATTTGGGTAGTCAAGGTCGTATGTTCAAGGTGGAGCTTCTGAAATTGGGGTAGTTCTTT
GAATCCCACTTAATACACCCACTCCTCACTTACCGACATGGTTAAGTTCCAAAGACCAGG
CCATTATGCGAAAATCGGCATTATGTAAAAACGGAGGATGACTGCATCATTACATAACTG
GCAAACCACTGAGAATCACGGCCCAGCCAAGTTGACGCATAACCGTCACAGCCAGTGTTA
CTCTCTCACACTTGTTACTGCCAGACTTACATCGTTAATACGCAAAAGAGCTGGTAGGTG
TTTTACCATTGTTGTAAATGCGAAATGTCAGACAGGAGCTAGTCGACAGTGAGGAGTAGG
CGTACAGTGTAAAAAGCCCCTGGAGACATCCTTGTAACTTTACCAGAGCCACACGGCTGC
CTGTCACTGCTTTGCCACGTTTTACACTTTTCTTTGCTACTGCTGTAGAGGGATGCCCTT
GGGTGCTTTGGTGCTTGTTTGGCTTGGTGCTGATGTACAAAAGTCGGGTGCCTTTCTTTT
CTTTCTGTGTGCGCTTTTGTGACGTTAGATCTGATGTGGTACTAATTCCCCACCAATGTA
CTTTCCCGTTTGAGTGTATGAGTTGGTTTTCAGATGGTGGGTCTCTGACAAAACATTTGG
ATGTAAAAATGTGTTCCCTTCTTACTCACTGGCTGGATTGCTTCCAAAGTCATTGCTGTT
GGGGTTTTTCTCTGGGTTTGCAGGAGGGATGCCCCCCACTCCGCAGGCTGCTCAGCTCAC
GGGACAGAAGCAGAGTCAGCAGCAGTATGACCCTTCCACAGGGCCACCTGTGCAGAACGC
CGCCAGCCTGCACACCCCGCCACCGCAGCTCCCTGCCAGGCTGCTTCCCGCCAGCGCCCC
TGCTGTAGCCCCGTCGTCTGCACTGCAATTCTCGCAGCAGCCCCCGGTGGTGGAGCCGCA
GACACAGCTCCAAATCCCCATGAAGACTCAGCAGCCCCCTGGCCCTGTCCCCGTGCCCCC
ACCCAGCCAATTCCCCCCTCCGCTGCAACAGGCCGCCCAGCCCGCACTCCACGTTCCCAT
GCCTGGGAAGGCCCACATGCAGGTGTCTCAACTTCCATCCCAGCCACAGGTATGTCCGGA
CAGCTAGGCATCTGTCTGCTCAGTTAGAGATGGGGAAAAGGGGGAGTCGCAGGGCTGGAA
GGATGCTGTGCACACGGAGGTCTGCGGCTTTGCTCTTAGCGGTTACACTCCTACTTGACG
GCAGTCAGTTAAATCGTTGCACCATCATTTTATTTGGCTCTGTAATAGTAGTTGTCCTAA
TTAAAGTAACAGAAAACAGAACTTTCAGTATTGCTGTTCTGAGTATAGAGGGTTTCCACT
TACTGAAGCACAAATTGTGCCCAAGGTATTGTGTAGTTGTCCCATTTAATCTCCCCAGTA
ACTGAGGGGTGCTACTGGCCACTTACTAATCTGGACACAAGGCCGAGCAGTGGTGTGCCT
TGCCCAGGTCTGCACGATGTGTGCACATCAAACGGGGCTGTCCCGGCTCTGAGTGCAGAG
CCCTTGTCACTGTCCTAGCCCACTCCTCTTGGGGGCACCTGCCCGGTTTGTATTCTTTTT
GGTGCTGTGTGCTCTGCACACCTGAGAGGGCATTACTTTTTGGGCTTGGTGCACCTTTCA
AGGATCTGGAATGCCCCCTCTCCTCTGCTGATCTTACCCAGATGCGTGTTATGAAATTTA
TGTAGTAAATGACCTCAGCCGCTTAAGAGGAATGGACTGCTGAGCGGAGCAGGGACCGTG
TCTGCAGCCCTGACGGGTGGCAGAGGGTCTCCAAAGGATGGCCAGGCCCTGTCTTGGTCA
TCTGTAATTGATTTGTTTCAGTGAGTGGGGGCGCCCGCTTCCTTGTGCCTTCCCTCACTA
GCAGGTGGATGTTGTAGGTGGGCTTTGAGTTCAAGGATTATTTGAAGTCTATGGCAGAGC
GTGATCTTAGCTATATGATAATAGAGTGACAGCAGATGCATAGTTGCTCCTGTTTGTTCA
CCCCTACATGGTGTCAGGCACTGTGGGGAGTGCTTTGTTGGCATTTTACTCATTGGGCCA
CATAATGATTTAAAACAACCCTGTGGTTTTTCTTAGGTTGTTTGTAGTACTTAAAGGCCA
CAACCTGTCTGTCCATTTGTCATACTGTGGTGGCTTTGTATTATTGTGATGCTGGGACCT
ATGTCCCCAGTATTTCAGATACCACCAGGGTCATCCATAGTGGACAGAACCTGAAAATTA
GCCAGTGAAAACCCCGTGGATCACAACAGAATACTGTCCAGCGTAGTGCTGGTAGATGAG
CCCCCTAGGATGGAAGGTGCTCACACGTCCAGTGCACCGCAGCCACCACAGTGGAACGGA
GCGTGCCAGTGATGGTGCAGGTGCCGCAGGGCCCAGCAGCATTTGTCTGTTGTGCACGGG
GAAGCCACAAGTTGGAGCTGACTCGACGGCAGCTAACACCACCAGTTATTTAAGGATCAG
CTGTTGAAGATGATTTTTAAAAAGCCCTCAAAGTGTGTAGAGATCTATTACTTACCGGTA
GCAGAGGGTCAGCACGCTTTTTTTGCAAAGGGCCCGATAATACATACTTCAGGCTTCGCA
GGCTCTCCAGTTCTGTCACGCCTGTTGAGCGAGAAAACAGCCACAGACAGTTCAGAAATG
AACAGACATGATGGCTGTGTGCCGGTAAAACTGGATTTCCGAAAGCCTGCGGCGGCTGGT
TTTTGCCGACTCCTGAGTGGGAGGAAACCACCCCCCATGCCATGGAAGGGACTCACTGGG
CATAGAGACAGGGTTGTCACTGAGGTTTCGTCCCCTCTTCTGGGTGGTGAACGTGCTACA
CTTCTGGAGTCTGCCCTCAGCACCCAGTTTAGCACCCCGCCCTCCTGCTCACTCCTCCCT
GCCTCGGCAGAATTTCGTAAACATTTAGTGCAGTCTTTAGGGAAGGGGACCAGAGCGCCT
TTCCTGCAGTTGAACAAGCCCCACTCGATCTGGGTAGGCACAGAGGAGGCGCCCCCAGCC
CCCCACGAGGAGGTACGCGGGCTTATGTGTGCCTCAGAGAAGGGGTAAGGGGGCAGGCAG
CAGGGGCTGTCGCTCAGTAGGAAAGTTCACGAGACGAGGCGATAGGTGAGGACCCAGCTG
GAGTGAATGCTCCCGTTTAGTGCAAGTGTCACCGGCGTGTGTGTGGCTGTGCTGTACAGC
GCGTTCCTATTGTGGCTTTCGTTTGGTAGTTATGGAAAGGAAGCTGTTATTGCATTTATC
TCCGTTGATGTCCCTTGTGTTGCCTGGAGCCTGTGAGCTGCTGAAACCTTGTCTTGTTTC
CTGCCTGCTAGACTGTGGCACTGACAAGGCCCCCCCTGGATGCTGCCCAGCCCTGCCAGA
GGCCTCTGCCCACCTCCTCTTCTACCTCGTCCCTCACCCCCGTGGGCGGCTCGGGCCCGG
GACCCTCGCCTGCGCGAGCCTCGCCAGTGAATAGACCCTCCTCAGCAACTAACAAGTCAC
TGTCTCCCGTCACATCCCGGTCCCCGGGGGCAGCTGCCTCGGCCCCCCTCAAGGCTCAGA
GCCCAGCTCAGAATGCTACCGCATCCCAGGACAGTTCTCAGGATAAGCTGGCGGAACAAA
TCACACTGGTAAGCCCACTGAAAACACCTGCTTCACCAGTGGGGAGTGCGGCTTGGGGCT
ACTCTCCAGAGGAGCCAGCCTGGGATATCTTATGCCTGAGGTGGCAGTGGGCATGGCCAT
CAGAGCCCAGGGTGAGCTCTTGGTTGCTCTTGGGGCAGCTGCCTGGGCACATAGTGCTGC
TGGGTTCTGGTCTCACGCACGGCTGGCTGGAGAGAACGTGGTGATTTCCTTTGTGAGTGG
GGGACCTGTGGACCTGGGGGGCCAGCAGTGCTTCCAGCTGCGCTCTTGCTGTGCTGTCAA
CTGGGAGGGCCGAGCACCCAGCCTGGGGGATGCCGAGGGGCAGCGCTGGGCTAGCCGGCT
GCACCAGGTGTTAGGCAGCTCCTCCCTTCCGCCTCGGCCTACCNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCCTTTAAATTGGTACAAAAAAAGCTAAGTGTGAACC
GGTGTCCTCACCGGAATACATCTAAGATTGGCAGGGCCAGTGGGCAAGGCAGGACGGGAA
CGTGAAGAAACGAAGGTAGATGTTTGGTTGTGGTGATGATAACCTGAGATTCATTCTTCT
GTTCAGGTGCCTGTGCTGTTTTTCTTAGGTTTGTGTATTCAACAACCAAACCGAAACCAG
CCCCCTTCAGGGACTTCCACTGTGCCTCGAGCGAGGTTGGGTGTCTGAGTGGGTGGCGTA
CCCCTCATCACTGAATGCTGACCCTGTGCACCCTTACAGGAGAACCAGGTCCAGCAGCGC
ATTGCAGAGCTGAGGAAGGAGGGCCTGTGGTCACCACGGCGGCTGCCCAAGGTGCAAGAG
GCCCCACGGCCGCGGGCGCACTGGGACTCCCTCCTAAGGAAAAGCAGAGGATGGCCACCG
ACTTCGCCCGGAGCGCAAGTGGAAGGTGGCCGCGGCCTAAAAAGTACATAAGAGCAAAAG
CAGAAAAAGAAACAAAAGAAACTATTAAAGAAGTTGGAATAGAAGAAATATTACAGAGAA
GCAATAATATAATTATGAAAGGTCTACAAAACTAGCACAAAAGACACACAGAAAATGACA
ACCTAAAGGGACGCTGTGCAGGGGCCACACTGATGAGGACAGAGGGAGGAAGGGTGGGGT
AGGCAGAGTCAGCACCTGCTGCTCTTAGGTGTGGGGGAAACGAAGCCCATCAGGCTTTGA
GCATCTCTGCGTCTTTAATTTACGTCTCGCCACTTTTCAAGGTGCTGCTGGTGGGTACGT
AAAGGGTGTAAATTGTTGGAGAGCAACTTGGCAAATTAAAGCAAAAGCCTTAAAAATGTG
ATTTCTCTTTGCCTCAGCAGTTTTCATATCTAGGAGTGAAATAGGCTTTGCCGTACTCAT
GCTGTGGAATGCTGTGCAGTGAACTAAAAACTGGTGCTGATCTGTGTCTGTTGAATGGGA
AGATGCTAACAGTGTATTAACTGTGGAAAGAAGATTGTAGTGTACTGTTGTCCTTTTTTA
AGAACTGTATGCCTATTTAGTCCAATAATGCCCTCAAGAAAAGCAAGCCAGTGTGGATGG
TGGTGTTTGCTGGTAGACGCACCCATGGTTCTGCTAGCACACCCCAGGGGCACAGGAGAG
TGGGCTTCGTAGCTCATTGTGGTAGATTTGTAAGAACTTGACAGATCCCATTTTATAGCA
GGACACTGCACAACATACAGTTCTTGGCCTTCTATTTATAGCTGGTCAGAACCGTAGCAC
GCCATCATGAAGACAAGAAGCTTCGTGAGGAGAGAGGGAGGAAGGAAGAGCAGGACCGGC
TGAGGCGCATTGCGGCCTCCACTGCCAGGGAGATAGAGTATTTTTGGTCTAACATTGAGC
AGGTAAAATTCTGGATCCTACCTGGGGTCATAGAGGTCATAGGCTGTCTCAGAGCTGCAG
AGCCAACCTGGGAGTGCTGGGTCTGTGGGGGGAACTTGGAGGCGGAGCGTGCGGGCAGTG
GTCTTGGGAAGGTGCACATGTGGAAGGGTGGGTACTGGTTTGCCCTGCCCGGGCTGTGGG
GTCCTGAGAAGGCGCAGGGCAAGCTTGTTGCCTCAAGGCTCTTCTGTCTGTGCCTTCAAG
TGCCTGGTTAGGCTGCAACCCAGGAGTTTGGTAAGTCATGCTGGAGAGCTGTTCAGAGGG
CCTCCAGGAGGCCCTTCCTCCAGTGTGGGCACCAGTCGCCCGAGGCCAGTCTTCACAGCG
GTTTCCCCGTCCTCCTCCTCCTCTCTCCCTTTCTGTCCCCGGGCTCTCTTCCCGCCTGGC
CTCCTCCTTCCCCCTGCCTTCCTCTCCCTCCTTCCCTCTCTCCTTCTGCCCCTCTCTGTC
TCCCTCTGTGTCTCTCTGTCTCTCTCCATCCTGCCTTTCTTTTTCTCATCTCATTGCCTG
ATAGAATTTGGACAGAATGTAGCTAGATATAAAATAAATGAAAAAACACCAAGTTGAAAA
TTTACTTTTAAAGAATTTTTGAAATGAGTTTGAGACAACTGTGTTTTTAGACTGTATGTG
TAATTTTTGATGTTTTCTGTTCAGAACTTGTATGATTTACATTCTTAATAACGTGCATAT
TTATTTAACTTTTTGTATTTAGGTTGTGGAAATAAAACTACAAGTAGAATTAGAAGAAAA
AAGGAAAAAAGCTTTAAATTTACAGAGAGTTTCCAGGCGAGGTATGATACTTTTTTAAAA
ATAGCTTTTGACATTTGTCAGATTGCACAAAGAGTATATCTTCATTATAAATTAAAAAAA
AACCTGAAAATATTTTTAGAAGAAAAAATAATACCATCAAGCATTTGAAAAAAGAACACT
GTCGTCCTCTTCATCGAGGGTTTCTACTCCTGTGTTTTCATGTAATGGCAGCGTGCACTG
CCCTGCATCACTACCGCTGAGCTCTGTCTCGTTGTGGATGCTAAGATGGGCATCCTTGTG
GTCAGGCTGCCTGAGTGTGTTTTCTTCATGATGACTCATGGTGAGAGAGAGAGTGTGACG
AGGACCTCCAGCGGGGCCTGCAGGGTCCCACGTTGTGGTCGGTTGGGTGGAATCGAAGCG
TTTGTAGCACTAGTCGAGACATCATTTCTGGAGATATTTCTTAGACATTAATTCTTAGCG
TTTTGGGTTTTAAATGAGATTAAGCTGATTGTAAAATGGCAAGGAGAGATTTGTGAGTGG
AGATGAACAAGCTGCTCTAACTGAATGAATACTGCAAAGATGAAAAAGGCAGCAAACTTA
AAACATATCCTTAATTGATGCCTGAAAGCCACAAAGCTGTAGTTCACTTTTAGATGTGTT
TGTCCTTCAGGCTGTGACTTTGCCATAGGACGTCTCTTTCTCCCTTTTCTTTCTCGTCTG
GGTCAAGTGGTGTCATGTAGTGCTGCAGTGAGCTCTGTTGTATATGGATCTTTGTCAGAT
CCATGCTTTCAGTTCCTTGAGGTAGAGTAGTTTTTTTTTCTCTCTCATCTCCGATATTGT
AGTTTTTAGAACTGTATTCCTGGAGGTTTGTAAATTATTGCGTATTTGAAAAGCATTGTA
AGTAACTGTAGGCAATACGTTTTGTTCTCTGAAAATTCTGAGAACTGGGAAAAGAAGAAA
ATGCCATTGTCTCCTGAGAGTTAAGCTGAAGTTAAATCAGCCAAATGGAGCCAAGACTGG
TCAGGTTATGCTGCAGGGAAAGGGTCAGACTTGTAAGATACTGCCTGGAGTAGGATGAAT
CAACCAGGGGCTCGTGCCATCTCAGGGTGTGGTTGGCAGTGGTCGTGCTGGTGTTACCGT
GTGGGCACAGACTGGGGCCTCTGGTCAGGTCAGAGGGTGTCAGGCCTGCATAACAGGCAG
TGTCACCTTTTGACGGAAAGGCCCCTGTGGGCAGGCAGGCCCCTGTGGCAGAGCTGGTAG
CCCCGGCTTGAAGAAGCCCTGTGTGTGAGTCTCCGCTCACCAGGCTTTTCCTGACCCTTT
GTGCCTGTGGAGCCCAGGGGAGAACTCTCCTTGGCGGCCGCTTGTCAATATCTGGTCTGC
CTGTGGTTGATCTCCTTGCTGTAAATAAGTGCACTGCCATTCCAGTTTGCTAGTTCATCT
CTTGTGAGGTTTGCTAGGATGAGTCCCCACCCCTACATCTATCAGCCCCAGACCCTCTCA
CATGAGGTTTGAGCCTGTCTGTGGCAGTGTTGGGACAGTGAGGTGGACCATCAGGTGCTG
CCACCCTTAGGGTCTCTGGGCTTGTGGCTGGGTGTTGCCCTTCAGAGCAGTCTTCCTTTC
TCAGGCGAGTCTGCCTTGCTCGGAGTCTCTGGGCATTGCTTAGCTGCCCCTGTCCCTTTA
GCACCTTGATGGGGCCAGGAGCAGCAGAGACTCGCCATCTCTTGGTCCTCAGAAGAACCC
TGGAGGGGTGGGCCTTGTGATGCCCACACTATTGATGAGAAAACTGGGAATGAGGGGCAG
AAAGTCGTGGAACTGCTGTGTAAGGTAATAAACATCATGACAAGTCAGTCTGTGCCATTT
CCCACTGCTCTGCGCACGACCGGGATGTCTGGGTCCCTGCGGACGGGTCCAGACCTGGAA
GTTAGGAGCTGCCATCACTCTGTGTGTGGACTCACAGGTCAGGCCTGGTGCCTCATGGCT
CCTGGGTTGCTGAGAGGAAGGGCAGAATGGCCCCAGTGCCTCTGTTCAGTGTTGGAGGTA
CCTGTAGGGCAGAGCCAGACAGAAGAGTGGCTCTTCACATTGTGTGGACAGCTTTCTCTG
CCTTTCAGCTCTAGGCGAAGCTAACCATGTTCCTGTCTCCTTAGGAAAAGAGCCCAGGCA
CCTGGGACTTGATGCTTTCCCAGAACACTTCCTGGTAAGTTCAGACTGCCGCTGCGCTCC
AAAGAGACAGCAGCCAGGTGGTGACCACGATGTTCCATCACTGGAGAAATGCGTAGATTG
TGACTTTTACTCCCTGTCTTCAGAACACCAGTCCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GTAAGCTTTTCCCTTTCTGTGAATAAGAACAACCCTCCCATGAGGACAGTGCAGTGAGAC
AGACTGAGCCCAGAGCCTGCTGTTCTTGTCTGCACGTCCTAGGTCCCTCCCAGCCCAGGT
TCGTAAGTACATCACGTGTGAAATATGGGCATGAAATTCCCTCACGAGTTTTTTGATTGA
GAGAACACTGCCTGGGTTGTCCCGTTCAGGTGCGTGAAGTCAGCGCAGCTCTCCTGGCTG
TCACAGCGCATCTTGTGTAACAAGGATGGGGAGGCCAGCTGGGCTTGCCGCTTGTGTTCT
AAGAGCTCCTGTTTGTGATGTTTTTCTTCTTTGTTTCAGGATTCAGGAATATCTAGAAGG
AAAAGGAAAGCCAGCACATCTTTAACTGATGAGGAAGGTCTGTCCCCCCGCCCCGTGATG
CCTCTCCTGTCTGCAGGCTCTGTTAATTCTCACTGGCACCTACACATAGGGGTTGCGGAA
GCAGAGGGGTGACTTTGGCCCAGTTGGGAAACTTGCCTTGGTCTTTCTCCCTGGTGTCTC
GGGGCAGAGTGTTTCTTCATGTCTCCAGAGGACCTGGGGTATCTTAGCTGCATGGTGGGA
TCTGCATATGGGAGGGCTGGAACGCAGAAGCACCAGGGTCACGCGTGCCAGAGGGCTGGA
ATGCAGGGGCATCTCAGGGCACCAGGGTCACGCGTGCCGGAGGGCTGGAACACAGGGGCA
TCTCGGGGTGTCAGGGTCACGTGTGCCGGAGGGCTGGAACGCAGGGGCATCTCGGGGCGT
CAGGGTCAGGGTACAGGTGGATCTGTGTGTCTGTGGGCTGAAACTCAGCTATGTCTCCCA
AGATGCATTAGGGTTACCATGCAGGGGGCCCTGGGCCCAGACCGGCGCTGTTTGTGAGGC
CAGGGGTCTGAGCTGGACAGGGTTCTGCCCAGCTACAGCCGGCTTGATGGGCAGGGCTCA
GGCCAGGTGGCCTGGTATGGGGTGTTTCAGGAGAAATCCTTAGCCCTTTCGATGTTGGCA
ACTTCCTCGGATAAAAGCGAACATGTCCTCATTGCGCACGTGTGTGTGTGTGTGTGTGTG
TGTGTGAGCAGACACGGCCCCCTGGCCATCAGCCGGCACTGTCTGCCACCCATGGGTCGT
GGGGCCAGGCAGATTCTGACCTGTGAGTGGGCAGGCAGGAACAAGAGGGCTGGGACAGTT
GTCAGGGTGCCGCTGTGGGGATCCCGTCCAGGTGCCGGTAAGACCGCTGTCTCCACCAGC
CCCTGGTCAGTACCACGTGGTTTACTGGCTGATGAGGCAGTGTGTGTTAGGTTTCCACGT
TCTGAAAGATTGCTGTTTCGGTGTTTATTTTGTCTTTACTGGGGAGTTTAGCCATTATTG
GCATAGTGAACTGTGCCTGTGAGGACTAGCTTCTGTACGTGGCAGGAAAAGCTAAGACAG
CTGTGGCCAACACGAGCTAGAGACCTGGAGGGTATCTCCATCCTTCTTGGTCCTTGGTGG
TGTAGTTAGCTCCGGGTGCTCCCGGCAGTGTCCTCCCAGGTTGCAGGAAGAGGGCACGTG
TGAGAGCCAAGAGGGCCCCTCTTGCCTGGTTGCCCTGAGCGGCCGCCTCTCAGGAAGGTC
TTAGCCAGCAGTCCTCTGATGGTCTCCATCCAGCACTGTGTCAGGCCACCGCTGCTGTTG
GCAGGAGGCTGGTAGCCCTTCCCTGCAGGTGGTCATGGGCCAGGCACGGGGAGGTCACTA
CGGAGGAGCGCCCAGCAGTCGGTATGTGCAGGGCGGTGTGGCCAGTGGGTGCAGTGTGAT
GAGGGGGTGGCGGCCTTGCGGAGAAGACAAAGCATTGGACTGGTGGCAGCTGGTGGCTGG
TGGTCGGTGTAGACGTTGTTCAGTTCTAAAGACAGAGCCAGGGGTTGTGTGGTGCTGATG
GGAAGGAGTCACTGAGGGGAGCCCTGGCAGAGGATGGGGTCTGTAATGCACTGCAGGCCT
TGGGTGACAAGGGGTTGTGCTCCCATGGAGAGAGGGCTCCCAGATGGGCATCCTGATGCT
GTAGGCTGGCGGACCCTTTTCTGAGAGCAAGGTGCGAGGACTGAAGATGTCGGGGAGGGG
AGCTGGTGAGAGGCGGGGCCGTGGAGGACAGGAGAGGCCCCTTTTGAAGGGATGGTGGCT
CGGTGGGTGAGAGTTCGCCCAGGGCTCCGCAGGCCCGCCATGCATGGAAACACCAGGGTG
GAGAAGAAAAGTGTGCTCCCTGGGTCCCACTTGTTGATGAGCTATCTGCCAAACTTCGTT
TGAGAAAGACAAAGCTTTGTGCGAATTTTTATAATTACTGTAGTTTATGCGAAGCAATTT
TGAGGCTGTTTAGTGTTTAACGTGTAACTGGAAAGGTCACGTGAAGTCTTTCATTGACAT
TTGATGACAACTGTTTTAGTGGAAGATGAAGACGAGACGATTGAAGAGGAAGAAGCAAAC
GAAGGGATGGTAGACCACCAAACAGAGCTGACTAATTTAGCCAGAGAAGGTAGGCTGACA
CTACCTTTATTGAGAACTGCTGTCGTTAAGTATCGAATACATACGAAAAAGGATTGAAAA
AACACGTGTCAGATGTAAAAAGTAGCGCTGGATCAAGCACTGGGTACACAGGAGAGCGTG
GACGTCCGTGCACGTGCTCCCTGTGCACAGGCAGTGAGAGCAGCTCACAGTCACCTTCAC
AGAATACTGCCGGGTTTTGTTGAGAGCCACATGTCCAGCTCCCCCATCCCCCACCACACC
ATTCCCGTGTCCAGCTCCCCCATTCCCCACACACCATCCCCACACACCGAGGACACAACT
CCTCCTTGCTCTGATCTTGAGGACAGAGCATCTTTTCTCCAGGCGAGGCGCTGCCTCTTT
GTGTCTGGCCCACCCTGGTGTCAGGTTTCTCTGCTCCTCCTTGTTTGCACGCGTTCTCTG
TGTCGGACATGGTCGGACGTGGCTTCGTGGCTTCCGTATCAGTAAGAGGTGCTGCAGTAG
TCTGTTTCCAGGCCGTGGTTTGCCTTTTCGTTCACTTGATGGCACGTTTTGGTGAGCAAG
TGTTCTTGATTTTAGTGTTGTTGAAGTGTTACCAGTCTTGTTAAAAAAAACCCTTTTACC
TTAAGATAACGTGGGTGCTCCTGTATCGTGGTGTAAACATTGTCTTTACGCATGTTGATG
TCTGTAATCCATCAGGAGTTGCTTTGCCCTCCCTCACCTCCAGTACGGTTGCTGACTGCC
CCTGCTCTGTTTAGAAAAGCCTGTCTTCCCCTCGCTGATGGCCACTGCCGGCGCAGCCAT
AAATTAAGTGTCCTTGTAGGCCTGGCTCTTCCTGGGACCTTTGTGGTTTTATTGATGAGT
TTGTCTGTTTTGTACCCATGCTGCACCGTCTGAATGACTACAGCTTCATGGGCATTGTTG
ATGCCCAGTTCACCAAGTCCCGCAGCCTTAGTCTTCTTTAGGAGGCTCTTGATGGTTTGG
GGCCTTGGTGGATTCAGTGTTGAATGAGAACGTGGTGGTGGTACCTCTGCCTTGATTTTA
AAGGGAACACTTCCCGGGAATGGCAGTCTTCTGGGTTGGTTGAGCCAGACTTGCTTGGTT
CATATCTCACATCTGTACCCACTAGCTCCGTGACTTACGCCCTCTGCCTGCTTGGTTTCC
TCAGTTGTGAAGCAAGGAAGAGTTGTTTCCTCACGGTGTGGTCCTGAGGACTTAGTGATA
ACATGCAACGTGTGCAAAACCTGGCCAACTGGACGCACTGCTGCAGCCCACAGCTGGGTC
CCGCTCCTCGTCAACCCGATTATTATTTTTTTGTAGGTGGAAGTTTACATAGCAAATGAG
TTTCTCATTCAAAAGTTATACGCAAATTGTTTTGTGACATTGGTTGTAATCCTGCAATGT
GTCAGCGCTCTTCCCCTTTCTACCCTGGGTTCCTCGTGTCCATTCGTCCAGTTTTCTCTG
TCCCTTCCTGCCTTTTTGGTGTTACTTTTGGGCAGGTGTTGCCCATTTGGTCTTGTATAC
TTGATTGATCTAAGAAGCACGTTCCTCACGTGTATGTGTTTAGCGGCTGGTGAATTCGAA
CTGCCAACCTTTTGCTTAGCAACTGAGCTCATAACCACTGTGCTGCCAAGGCTACATGTT
TGTTTCATAGGCTTGTCTAATCCTTGGCTGAAGGGTGAACTTTGGGAGTGGCTTCAGTTC
TGAGGTAGCAGGGTGTCCAGGGGCCATGGTTTCAGGGATTCCTCAGGCTCTGTCAGACCA
GTGTGCTCTTTTTTGTAAATTTTTATTTTGTTCTACATTTTCTCCAGCTCTGTCCAGGAC
CCTCTATTGTGATCCTTGCCAGAGCAGTCAGTGGTGGTATTGCTCAGCGTCTTATAAGGC
TGGAGTCCACGTGCCACTGGGCTGCTGCTTCTTTGGAGGCTGGGGGGCTCTGCTCTGAGC
CCATCAGGCTGTTGCTGACCTTGGCTCCTTACAGGACACGACCAAGGCCTCCCTCTCCTC
AATGGTGCTCAGCAGCGCTGCGCTCAGCTTCCAGAGGTGCCCGTAGTCTTTGCCTGAGTC
TCGTTCACTCCTTTAATCCCTGTGGCCAGAGAGAGCCCAGCCCCTTTTGGGGCTCCCTGA
TTCTGTCAGGCTCACTGAGCGAGCATAAAGCTCCCGCCTTAAGTCATCTGACTGGAGACC
CCGTTAGCAGCTGCAGATCTCTCTGCCCTGTAAAGAACAGTCACGGGAGTGGCACATGAC
TGTCATATTCAACAGACAGGTCTCACTCAGCAGGAGGGGGTGACATAAGGGGAGCCATGA
GGGGTCAGAGTTCTGTCTAGCGCAGTCTTCTTCTGTTCAGATTCTTGTTCTGTAACTTTT
CGTATGTCAGAGTATTGCTGTCACTCTTCAGATATTTCTAGCCTAGTTACCTGTGGAGTC
GCTGTGAGTTGGGATCGACTCAACGGCAACGAGTTTGGGGTTTTTTACCTACTTGTGACC
ACCTGCTCTCTAGAGTATCCTTTTCTGGAGTCCCAGCATGCCCCTGTTCATATGTCTGGG
TTTGCCAAGGGAGCGTGGGACCTGTGAAGCAATAACCCAGCAGTTGGTGCCTGAAACCAC
ACTCAGTCCGCTCCTGTCTTTGGGCTAGGAGTTTGGAGCAGCTAGGCTGGAGATGTGACT
TGGCGGGTGGGAGGCGACCCCAAGGTGGCGCACCTACCTGCGGCTGGGTCCTCTGCTCCT
CGCCACGTGGACTTCCTGTGTGACAGCTCGATGTACTCGTGATGTGGCAGCTGGTTTTCC
CGCGAGCAGGGCAGATGCTGCAGTGCTTTCTGTGAGCAGCCTTGGGGGCCCACAGTCAGG
CCTGCGTAGTGGGGCAGGGCCCACAGGGAATACCCAGAGGTGGGGTTGGGGACTGCCCTG
GAGGCTGGGGGGCCCACAGTCAGGCCTGCGTAGTGGGGCAGGGCCCACAGGGAATACCCA
GAGGTGGGGTTGGGGACCGCCCTGGAGGCTGGCTGCCACAGTATCCTCACGACGCTGTGT
GTCACCCATGGCTGGGTGTGCCCCCAGGAGCCACCTCAGGGCTTTGTCTTGTAGGTGTCC
ACAGTGCTTAGAAGCTCCACTTCAGTAAGTCCTTTTCTATCTAAATGAGGTCTTTTTTCC
ATCGTTATCTTCTGCCTGGTTGTTGTTTGTTAGGTTTGTTCTAAGGCTTCTTGCCACATT
ATCTTCTTATTGTAAAGGTTTTCCAGTGGCTTCCCCTATTTTGTTTTTTCCTAGTTATAT
AGCATTATAACATTTTATTCACACAGAAGAGTTGAAAGGATCTTACTGTGACATTCATCT
CCCCACCGTGCAGGTTCCACAACGAGCAGTTTGCTGTACGGGCTCTATCACGTATCCACC
TTGCTGTCCATCAGTCTGGTGTGGTCAGTGTTTTAAGTTACGGACACATGAATTTAAAGG
GTTTTATTAGTCTCAAGTGGACAGTGCCTTTAATATTGTTCCTTTCCAAAACCAAACCCA
GTGCCACTGAGTTGATTCCGACTCATAGCCACCCTATAGGACAGAGCAAAACTGCCCCAC
AGAGTTTCCAAGGAGCACCTGGCAGATTCGAACTGCCGACCCTTTGGTTAGCAACCGTAG
CACTTAACCACTACGCTACTAGGGTTTCCATTGTTCCTTTAGAGTACTTTTATTTTGAAT
ATTTACAAACGTATTGAAATACAATGTACATACAGAAAACTTCACATATCCTAAGTATAC
ACCTCAAAGTGACCCTACCCTGTTAGATATAACAGGAAACATGTTTGAACACGAATCTGG
GTCCAAGTTTCTGATTATTCTCCTGGATAGATTCATTAAGAGGGGAAATAGCGAGGTTAG
AGAATATTAACTTGTAGAGCGCTAATCTTTCCGTATCAGTTTCCAGAAAAATTAAGCCAG
TTCATCCCATTACCAGTGGTGCATGAGAGGGTCTGAGTCAGTGTTCTTCCAGCATTACTG
TTTTAAAGATGGTTGCTAATTTGGTAAAGGACAGCTGTGCACTGTCTCATTTCCAGAAGT
GCTTGGTCTAAAAGAAGCCCCTATAATGTTAGCCCCTTTGTGCTGTTTGTGACCGTGACG
TACTCCAGAGCCTTTGCCCTTTGTGATTGGGGCTTTGGTCTCATCAGTTGGGGTGAGGCC
TTTATACAAAAAACTTAACAGCTCATCATAATTTTCGAACACTTTTTCTGTTTTTTTTTG
ATTGTTTGAGCCTTTTTTGACATGTTTTGTGTTTTTATGTATCCATTGTTTCCCATCAGT
GGTGTTCATTTTTTGTATTTTTATTACCCTATTAGGTGCTACTGTACATTTATTAGATTA
TTTCAGAAATATTTCTTTTGTTCTTTTATGAACAATAATTGAGTTTCCTTTCTTATTTCC
AGAGATTTTCACTTTACTTTATAAAGAAGGTATTTTAGACTCTGTCGCTAAAGGGCAACC
ATTTTAGTTTTTAGAGAAAATAAACGTGTTTTTAGAAAATACGCTTTTCCCAAGGAATTA
CACATGTGAAAGGATGCCTTGTCGTTTTTCCTGTGGCTTTCCTGGCTTTGTTCTCTCCCA
GGGAAATGACTGGATGTTGTCTTACAATACTGATCTTTGTTTGTGTGATCTTTTCCAGCT
GAGTTGCCCTTACTTGATTTGATGAAGTTGTATGAAGGTGCCTTCTTGCCAAATTTTCAG
TGGCCCCAACCCAAACCCGACAGTGAAGAGACAAGCGAAGAAGAAGGTATGTTTCTAGAT
CTTTAAAGACTTCAGTCTTTCAGAGACCAAAATGCTTTCTGTGGAAGGAGGCTTAAAATG
AGACTTTTAAAATTACCTTCATTTTCGTTTGATGAAAGAAGAAATTGCACATGTATTTAA
TATATGATTTTATATTGAATAGTTTTATTAAATTCTGTGCTTTTTGTTTACTAAACTTGG
TATAATTTTCAGAGCACTTAATCAAGTTGTGAAGAACGTAGAAATATTTTTCTCCAGTTT
TACAGGAGTCGTCGTTTTATGGCCCTAGATTTTTATTGCGTTTATCCATACTGGGCTGTT
GGATAACGTGCCAGTTTTGAGGAGCTTCGTTTACGTTTCTTAACCGTTCCAGATGCACAC
ACAGGACACACTTACAATGGCTGGTGAAAAGCAAACCAGTGTCCACCTCTTCCTTGTTCT
CATTCAGACAGTTCTTGTTATTAGAAATACATGCATATGGGGGGTAGGGTTGGGCAGGTG
AGTGGGGGTCCTGGAGCGGTTCTTGGAGCAGTGGGTAGCCATCCAGACCCTTTCCTGGTC
AAGACCTGCACGAGAGAGACCGTCCTCTTCTGTGCCTGCCTGTGCTGCAGAGACGGCTTT
AAGTTTTCCTTTCTTGCTGATGGGGGGAGATCATGAAGTCCTCAGGTACCTATAAATCTT
CTCCTAGTCTGAGTTCCTGATGGCTGTGGGATACCTTTCAATTAATTGCCAGGTTATTTG
GGGGCAAATTAGACTTGAGGGCTTTCCAGAATAGCGCTGTATTTGATGGTTGCATGAGTC
CCTGTGCGTTTGTCCAGCTGGCATTGGCAGGTGTATGCAGGTTGAGAACGCACAAAGGAT
GACTGCCCAGATCTGTATGTGAAGTATTTGGGTTTGCTGAAGTTTTTTTTCTGTTTTCCC
TTTGACGGTGAGTTGCCCCAGCAGCCCCCGCTTCTGTTCACTGCATTGTTTTTTGTAGAT
GTGGAAGACAGCCCGAGAGACCGGGAGAGCCGGAAGGATCTGGTCCTCATAGATTCCCTG
TTCATCATGGACCAGTTTAAGGCTGCAGAGAGGATGAGCATCGGAAAGCCAAACACAAAA
GACATCGCGGAAGTGACCGCCGTGGCCGAGGCCATCCTACCTAAGGGCAGTGCTCGGATC
ACCACCTCGGTGAGGCCCTGGGCTATCTTTGCTCCTTACTTTTTCTTTAATTGTGGTGAA
AATCACATGACATAAAATTAACCATTTTAAAGTGTATGATTGAGTGGCATTTAGTACGTT
CATTCTCAGCGATGTGCCGCCATCACCATTGTCTAGTTCCAAACATTTTCATCACCATGA
AAGGGGCCCCTGTACCCATTTGCAGTCACTCCCCACCCTCTGTTCCCCCTGGCAACCACG
AGGCTGCTTTCTGTCTCTGTGGCTTTATCTTTTTGGACACTTCATATGAATAGAATCCTG
TAACATGTAGACTTCCGTGACTGGCTTCTTTTACTGAGCGTAATATCTTCGAGGTTCCTC
CACGTTGTAGCACGTATCAGTATTTCATTCTCTTGTGGTTGAATAGTATCCATTGTGTGG
GTAGACCACATTTGTTTACTCATCAGTTGATGGACAGTTGGGTTGTTTCTACCTTTTAGC
TGTTGGGAATAGTGCTGCTACCGATATTTGTGTACAAGTGTTCTCTTCGCACCATCTGTC
TTCGGTGTTTTTGTGTATGTACCTAGGAGTGGATTTGCTGGGTTCTATGGTAATTCTGTG
TGTAACTTTCTTGAGGAACTGCCACACTGTTTGCCACGGCCGCTGAACCGTCTTGCATTC
TCACCAACAGCGTACGAGGGCTCTGATCGCTCCGCATCCTTTCCGATGCTAATTGTTTTT
CTGTTTTTAAATCACCATCATCACCACCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGCTGTAGTTGTGCATAACTTCAC
TGGGCACATGCTGATGAGGCTTCTGCGGGCCAGCTCCTTGACTCGACAGATAGTATCATT
ACACTGGAGAATCCCGTGTCCTTTTCCTTGCAGGTAATTGGGGCCCCCATCTCGTTGTTG
TAAGAAGTTGTAACATACTCAAGTGGGAGCTTGAGCTGAAGCGTTGGTGCCCTGGGCTAA
AGACCCTCCTGTATGTCGGGAGCCACAGGGAACTCAGAGCCAAGAGACAGGTACTTTTTT
TTTTTCCTGAACGATATAAGATATTGTGTTCTTTTTTTTTATTATTATTGTACTTTAGAT
GAAGGTTTACAGAAGAAACTAACTTCTCATTGAACAGTTAGTGCACATATTGTTATGTGA
CTTTGGTTAACAATCCCACCATATGTCAACAGTCTCCCTTCTCGACCTTGGGTTCCCTGT
TACCAGCTTTCCTGTCCCCTTCTGCCTTCTAGTCCTTGCCTCTGGGCTGGTGTGTCCCTT
TAGTCTCATTTTGTTTTATGGGCCTGCCTAGTCTTTGGCTGAAGGGTGAACCTCAGGAGT
GACTTCAGTACTGAGCTAAAAGGGTGTCTGGGGTCCATACTCTCAGGGTTTCTACAGTCT
CTGTCAGACCAGTAAGTCTGGTCTTCTTTTGTGAGTTAGAATTCTGTTCAACGTTTTTCT
CCACCTCTGTCCGGGACTCTCTATTGTGATTCCTGTCAGAGCAGTCAGTGGTGGTAGCCG
GGCATCCAGCTAGCTGTGCCGGACTCAGTCTGGTGGAGACCATAGGTGATAGGTACTTTT
TAAAACAAAACTGAAAAGAAAGCCATCTCACTTTTTACGGAAGGCAGTCTCAAAATGACA
AGACGTGTCTGTTAACGTACTTAATAGAAATTGCTTGCTTGTGAGATACCCTCCAAGCTG
TTTCTTGATTCTAAGGGATGGATAGACCACCCACAAGGAGGGCCACGCCAGCAGGTGGCC
AGGTTGCACGCAGGGCTCGCTCACTTCCCAGGAGCAAGGGACTCTCCTTCCAGAACTGGA
ACGTTCCCTGGAGTGCTGCTGTCCTCCTCAGCTGCAGGCCTCTTGACGGCCACCACCCTC
AGAGGAGATCTGGGGTGTCCACATTCTGGATTATAACTCAAGCCCCATGTGGTCCACCAG
AGCTGTCAGACGCGGTGCGGCTTCGAGACAGCACCGTTGGCTTGAATAGGCCTGTGAGTG
GACTGCTGAGTCCGACTTTTCTTATGATGTCATCTGTGTAGAAATGTTTAGGGATAAAGT
GAATGTATATTGACCAAACTCTTCATTGATAAAATTGGGTGTATCATTGGACTTTATTGT
GTTGTACTTACTGAAAAAGTGAGTACTTTGGGATGTGTTTTCTTTAGCACCTCTAGTTAC
TAATTTGTTTTAAAAAAGTTTAGAGCGCAGTCAGTTGCAACATAGATATAATCACATTTC
CTGTCATCCTTCAAGTACATTTGCTTCTCACTTGGGTTATATGGAGCCTTGGTGGCACAG
TGGTTCAGAGCTTGGCTGTTAACCACAAGATCAGCAGTTTGAATCCACCAGCTGCTCCTT
GGAAACGCTGTGGGGCAGCTCTCCTCGGTCCTCCAGGGTCACTGTGAGTCGGAATTGACC
CGACAGCAACAGATCTGTTCTTTTTTGGTTTTGGATTATACACCGTAGAAGTTAGTTCTG
CTTGAGGAAGCTTGGTGAGAATCTCTGTCTTCCAGATAACATTGCGAATGCCTCTGGAGC
TGCGTTACCAGTTTGTCAACAAAAGTGCTTTAGGCACCTGGAGGAAAATACAATTCAGTT
GTAAACTCAGCCGTTTTCTGTGTGGTAGAAAGCAAGTTATTAAGAAAAATGACTGAAATA
CTCTAGATGGGAACCGATTATTTCAGTGTTGAAAATTTTCAGACATGATCTTAAGTGTTT
CTGTTCTGTGAAGTAAAGGGTTAGGAGGACTGTTGAAACCTTGTTCTCTGCCCACAGGAG
TGGACAGAGCCCCACAGCTTCAATATCTGCATCACATCCTACAAGCGGTTCTTCAGGGGC
TACCACTCCTTTGCCAAGGTGCGGTGGAGGTGCCTGGTCATCGACGAGATGCAGCAGGTG
AAGAACATGACCGACAGGCACTGGGGAGCCGTCTTCAACCTGCACAGGTTTGTACACCCA
CAGGGCCGCCCACCAGAGCCCCCTGCTTTTGTCCTTCAGTGTCGTTGACATGCAGGCGTG
GGGCGAAGAGGTTTAGGGTTGTCTTCCAATTGTAGACTCACCGCTCACCTTTGTTTGAAC
GTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCTATGATGGGCCAGGGACTGAGTGCTGTCTGTGCCTCTCTTCTCCCCATAA
GCCAGGGCCTCTGTGAGGATGACAGGTTTACATACAGGAAGTTCCCAGGATAGTGCCCGC
ACACAGACCTTCAGAAGGTTTTGCTGTGGCTGCCTGCATGTCGTGCTGGTTCATCTTGGG
GAGTCGTAGGGCTGGATGAATGTGTGAAGTGCGCACCCCTGTCCACCTGCAGGCCCATCC
CACCACTCTGCAGTCAGCCCTGGTCATTCAGTCAGGTGTAGGGGCAGCTGGCCACCTCAG
AACCCCAGTGTGTCCTTCCTTCCCAGTCACCACAGGCGCTCTGTGCGTGGACAGGAAGAA
CTGTGCAGTGTTGTGCTTGCGTGCCAGCCAGAGTGTCCAGTAGGATGTTGGAATTATCCT
TGACCGCTCTGGTCAGGTACTGATGTCAGCGTATGGGGAGGTCTCAGCTAAAGGAGTTGC
AGCTGCCGTGTGTAGAGCTAGTTCTGCAGCTGGTCTGTGGGGCGAGCAGCGCCCATGTCT
GCTCCCTCGTTCTGCCGCCCTGGCGTCACATCTCTGTGAAGGGCCACGGGTGAACCAGCG
AATGTGTACGGCCCTCGTGGGGACCTGTGCCGACGTCATTCACCGGATCCAGAGAAAGCC
TACTTGTCGTTATGTTTCTGGAATGAGAAGGATGGGCAGTGAAGGGTCCGTGTGGTAAAA
TGCATGCTCAGGTTGGAATGTTCCGTGTGTTTTCTTAACCGTGCAGCACTCAGGAGGCCC
TGAAGAGCGGGCACTTTGTCAGCGTCCTCAACGTCCTTGTGAAGCTCCAGCGGATCTGCA
ATCACCCGGGGCTCATTGAGCCCCGGCGGCCCGACTCCTCGTACGTCGCGGGTTCTCTGC
AGCACTGGTCCGCCTCTCTGGCTCTGAAGGCACTGGAGAGAGACCTTTGGAAGGTAAGTT
GAAAATTCAGAAGGCAGGTCACTGAGCTCTTTCCCAGGCGCATCGTAGGCGTGGCGTGTC
GTGGAAATGGTTTCCTGACAAGGTTTGTCCTCTGTTTTGAAATTGCCTGATCCCAGACAG
TATTTAGCAGAATGTGTGATGTGCTTGCCTCTAAGGTTAGAGACAGATCGTCTCGGGGGT
ATTGGAGGAGAGATGTTACAGAGTAGCTCACTTGGTGCGTGTTGTTTAACAGCTTTGCTG
AGGTAAGTCACGTACCATACAGTTCACTCTCTGAAAGAGTGCAGTTGAGTCTGCTCTTAG
AGTCCTGGAGCCATCTCATTATCTAAGAGCATTTTCATGACCCCTAAAAGAAGCCCCATA
CTCATTCACGATTCCCCACACCCCCAGCCCTTGGCAAGCACTGATGTGCTTTTTCTCTGT
GGATTTGTTTGTCCTGGACATTTTCTGTGAAAGGGGTCATGTAATATGTGGTCTTTTTGT
AACTGGCTTATTTTCCTCAGCGTGTTTTCAAGGTTTACATGTTGTAACACGTATCAGGAT
TGACTTCTTTTTTATAGCTGAATAGTATTCCATTGTCTGGATGGGCCACATTCTGTCTGT
CAGTTGGTGAACATTTGGGTAGTTTCTGCCTTGGCTGTCACAAATAGTGCTGCTGTGAGC
ACATATACAAGTCTGCGTGTGGACATGTTTTCATTTCTCGGGCGAACATGCAGGAGTGGG
ATTGCTGGTCGGATGATGGCTCGTGTCTGCCGCTTTGAGGGACAGCCGGCCTGTTTTCTA
CAGCACGCACTGTTTGCATTCCTACTCCCCCTTTATGGGGTCGTCTGTCATTGACCCTCT
GTCCTGCTGGGTGTGTGTTGAGCCGTCATGGTCTCAGGCGTGGTCCCAGGGGAAGCACTG
GTGTGTGGCAGTGGGATTACTGTCCCAGCTGGTGTGTGGCAGTGGAACCACTGTCCCAGC
AGGTGTGCGCTGAGCCATCTGTTATGGCCTGGGCATAGTCCCTGGTGTTGGGCTGAGTCC
TGTGTCCATGACTGCGTCCTCCCTGCCACGTGTGTCCATCTGTCACTGGGACTCTGGCGG
GCTGCCATCATCGCCCTGGAGCAGGCTGGGCATGGATCCTGGGTGCCTGCGATGAGCCCA
CGTCAGCCTCTGCTCACACCAGCCCACTTGGCTCTCCCCAGCTCACCTCCTTGTTCTGTT
GTCTGTCATGCTGTTCAGGCTGGTATCTTCTAGTCTCTTCCCTCTGCCTGCTGCTAAATC
CTCCCCATGCCCACCATCTCTGGGGAGAGCCACATGCCGTTACTGCCCATCTTAGAGAGC
CCGGCCCCCTGCCCAGCTCCCTGCAGGGCCTGTGCTGGGCGAGGCTTTCCCATCAGGACT
GTCTCGTGGTTCTCAGTCATGTGCTCTTCCTACCACATGTAGCAAGAATTTTTTTTTCCC
TTTTTTCCTTAGGAAGCAGACCTCTCTGTGTTTGATCTTATCGGGTTAGAGAATCACCTC
ACTCGCCATGAGGCAGAATTGCTGTCAAAGAAAAAGGTGACACGGAAGCTTCTTGAAGAG
ATCTTCACCTCGCCCCCACCATCAGCCAGACCCGTTGCAGTAAAGCTGAAACCGAGCAGG
TATGTGGCTTGTTGAATCTAAAACATAAGCTCTTCCTGCCTCTCCACCCTGACTCCGTTG
TTGGACTGCTGCTGTGTAAAGCCGCCCTCACCGCTCTTTCTGCCAGTCCTCAATCAGCTC
AGGGCAGGCAGGGGCTGTGGCTCCCAAGGGTGGCGGGAGTCGAGGCCCCTGACTGAAAGA
CAGTGTGTAAGGCCCCCGGCAGTGGACCTCTCACACATAGGAGGCCTGGGCTATGTGTGG
GTTTCCCATAAGGACCCAGGGCTGCAAGTGGTGGAAGGAAGACGCTCACTGGGATGGATA
TCTACTTCTGGAACTTTCCTGATGGCCCTTGGTTATGTGAGATCTGCTACTTAGAGAGTG
CGCTTGGCACACAGCACCTCCCTGAGCCAGCCGAGCAGCTGCGCGTGTGCCTTCTTGATC
AGGATGTCGGTGTCTTTAGCCAAGCCTCGGGGTTTGGGAGGGGTGCCTGGGAAGGGGCCG
GGGGTCTCCCCTGGGCCTGGATAGCCCACAGAGTGGAACTCGGCCTGGTGCCTGGGCAAC
AGAGTTTTCCCAGAAGATGCCCAGATGGCAAGTACAGAGGGGAATCTGGGGCTCGACTGG
CTTCACTGTGGTGCTTACAAACCATCAGTGGCTTTGCAGGTACCACAGAGCTGGTGGGAC
AGAAAACATGAGCTGATGAAACCACAACACAAATGAGTCAGGAGGGGCCCACCCCAGTGA
GCTGGCAGCCAGGGGTGGAATATGTGCAACCCTGTGCTGGGGTTTTTAAGCCACAGAGAA
TAGAGAAAGTGGGCAATTTAGAGCTGCAGCCTGAGGGTGAGTGTAGGCTGGGGAGCAGTA
TGAACCATTTGTGCCTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTCCCGTTAGCCCGTTCCTAAGA
TAGAAATAAGAGTTCAGAACTGCCCTGTTGCAAAATTCCCTGTAGAGATAAGAACGGAAG
CTCTGTTTATGCTACTGGGTATGTGTTTAGGAGAGCATTTCTAATTGACATGAATGCTCA
CTCGATGGGGCGACTTCAGTACTTCTTTATTTGCACCGAAAGACGTACTGATTGGCTCCA
AGTGAAAATAACCGTCCGACAAAGGTATAAAATTACATCTCTCTCACCGCGTGAGGAGTA
CTGGGCCTTTTCTTCTTAAGAGAGGGCTCCTCAGTAGAGAAACAGTATGAGAGAATGTTC
TTTTTATTTCTTTGAAATTCGGGTTTAAATATTGCATTTTGTCAAGAACCTTTAACAGCT
TTGCGCAAACACACCTTATTGATTGCAGCGGCGGCCGCACAGTGTCAGCCACCTCAGGCC
TCCTCCAGTGCTCCGAGACACCAGCCCGCCACGACCTTCACCTCCGCAGCTAGCGCAGCC
CATCCTGCCAGCCTGCGGGGCCCGGCCTCGGCCCCGGCCCCTGGCCCGTCCCCGTCCCCG
GCCCCCGCGCACACCGCCCCGCAGAGTGCTCTGCCCCCGAGGCTGGTGCTGACCGCCCAG
GCCCAGGCTCGGTTGCCGAGTAAGTGGCCTCCAACCTTCCCCAGGTCTCTGCCCTCTGAC
CCAGAGGAGTTGTTCCGTGAACACTGGCGTGAGTGAGGGGCCTTTGCTGTCCACTCCTTG
TCTCTCCCTGGCCTGTGCTGGGTGCTGCCTGCAGCAGCTGCAGCCAGTGAAGGCAGGCGC
GGCCTCGCAGGTCAGCGTCCCAGCCCTTCTTTACCTGTCCTTCTCTCTCCTCACTCCCAC
GTGCTCCCTCTGCTGTCCTCATGCCGTCCTGCACTGCTGAGTGCGGCTGACGGTGCTCAC
ACTGACGTTAGTGCAGCCTCTGTCCCCTCAGTGGCCGGCTACCCTGGGGAAGCGAGGTCT
CCTAAATGGAGGCTTCTGCTCACTCTGCCCCAAAGCCCCTAGTTCTTCTAGTCTCTCACT
TAATACCAAATTTAAACATGGAATGAGCTACTGCTCAACTGAGAAATTTTGTAACTTTAA
TAACTAAACCACACCAGTCTTAATAATTTTTTATTTTTTAATGGCACAACTTTTTACTGT
GGCCACTGCGATTAGCGTGCCCCTGAGTCATTCTGCCATGGAAGGTTCCTGAACGTCACA
TCTTAGGATTGTGTCGTTTCTTAGATGCCACCTCAGGGACGTTGGTTCTTGGTGTTGAGG
CCTTTCTGGAAAGAGAAGAGTGAAGCAGTGGCAGGAGGAGATGCTGGTTGCAAACCCATT
TTCTCTTGTGACAGGTCTCTCTTCCACTGCCAGTGGTTAGAGGAAGTGCCCGTTGGTTTT
CCCAAGGAAGGAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCCTGTCTGCGTAGTCTGTAGA
GATACAATCTCACTTGCCTCTGTGAGCTCAGTTGTGAGCTCAAAATTTTTCACGTTTAGA
AAATTCTCTGAAATTCAGGTGTATGGGAGTTTCCGAGAGTATTACAGATACAAATAGATT
TCTGCTATTTTTGGTGTTTGCTGCTTTTCTTATTGTTTGGGGAGAAAAGTTAAGTGTTCC
TAAATAGCTCGTTAACAGTATTAACATCTGATATCCAGAACCCCTACGGGTTAGGGGTAA
ACAAGTTGACCATTAGGCTCTGATGTTAATTCCTAATTGCTTTCTCTTTTCTGTGGAAAC
AGTTTTGTTTTTTTTTTTTTTTAAGTGGTAGAAAGCAGTCTGGGTGCATGTCTCGGTGAC
ACTGGAGCCCACTGTAGACGGTCACCCTGCACGACAGGTGGCCGCAGCATAGCAGGCTCC
CCGCTGCTCGCAGCACGTTTTTAATTCCCCTCGCCCTCTGCGTCTCCACAGGCGGAGAGG
TGGTGAAAATCGCTCAGCTGGCGTCCATAGCAGGGACGCAGAACCGAGTCACGCAGCCCG
AGACACCCGTGACGCTGCAGTTCCAGGGCAATAAGTTCACCTTGTCACACAGCCAGCTCC
GGCAACTCACGGCGGGCCAACCCCTGCAGCTGCAAGGTGAGAAGTAAGCTGCCGTGACGC
CCACCGTGATGGCAGGAGAAAACCCGCCGGCAGCGCACTGCCTGTGGAGATCCCAGCCTG
CTGCGTCAGTCCTGGCTGAAGCCCTGGACCTGCCACGCAGGGCGGGTCGCTTGGCCGCTC
AGCCCCAGGCCTCAGGCTGTCCATGTGCATACGGTGCTGGTAATTCTTACTGAAAGGGAC
GGTTGAGATGGTAGACCGAACCGCTGGGTTGTGTGGTACCTGAAGAACCTTAAGTAAATA
ATGGCTGTTTTTGTTATGCATCCGTTTGAAAAGAGACTCCTCTTTTTAAATTAAAATAAG
GAGATTTCTAATTTTAGTGTGAGATAAATTGTCCTAAGATGTCAAAGGATTAACACTTCA
CGTAGGAGAACTTGGTCTCTGTCATGCGTGGACTATAACTCTCACCCCTAGGACCTTTGA
GAGCGGTGCCCATTACTCGTCCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGTCTTCGCACATTGGCAGAGGGCGGCCCTGGCTTTC
CCCTCACCCTCTGTGTCCCTGTCGCACTCCGCACATTGGCAGGGGGCGGCCCTGGCTTTC
CCCACGCCCTCTGTGTCCTGTCGCACTCCGCATATTGGGAGTGGGCGGCCCTGGCTCTCC
CCATGCCCTCTGTGTCCCTGTCGCACTCCGCACTTTGGCAGGGGGCGGCCCTGGCTTTCT
CTGCACCCTCTCTGTCCCTGTTTCATGCAGATAAAGAATCATGTGTGTTTGTGTGCCCTC
TCCAACAGGCCACCACGCACAGGGGGCCCCAGATAAGTTGTGAAAAAGGTGATTTGAAGG
GCGCTTCTCAGATAACTGTTTTCTCATCCCTGTTTTCGACAAAGGAGGAAAGGGCCAGAC
TCCTGAAGGAGAGGTTGGATCAGCTCTTCCTTGTCAATGCAAGGCGCTGCTCCCGAGCAC
CCATCTACGGCCGAGACCTGCTGGGGCTCTGCTCCTTGGCCATGCAGGGTAGGGCGCCTC
GGCCCAGGTCTTGTGCCAACGACCACAGGAAGGGGGCAGGGCCCTCAAGTAGCAAGAGTG
ACCTGATTTTGACGCTGAGCCAACGTAAAGAATCCCTGCAGGATGTTATTGATAGGTATG
TTCACCTGCGTAAATACGTCCTTAAGTGTATTGCACTCCGACAATTAGCTTTCATGGTTG
TGTTGTGGACACTCATCCTATCTCCAGAAGTTTCTCTGTGAGTTGTCACATCTGTTTTGA
AAACTCCTGGGGTATTTGGCTTTATGGTAAGATACACCCTGTTGTCTGGGGTCTGCTGGA
ATGACTTTCTCTGGCGCCCACCTTCAGGAACGCCTGCAGGCCCTCCCCCTGCAGGTTGGC
CTGCTCCCCTAGGCAAGGTGCGTGTCCTACCCTGGGGGGCTGCTTCAGGTGAACTTGGGC
GTTCCTTGTGCCAATTTCTGCATATAGATAACAAGTAATTGTTGATGATTTTGTCCATTT
TGCTCTTTTAAAAGCATAGTTTTTTGAAATAACCACGTGAGGTGTTTAATTTTATGAGTA
ATGTGTATAAACAACTAAGAAACATGGTTTAAAGAGAAAACAACAGCCCAAGTGTACGGT
TTCAGCCACTGATGCTCGTTGCCTCAGCAGGATTTCTAGGTTCAGCTTCGGACAGCATTT
TCTCCTCTTCCTTGTTTCACTTCTTGGTTGAGAGGCGATTCTCACGCTCACTCCATGTTT
ACACAGGGAGCCCCACGGGCCCTGTGCTCGGCTCAGCCTGCAAGATGGGTCTCTTTTAGG
TCCCTCAGACCAGAAGCTGAGTTTGTGGGCAAAGTGAGTCCAGAACAGCTCCCAGCTCTC
CATCCTAGCTTAGCGACCTCTTACACTGACGCGGCTCTCATCTGTCCTCCCTTCCTTCTT
CTTCTTCTGATATGGCAGACAGCTTTTTATATGGATACAATTGGTAGCAAGTCATAGAAA
ACCTAACCAGGTGGCTCGTACAGGAAGAGATCAGCTGGCAGGTGACGTCTGCAGGTGGAC
GGGTGGGCTCCAGGTGGGTAGGTGGAAGGCTTGGCAGGGCCTGGCCTCCTGACTCTGGCT
TCCCTTGTGGGGCTGTGGCTGGAGCAGCTCTGGTATTCACCTCTGGACCAGCCAGGAGAC
AGTACCTGTGTCCTCAGACTCCTGCAGGAGACAGGTGTAGGTGGAGTGTGCCACCTTGGA
ACCAGCTCCTGCAGTTGGGGAACCCTTCTGGTGGGTTTAGTCACTGTGTGGAGTGGAGCA
GGGTACCCCATTTGGCCAGGACCTGTCCGGGTCCACCCTGTGGGTCCCCACCGCACGGGT
GCTGTTGGTGAAGGACACACAGGCCAGCCACCACATCACCGTGGTGACACAGACGAGACT
CCCACTGCCGCTTCTGTGGGACCTTCCTGCAGAGACTCTGGACGTCACCGTAAACAGAAC
AGCCACGGCCTGTCAGAGGCCCCGCAGGCGCCACACAGTGACGGAGCTGTCTTCTTCCTT
CAGGGTGGCGTGTGTGATTCCGTCTGTGGTTGCAGCACCCCCGTCCTTGCGGGTGGCGAG
GCTGCCGTCAAAAGTACAGCCACAGGATGAAGGTTTTTAGGCACTGTCTCCAAGAGCACA
TGCCCCCCGTACTTCCAGCAGCTGCAAACGGGAGCCACAGCGCTGCACCTGTNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGTGAGGTGTGGGAGGTGATTGGCCGTGGGCCATGAGACACTCAGTGTTACCCT
TTTTGTAGGAAAGCTAGAAGCTCTGGCCATCTTACTTCAGAAGCTGAAGTCGGAAGGACG
CCGTGTGCTGATTCTTATCCACAGATGGTGCTCATGTTAGACATTTTGGAGAAGTTCCTG
AATTTCCACTACCTCACCTACATACGAATCGACGAGAACGCCAGCAGCGAGCAGCGGCAG
GTGAGGAGTGAACGATTTCCTCTTTGTCGTTTACAGTTGGATGACATTGCTGTTGGCAGC
ACCCTCGTTGATAAGAGCTGTATAAATTGAGTGATAGCATGATATGACCCTTAAAAATAA
AAGGGGAAGACTGTCTTAATCTATTTGGTCTTTTAAAAAGCCTTCAGCTTCATCTTTGGA
TTTTTTTTTTTAATCTTAAGTGGGTGTGCAGTATGAAACTATGTCACTAGGTGAGCACAG
TCAGCCGGGTGTCTCAAAATAAGAACTGGCCCCCTGCTGCCAGTGTCGCGTGGTGCGGCC
ACTTCGGGAGACAGCCGCGGAGCCGCAACGTGGGTGCTTCTCAGACTCGTTCTCTTTAAG
GAAATGAAAAGCGAAGTGCGTGTCCATTGTTCACTTACCAAGGTAGCTGAGGATGTTCTG
ATGCCGCATGGGACAGTGAAACTGGCTTGCTCACTGGTGGGGCGTCAATCGGTAGAGCCT
TCTGGGGGGCAGCTCGACAGGACATACGCAGCCTTAAAAAGGGAGCCTGCACTCTGACCT
TGAAATCATCTGTCGGGGGTGCTTTCCTGAAACAACAGCAATAGTGCACCAATTCAAGAT
CTGTGTGCACACCTTTCCCTGTTGAAGTGTTGATAACAGCCCTCGGTCAGGGACGATGTA
AACGTCCCCTAGTGCAAGACAAGCGAAGACTTGTCCATGGGCCGCGTGACTTGGCAGAGT
GTTAAGGTACAGCCGCTCTGTGGTATTCCATATGAAGGATGAGAGGTTGCTAACAGTGAC
ACCTCAGAAGTTTTGGAAACATGACAAAGTGTTCCCAGTAGAACATTCAGTGCGAACACA
AGATGCTGAACTGTGGACCACGTTGCCCACTCTATATGCATCGTTCAGCAGTTCTGGCAT
CTTCCGTACACATGCGCAGGCACACACTGATGGCCTGGGAAGACACACATCAGTTTGGTA
ATTATCACATTTTCTTGGTGGCAGTTCAACAAAAGTGTAGAATTCTTGAAGGCAGAGGTT
TGGTGTGTGCTGGCCCTGAAATGTATAGAAGTAATCAAATCCTGTTGCTCCAAGTGAGGT
TGGGGGTTTTTCTTCACGGCCTCGCTCTTCCCTGCTTCCTCAGCCTTACTCCAGAGCCTT
CTCACCTGTAGAGTGCCCTGGCATTGCCTGAGGATAGATGAGAAAGCACGTGTCCCTCCC
CAGGAAGAATCCGCTTTCTTCTGGGGCCTACACATTGAGCTGACAGTGCACGTACGGTGG
AATCTACTGTTCGCACTTCTATGATAGCAACTCGAGTTATCCAAGTAGAACTTAGAGATG
TGCGGTCAGTAAAGATCATGCAGAGGCAGGAGAGCCAGGAGGAGCAGTGAGCTCGTGTGA
CAGAGCCAGGGACACCTGGGAGCATGTGTGCAAGAGAGCCAGGGAGAGCAGTGTGCTCGT
GTGACAGAGAGCCAAGGAGAGCAGTGAGCTCGTGTGACAGAGAGCCAGGGAGCCCTGTGA
GCTCGTGTAAGGGAGAGCAGGGAACGCGTGTAACTTTAGCCCAGGCCATTTGTCACGTGG
AACACAAAGGAAGCAGCTTTGTTGTAGAATGACTTTTCATTGCTAAACATCAGAAAACGT
CTCGGTTTCCCACGTTTATCAGGAGTAACGAATTGAGTATTTCACATCAGGAGCTGATGA
GGAGTTTCAACAGAGACAAGCGGATCTTTTGTGCCATCCTCTCGACTCATAGCCGTCCCA
CAGGCGTGAATCTGGTGGAGGCGGACACGGTGGTGTTCTATGACAATGACCTGAACCCGG
TGATGGACGCCAAGGCCCAGGAGTGGTGCGACAGGATTGGGCGCTGCAAGGACATCCACG
TGTACAGGTGCGGGTAATGCCGGCCTGCAGGCCTGAGGTGCAGCCAGTGAGGTGCTGTAG
GGGGTGTGGTGCGGGAAGTCTGCTGGAAACAGCACGTGCTGCGGAAGAGAACAGAGTTTC
ATCTGTCAGGCTCCTGCTAGATTGTCTGTATTTCCTTTATCTTCTGCAGCTTTGTGTGTT
AGCGTGTAGTTCAGTTCTGTGACTCGGACATGTCCACTCCATCCTCCCGGGGTTTAGCTG
CTGTTCCCCTTCGGGAGTACCTACCTTGAAAGGATGACTCCTGATTCAGATATTTAGACA
TTTAAATCATCTGTTACTAAGATGGTTACGGAACAAAGCATCGTTGAAATTATCTTTAAG
CACAAACGTTACAATCAGGGTTGCGTGCCTGTCAGGTGTGAACACATACGGCCGCACCAC
CATGATCCCGTCACTCCCCAGGGGCATGAGGACGGGAACTGACGAGCACGCAGGGGCAGA
GCCCTGTACATGTGTGAATTCCATGTGCACAGAGCTGGATTTCAGTGTAGCGGCCGGGCC
GTGTGTTGAATAGCTAGTGCTGGCGAGCTGCAGTTTGGTGGGAGGAGGTGGGGTCGGAGC
GCTGTCTCTTGCTTGGTGAGTACAGTGCGGTCCCCGTGGATGGGGTTTACATGTAAAAGT
GAAAGCAAAAACCCCAGAACGCTACTTCAGAGGCAGCAGTGATAGCCGAGAGTTTGAAGG
AGTCATTTCAACGAAACAAAATGCCACAGTAAGAAAAGACAAACTTACTTGATTACATAG
TAAAATAAATAAATAAAGCATTTAGATTTTTAAAAAATGCCATAGGCAAACTGTAGATTG
GGAAAGTTACTGGTAATTCTCACGTTAGTGTCAGCTACCTGGGGGGAAGGCGAAGGTAGA
CAGCGATGGTCCTGAAGACTGAGCAGGAAGTTTCTGGGTTGGGTGTTGGGGAGCACAAAG
GACACAGCCAGTGGAGGGGCAGCACCATGGGCCTGTCCCCTGGAGGGCGGGGCGGGGTGA
GAAGGGAAGGGGGTCACACGCTCCCTGTGCCCTCAGAGGCTTAGTGATCACAGTGTGCTG
TGCTTTGTAGGCTGGTGAGCGGCAATTCCATTGAAGAGAAGTTGCTGAAGAATGGCACTA
AGGACTTGATCCGAGAGGTGGCTGCTCAGGGAAATGACTACTCCATGGCCTTCCTGACCC
AGGTACCGTGTTGTGGCAGGGCAGGCCTCAGCCGGGAGAGTGCGGGTCACGGCACGGTGC
TGTGGCGACCCCTCGCGCTCTCCCCGGGTGCTAAGTGATGTGCTCGCTTGTGCTCAGCGC
ACAATCCAGGAGCTGTTTGAGGTGTACTCTCCCATGGAGGACACGGGCTTCCCGGTGAAG
GCAGAGGAGTTTGTGGTCCTCTCTCAGGAACCTTCTGCCACAGAGACCATTGCACCCAAG
ATTGCGAGGCCATTCATAGAGGTGAGAACAACGTCCCGCCCAGCCTGAGACTGGCTGGCT
AAGGGGCAACCATAGAGGTGTCTCTGGAGCAGCTGTGCTCACTCCACGCAGCTCCAACTG
CTCAGTCTCTGACCCTGAGCCTGCTTCTTCCCCAGCCTTGCCTCCTGACCCTTCACTGTC
CCTAAACCATGAATTACCTGCAGGGAGGCTCCTTGATGGTTTTAAGTTAATTGCGTGTAG
CATCACTCTTTCTCAGAACTGCTCAGTTTTAAAAACACATCAAAATAATCCTGATGTGGA
ACCTTCCCAGGCCCTCAGAAGTATAGAGAATCTGGAGGAGGGTGTACAGAAGTCCTCTGA
GGAGGCAGCATCACAAATAGGGACTGACGTGTCAGCACCAGACGGAGACCACCTGAGACT
CCAGGAGGAGCCGTCTCAGCTAGAGGAATTAGCTGACTTCATGGAGCAGGTTTGGGTTGA
TCTTGTCTTTTGTACTTTAACCTGATTGATCTTCGCTGTAGCTAAATATCGTCAATGTTT
GACTCTTCTATAAAACGTTGTTTGTTTACTTTGACCGAGAACAGTCACCCCCAAGGTTGA
AACCTGGTGGGGGTAATACGAGGAACTCGGCCTTCATTAACTTGCTGTTAACACTGTCCA
AAAAAATTTATGTCCAAACAGCTTACACCCATTGAAAAATATGCTTTGAATTACCTGGAA
TTGTTCCACACTTCCATTGAGCAAGACAAAGAGAGAACCAGCGAGGTAAGAGAATCAACT
GTTGATTATTTTAACATGTAAGGAATCTCAGATTCTTGAGTGTTAAGTTTGGTCTGAAGT
AAAGGTGACTTGCATAGACTTGAAGAGACAGAAGCAAAGCCCACCTGTGTAGAAACTAAC
TGAAAACTCTGTGTGAGCGCCTGTCCAGCTTATTCTTTACTTTGGTATCTTTTCATTTGA
TTTGAGGCAGCTTGCTTGGTGTTCGATAAAGTGTTCTGTGTTTGAAAGAAAAAATGGGGC
CCCTGAAAATGTGTCACAGTGCATAAGAGAGACTCAGGCTTTGACAGGGTGAATTGAAGG
TTTTTGTCAGTGCTTGACAGACAGTGCTTCAGGGCAAGAGGGAGGAGGTGGGGACGCCAT
GGTGCCCACTGCTCGTGGCAGCACTTTCTCCATCATTGCTCCTGCAGGATGCGGCCATGG
CTTCAATGAAGGAGTGGGAGGCCCAGAATGCGAAGACCCTGCAGGAGAGGGAGGCCCGGG
CGCGTGAGGAAGACCCAGAGGAGGAGCTGCTCACGTACACGAGAGACGACGCATACAACA
TGGTGCGTGCGACGCCTTCCACCGCCAGCCCGTAGCCGTGTCTTCATGTCTGAGCCATTT
GAAGGCTGCATTTGTTCTCAGGAGAACATGTCCTAGTGATTTTTTACTTCTCCTACCAAA
ACATTTTAATTCAGGTTTTAAAAACATAATTGTTGTAATAATTGATGCTTTGTTAGAGAC
TTTGTTAGGTAGTTGGGTAGCAGGGATTAAAAAGCACTTGTAAGTCTTATAAATCGTCAT
ATTGGTCATACTTACTCTGAAGGCTTAATAAGTCTTGTGACTTACAGCATGACGCTGAGA
CTTTGTAAAACTCACCCCCGTGTTCCCCATAGGAGTACATCTACGAAGATGCAGATGGAC
AGACAGAAATTATGCCAGTGAGTGATTCCGTTTGCATTTGTGTCTGAATTGGCCTGCTTT
TCATCAGTGACGTAGCTAATGGAATTCTCTTTCTGTGCGCAGCTATGGACGCCACCCACT
CCACCGCAGGATGACAATGACGTTTACATCGACTCAGTTATGTGCCTCATGTATGAGCCC
ACTCCCATCCCCGAATCCAAGCTGCCCCCCGTGTACGTGAGGAAGGAGCGGAAGCGACAC
AAAACCGACCCCTCAGGTACCTGTCCTGTCCCCGCCGTGTGGCCTATGGTGCCGGCTGTC
CATGGCACACCCCTTGCCACTGCCTGTGAAAGGAACCAGCAGCCACAGGACCTTTGTTGT
GGTCTTGGGCCATGGGCATGGTTTTACCTCTTCGTTCTGTGTTTATATGGTGACACACTG
GCAGTTTTAGGAAACCGTTTCATGTTCATGGTTGTAATTAACGAGGAAAGTGAGAACGTG
GCTTTGCCTTCCTCACGTATTCTTAACGGCCCCATTGTGCTCGCTCCCCTTCCTTTGCTC
CTTGCCCCTCGTGAGAAGCGAGTGAGGTAGAGCCGCTCTGAGAGTGCCCGCTCTGTCCAG
CTGCAGGCAGGAAGAAGAAGCAGCGGCACGGGGAGGCGGTCGTGCCACCCCGCTCCCTCT
TTGACCGTGCCGCACCGGGCCTGCTGAAGATGCGCCGAGAGGGCAAGGAACAGAAGAAGA
ATATCCTGCTGAAGCAGCAAACACAGTTTGCCAAGCCCCTGCCGACTTTTGCCAAACCAG
CTGCTGAGTCAGGCCAGGACAGCCCCGAGTGGCTCATCAGTGAGGACTGGGCGCTCCTGC
AGGTGCTGCTTCTGGGCCTGGACAAGGATGCGGGCGTGGGAGGAGGGAACACCTGCTGAC
TCCCCGCTCACGGCATTCCCTGGAACCCCCTTCTCCAGGCCGTGAAGCAGTTGCTGGAGC
TCCCGCTGAACCTCACGATCGTGTCACCTGCTCACACCCCTAATTGGGACCTCGTCAGTG
ACGTCGTGAACTCCTGCAGCCGCATTTACCGCTCCTCCAAACAGTGCCGGAACCGCTACG
AAAATGTCATCATCCCCAGAGAGGAGGGGAAGGTGGGGGCGCGCTCAAGCAGCATAGGGT
GTGCGGTGCTATTGCCGCATCTTGGCGCCTACTCTCCACTGGGGGCACTCTGTCCTTTTG
AGTCCAGTAAGCCAGGGCCAAGGACCTGCATAGAGGTGACAGGTGTGAGTGAGCTGTGGC
TGTCCTTCCTGGAGTTGGCAGCAGTCCTGGGGTCTGAGCTGACACTGGACCTCTGCTGCC
ACTGTCACTGGGAGGGCAGTGTCGCGTCCGGTGTTGCCTGCCGGCGAGTGCCTGGCAACA
CGTCCTTGTACAGAGGCATTAGACAAGTAACAGGATCAGAGACTTTGCTGTCTCAGCAAG
TAGCCAGGGTAAAGGGCAGCAGGTGAGTCTTTCCTCGGGGATTTTGCTGTAGGACAAGGC
TGTGGTGCTTTGAGGTGCCCTGCGCAGTCTGTGCCGGGGTCACCAGAGCTTGGAAGCGCT
GGTTCGTGAATGGCACAGCTGGAAATGGGGCCTGCCAATCAAGGAGCCGCTCCAGCTGGA
GGGCGAGCCCGCAGTGAGCCCCACGCAGGCCTCCCTGGGAACGTACCTTCCATCAGGGAG
CCTTTCGCGGCCGCTGTTTGGTAGTGCTGACGGCCACTTCGCATCTCCTCTTGTCCACTT
TGTTTCAGAGTAAAAACAACCGACCTCTCCGCACAAGCCAGATCTATGCCCAGGACGAGA
ATGCCACCCACACGCAGCTGTACACCAATCACTTTGACCTGATGAAGATGACAGCGGGCA
AGAGGAGCCCCCCAATCAAGCCGCTGTGCGTCCTTTAGCTGCTGTTCCACACCAGTTAAT
AATAGCACAGCCGCTCATAGCTCAGTGCTGGTTTTGGCTTGCCCTTCCTCTTGTTTTCTT
GTGTTTAGTTATTGCTGTCTTCTTTTCTGATTTGCAGGCTTGGCATGAATCCCTTTCAGA
AAAACCCCAAGCACGCATCCGTGCTGGCAGAGAGGTATTTCTGTACTTGTGACTCATTCT
TTAGGGTTGGTTGTGATTTCCCTTAAGTGCCCAGCCCCACCCAGTGAAGGCAGCCGTGAG
CGTGCGAGTTTGCTGCAGGCGTCCACGAACGGTGGCGTGGGGAGAGGCCTGTGTGTGGGC
AGAGCCGGCCGTGGGCGAGACAGACGGCTCCTGGTTTGGCCCACGCGGTTGGGGTCGGGG
TACATGATGTGGCCCTCGTAGGGCACCCACACACGTGTGCACTGCATGTTCTGAGGACAA
CATAGCGATGCATGTCTTAACTTCTATCTGGGGAGAAGACGTACTGCCACGTCAAGGTGC
TGTGAGGCTGGGCAGGCTGCCTCCTCTGTTGCGCTTTCCACTAGGCTGTCCACACCACGG
GCTGGGCCCTGACTGTCCACCTGCGCCAGGGTGAACGCCCTAAGCGGAGACGCAGCGGAG
ACGATAGGAGAGGGGTTGGGGAGGGCGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCCAGGAAGTGCACTGCGG
AGCTCCTGGGAAATTGGACCGGACCCACCTTCCAGGAACAGAGGAACGAACCTTATACCT
GGCGTCCAGGTGTAGCCCCCCTGTGTGCTCCCTGGGCGCCTGTTGTTAGGCTAGACTCCT
TCGCTTGGTGACCTTGCCACGCTGTGCCCCATGCCCTTGGTGACATTGGACACTGCCTCC
AGCATCCAGAAGCCTGGGGAGCGAGGGCGCTGGTGTTTATAGAGACGGTGTCTCTTAGAA
CCAGCACGCTATATTAATTGTCTGCCCTTGTCTTTCAGCGGGATCAACTATGACAAACCT
TTGCCCCCGATTCAGGTGGCATCTCTTCGTGCAGAGCGGATTGCCAAAGAGAAGAAGGTG
GGATGTCTTGGCATCATGACCTTGTTCACAGTGGGAAATGCTGAGTGTTACCGGGTCAGG
TTTCTGTTCCTCACACCTGGCTTCTCCCTCCCTTCCTGGTGGTTTAGGCTCTCGCAGATC
AGCAGAAGGCCCAGCAGCCAGCTGTGGCTCAACCTCCCCAGCAGCCGCCACCACCGCCAC
AGCCACAGCAGCCGCCGCCGCCGCCACTGCCCCAGCCCCAGCCGGTCGCCAGCCAGCAGC
CCCCCGGGCAGCCAGCAGTCCCAGCCCAGGCACAGCCTCCACCACAGCCACAGCCTGTGC
AGCCACAGCCGAAGGTGCAGCCAGCAATAACCACGGGGGGCAGTGCTGCTGTGCTGGTGA
GCAGGTGCCCGTGTGTCAGATAGGGCCGTCTTGGCCGGCGCTGGCCATGCACCCCCACAT
TGGCGCCTAGTTGATGCAAATGCTTGTTGGGGGTTCTCTTGGTGTCCAGCCTGTAGACTG
TGTGTGTATATGTGTGTGTGTGTGTGTGTGTTTGCCTATATCCTCCCTCCCTGTGGCTCT
AGGGTACAGTTATCTCAGCTCTCACAGCTCTGGGATGCAGCTGTCTCAGCCCCCACGGCT
CTGGGCTGTATAGCTATCTCAGCCCTCACGGCTCTCGGGTGTAGCTGTCTCAGCCCCCAT
GGCTCTGGAGTGCAGCTATCTCAGCCCTCACAGCTCTGGAGTGTAGTTATCTCAGCCCCC
ACAGCTCTGGGGTACAGCTGTCTCAGCCCTCACAGCTCTGGGGTGCAGCTCTCTTAGCCC
CCATGGCTCGGGTGCAGCTATTTCAGCCGTCACAGCTCTGGGGTACAGCTGTCTCAGCGC
CCATGGCACTGGGATACAGCTACCTCAGTCCCCACGGCTCTGGGGTGCAGTTATCTCAGC
AGATGCCCAGGGAGGCTGAGGCAGTTCCTTACTGAAACGATGGAGTACTGTGGAATTAGA
AAGATTTCAGAACTGTGATAAGCTGACCACTTTCCCTGCAAACATGCAGAGCAGACACTG
CTGGGGACAACAGACAAACTCTTCTGGCCCCGCCCCTTGTCCTTAGAACATGTTCACGTG
TGCTCACGCATGCACAGAAACCTTATAGCTAACTGATGCCCGTTAGAGCACGGAGGTTAC
ATACGCAGAAGGCGTGAAGGGAAGAAGGCTGCTGGGGGCCCAGGTGCCCCCACTCACCTT
GGTGTGTCTTGCTGTGTGTGGGGGGTGGGAGCGCACGGTGGCCACTTGCCAGGAGCGCGG
ATTCGATTGCTGGCAGATAAGAGCTGGATGAAGGAATTCAAATGAACTCTCTCTCTAAAA
CAGGCAGGAACCATCAAAACGTCAGTCACTGGGACAAGCATACCCACTGGTAAGAAGAGA
ACAGAATGTTGAAAGCTGAGCTCAGTTTTCTGGCTGTGTCGTCTCATGCGTGTCTTCCAT
GCAGGCACCGTGAGTGGGAATGTGATCGTGAACACCATTGCGGGTGTCCCTGCTGCCACC
TTCCAGTCCATCAACAAGCGCCTTGCCTCCCCCGTAGCACCCGGAGCTTTACCTGTGAGT
TGTCCTTGTACCCGGGACGGCGAGTGGCCCCGTGCGTTGATGCCCAGGGGGAGCCATTTG
AATTTTTTTTTTTTTTTTTAATGTTTTCTTAGTGTAAAAACTTTAAAGGTCTAGCTGGAG
TTCCATGAGATAATTTAAGTAGCTGATCAATATGGCGGCTTCAGAGCCATCCAGGTGTCA
AGGGCATTTCTACTTTGTACCGTTTAAGGGAATGAAGCTCCCAGTTTCCTGTGTGTGCGT
GTGCCATGAGGGTTATCACAGTTCAGTTCACAGAGGTGCCCGGTGTGTGGAGGGGGGGTA
GAGGGGTGTGAGGGTCATCACGGTTCAGCTCACAGAGGTGTCCTCATGTGGGGACACAGA
TTGTGAGACTGGCGTGCACCGGGGGTTGGGAGGGTGCCACCTGAGGAGGAGATGTGGCAC
TGTGGCGGGGTGCATGATGGCCAGTGGGGCATGAGGCAGGGAGCTGTCACTTCCATATGG
ATGTCTGGCCCCCAGTTGTGGGGACAGGTGGGGCCAGACCTGGGCAGAGAGGCAGACCCA
GGGCACACTGAGCCCATGGCCATGGGGGGCACTGAGCCTGATCACAAGGGGCACACCAGT
GTCTACTGCTTGCTTCTCTTTGGTGTCTCAGAGGTAGTTGCGAGGGTTTGTCCACCAGCT
CACTGAGGGATGAGGAGGGTGGCAGGCAGACTGGGGTTTCGTGCCTTTGCCACCGTGGCT
GCTGCTGTAACCACTGGCCGGGAGTCAGGGGCTCGGGAGGCAGGACGGACGAGCAGTGAG
AGTGTGTCATTTCGGGCAAGACCCTGAGGCCCTGAGCCAGCAGTAGGATTCTGGGCTATG
GCTTCTGCCGAAGACGAGGGATACCAGTGGGCAGTTAGGATGCTGGTTGGTGTGCTCTGG
GGATGAACACGAATGTCTAGTGGGTAGTCAGGAATTTCTTAATGTCCCTTGGGACCAGAG
CCTTTGAGTGGAGACAGAGGGGCCAGGCAGCCTTACAGGTATGAAAGGGCGATGTCAGCC
AAACCATTCTTCCCGTGGGACCTGCCTGTCTCGAGGGCTCCGGAGCTGTGGGCACCTGTG
CGCTCACGCCTCGGACTCACACACGGACCCGCGCTTTGCAGCGCTGTGTGTGTGTCAGGG
GCCTGAGTGTGGAACGTGTCGCCCCTTGGGTGCAGTGTTGGTGTCTCCTTTCCCACCACA
CGCAAGGCCTCCAGTGGAGTGCGCCTCACTGTTCTTTCTTCCACGGCTTCTTCTAGACTT
CCGGAGGCTCGACACCCACCCCTGCGGTCCACACCCAGCCCCGAGCGGTGGGCTCTCCTG
CCACGGCCACCACTGACCTGGTGTCCATGGCAACAACTCAGGGAGTGCGGGCGGTCACTT
CCGTCACTGCCCCGGCGGTGGTCACCACCAACCTGACGCCTGTGCAGGCCCCGGCCCGGT
CTCTGGTGACCCAGGTGTCTCAAGGTAAAAGCACCCCTCTTAGCCCCCTACTCCCCTTCT
ACGTGTTGTCTGGGGGAGGTAGAGAGTCCAAGGGGGCTAGTAGCCGTATCTGACGAGCCA
CCTCCTTTGCAGCCACGGGAGTGCAGATCCCAGGAAAGACCATCACCCCCGCACACTTCC
AGCTTCTCCGGCAGCAGCAGCAGCAGCAACAGCAGCAGCAGCAGCCGCCGCCGCCGCCCT
CTCAGGTGCAAGTCCCGCAGCTCCAGGGCCAGGCCCAGTCGCCCGCGCAGATCAAAGCCG
TCGGGAAGCTGACGCCGGTGAGCCTCTCTGGAAACCACAGACATGGTGGCTTAGAGCAGG
TTGGCGTGGTCTGTGGGGGACGGTGGCTCAGAGTCTCTTCTGGAGACGTTGTCTGTGTAG
GGAGTCCGTTTGTCTTCTCTCGGAGTGAAACATACGGACACCATGGTCATGACCATGCCT
TTTAAAACTTCTTAGCCTTCTTCCTGGTGCTCTGTGGCCATAGTCCCATCTCCACACTTA
CATTCCCACTTCCCTTCCTGTGCTTCCAACGTGATGGTTCAGTCTCTGGAGAAGGCGAAG
GGCTCCCTGGCCACCCTTGACAGAAAACCCTGGTGACAGAGCACTCTAAACAGCTCTAGG
AGGCTGGGGGCGAGGACTTGGTTTCTGTAACAACAGCTTACTTGCAGGACTGCTTCTCCA
AGGCTGGCCCTTGTGTCCTGGCATTCCTGCTTTGGCCAGTGTGTGCCACCTTTGCGGTGA
TTCTGTAGCTGCCTTTGTTTTAGCAGGGCATCAGTGAAAAGTAACCAAAGCACCTTAAGC
GTGAACACAAAGCAATACTTGAAAGCTCCAGCAAGCTCCTCTCCTGCCAGAGCGCCGAGC
GAGCAGTCTGCTCCTTCTGCACGGGGAAGGGAGGAGCCGGTGCCAGAGGCCGTCACAGAC
ATGCAGTGCAAGGCGGTCGGCACCGTGCCCACAGGTGGTCAGTGCTGTCGGGGGCTGCCA
TGTTCCTCCAGGAACGTCCCAGCCCCCTTTTGAGAGACAGTGAAGTGGGGCTGTTTGTCT
GACACACTAGCAATTAGCCACACTGACCAAATTCCAAAGTGATCAAAACGAAACAAAACA
AAGCATTCAGTCTCTCAGCGGCACCAGTCACGTTTCTAGTGCTCGTGGCCACACGGGGCT
AAGGCTGCCGTACTGGAGAGCACAGAACTAGAACATCCCATCGTCGCAGGAAGCTCTGCT
GGACACGGCTAACTTAGAGAATTATGGGGCCCAAGATCTAGGATCTGGTGTAGCAGAGGT
GGAGTTGTCAAGTAAATGAAGCTAGTGTTTGATCCTCCTTCACGTACACGTGTGCATACA
CACACTTGCACACACATGCTCTCGTGTGCATGCACACAGAGCGGTCTTTCTTTGTCACCT
AAGACAGTCTGCCTCAGGTGCCGCATCTCGCCCTGTTCCGGCAGCCAGCGCTGTGCTCAC
CCTCTCACTGCCTGGCCCCTGTTCCTCACTCCTGCTCCCCAGCAAATCAGCTCCCAGCGT
TGTCGCTTACAGCGTTTTAAAAGAGACCTAATAGTCACAAACGACTCAGTGTAACTTCTC
TAAAAAATAAAAAAGCATGTTTTTTAGTATTTTTTGAAACTAACTTGAGAGCATGATGTT
TTGACATAGTTGTGGCACTGATTTCTAAATCGTTTGGAGACTGTGGGAATAACATACTGG
AGGCTTACACACATCTTACAATACACTTAAAATATCAGGAAGAACCGTGATTTTAAGGCT
TCCAAAAAATTCCATGATCGTACAGATTTAAATTGACCCGATTGTGAGAGAGAAGGGCCT
ACATCCTTGGCCAGGAGCTTTACTGATCCGTTAAAGTCACTGTCAGGTTTTCCCTGACAC
TGTGCCATTTTAAGTAAGTGGTTTAAAAATGTTGGCCCGGCCCTGGAGGATGGCTGGCAG
TACGTGTTAGCAGCTGGTTACTCTGGTATTTACTGGGTACGGAAACAGCGTTTTACATAC
GTGATGGAATGTAGCCGATACTGATGAGAAGATTCCCTCTGTGGGTTCTAGGAACACCTG
ATCAAGATGCAGAAGCAGAAGCTACAGCTGCCCCAGCAGGCACCTCCGCAGGCCCAGCCA
GGGCCCCCGGCGCCCGCACCCCAGGTGCAGGCACAGCCCGCACAGCCCGCGCAGCAGCAG
AGCTCCCAGATCACCACGGTCACGGCCCCGCGGCCCGGGGCACTGCTCACGGGCACCACT
GTGGCCAACCTCCAGGTGGCCCGACTTGTAAGTTCCAGCTTGTGCGTTTGTTTTTCAGAA
GCGACATCTGTTTTACTTTAATTGGGTGCTAGGTCTGCTCTGGACTCTGTCAAGTATCAT
AACTGACTACACGTAATGCATCGCAGTGTTGATAGAGTCGCACAGCCTACTGGACATTGG
AGGGGGCGGGGAGGGAGCTAGGCTGTGAAGAGAGCTGAGATTCCTGGAGGGTAAGGGTGT
AGAGTAGCATCCAGGTGTCATGGGTGCTGGATGCTGGGCAGGTTCTGACCTTACAAGACC
TGTGTGGAGGAGCAGAGGGCCTGCACAGGGGCCTTGCAGGTGGGCGTGAGCCAGGTCGGC
TGACCAGGGGTTGGACTGCCAAGAGTGGCTCAGAGATAGCTGCATTGTGTGGGAACAACA
GGGGCCTTTGGCGCTTGAAGAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCTGTACTAGCACGGGGTGTTGTGTGCCAGCCCTGTCACGAGTGATGCCCAGTTTAC
AGAGTGTCTCACTCTCATCCACTGCCATGAGCGTGCCACATTCATCACAGACCCACTGTG
GTGGGTGCTGGTGCTAAGTACTCACTCCACATCTCAGGTGGAGAAGCTTGTGTCTGCCGA
AGCCCCACTGTTGGCAGCTACAGGCAGCTGCACTGTGGGGCTGGCTCAGGCTTGAGCCCC
CAAGCCCCCTGGTAGGGGCCAGGTCAGGCTCCACGGTGTGGCTTGAGCCCCTGAGCCCCC
TGGCGAGGGCCAGCTCTCCATAGAGAACTAAAGTGACTCCACCAGAGCGCACAAAGCGTG
TATAGCAGCAGGAAAAGCGGTGGCCCCTAGTACTGGCCAGAGGGTGGGGGATGTATCACC
TCCAAATACATCCGTCAGACTGGAGTAGTTAACCTGTTGGGAGGGGCTTTTGGTGATCCA
GCTATAAAAACGCAGAACCCAACAGTCCTGTTTCTGGTGTGTCCTGAAGGCATGAGAGGA
CAAAGCAGCAAATGCACGTGCTCATTTGCTGCAGGAGGGTAGACGAAACTGAAACGTCCA
AAGCAAGCGCGTTAGGGGACATCCAAGCAGTGGGACATAAAGTAGCTTTGAAGAACGGTT
GTAGTTCTGTGTAGCTTGACTGTTCCTGTAAAGGGAAGAGACACAGATAACAGCACTTTT
AATTTCATCCCTTTTTACATTTTTCGCAGCAATCCACACAGGTAAGAACAAGGTCCAGAA
GGTCAGCTAGCAATTTTAACATTTGTGTATGAGTGGTATTAGGATTGTGAGTGATTTTTA
CTTTCTTCTTTGTATTTTCTTGGGTTATCTGGGTTTTATATGTGTAAAAATAGACCTGTT
TCCACTTTACTTTTTAAAAACGCAACATGAAATCAAAGTGCTTGGTAGTAGCGTGATAAC
TCAGTGGAGGGTGGCAGTGTCCAGGGGCTGACGTTCCGGTGGGAGGTTAAGGCCTCCAAG
TGGGGAGTGGGCTGACCTGTAGGGGTAGCTGAAGGAATGGGAAGTGGGAGATTCCCTAGA
AAAAATGGCCCAGAGACTGGTGGGAGAAGATGGTGCCTGAGATGAGAATTGTATGGGCTC
GTTAAATCTGAACTCTGGCCGATGTTGTTGTTCGGCTCCTGTGTCTGAATACCGCGGGTG
CTCCGCCTTGGTAGCTGGTAGGTGTTAGGAAGAAGGTGGACCTACAAGGACACCCTTTTC
CCTCCGTGTGCAAATCACGAAGCCTGTGTTAGCGTGACGCCACCCTTCTGCTTGGTCTAT
CCGGGTTCTCTCACCTGGCCTCTTGTGAGGAGACTTACGTGACAGTGCGCAGCATTCTGC
CTTTCTTGGGCTCACCCATGGCTTTCTTTTGCAGACCCGGGTGCCCACCTCTCAGCTGCA
AGCCCAGGGGCAGATGCAAGCCCAGACACCCCCGACGGCACAGGTGGCCCTGGCCAAGCC
CCCAGTGGTGTCGGTGCCGGCGGCCGTGGTCTCCTCGCCAGGGGTCACAACACTGCCCAT
GAACGTAGCCGGGATCAGCGTGGCAATTGGGCAGCCACAGAAAGCAGCAGGTGATGGTGG
GCGTGCACCCTGCCCTGCACCCTGCACCCTGCACCCCGCACCCTGCATCCTGTGTGGCAT
GCAGTAGCTGGGTGGCCGCCACTCCCGTTTTGAAGCAGTGCTTTGTAAACCTTTCCTGGC
AGACTCTGTGTCTAAGATGCATTTCATGTGTGCATGTTGTAGTTTAGCCCAAATGTCTCT
CCAAGACTTCCGAGTCCACGTTTCTCCCACCAGTTTCACTGTTAGCCGTTCCGAATCTGC
CAGATGTTTACGTAGACATCCCAGATGGACACAGACATAGCTTAGGTGGACCAGGGGATG
GCTGTGCTTGTCTCCTCACAGCTGCCCTCTCTTGCATGTCTGTGCAGAAAGCAGTCAGCT
GCACACGTCGTCACCGTAGGGCTATGACTGATGGCGTCCTTGGTGTTTGCAGGGCAGACC
GTGGTGGCGCAGCCCGTCCATGTGCAGCAGCTGCTAAAGCTCAAGCAGCAGGCCGTGCAG
CAGCAGAAGGCCATCCAGCCGCAGGGTGTGCAGGGTCCGGCCGCTGTCCAGCAGAAGGTA
CGTGGCTCTCCTGGGATGTGGGCCGCATGATGCATCTCCGTGCCGCCCAAGTCAGGACAG
CTTGCCCAGATCAGGCACGTGCTCCACAGGAGACAGTGGTTTAGTGGAACCCGGCGTCGG
ACTTGGGGCCGGGAACTCCGCTCTGCATGCTGGGTGTCCCAAGGCTGGGGGCTCGCGAGT
GGAACTGCCAGTGTGCCATGTGTATGTGTTTTCTTATTTCATGTGCACACACTGTGATGG
TGGCCTGTGAGTGTGGCCCGGAGGAAGCCCCTCTGCTCCAAGGCCTGGGGGGTGGCAGAA
GGTCTGGGAGTGCCTGACCTGGAAGGGCAGCGGGTTCAGGTTGTGATGGTCACCTGCCTG
GTTCCTGATGATGATGGGATGGGCCCAGCCAGGCACTGCTGAGCCTGGAATCAGGTGAGG
GTCTGCTTGTTGGAGGAGAGGAGGGACGTGAGGACTAGTGAGAAGGGAGGGCAGTGGAAA
GGGTTAGGGTTAGAAGAAATGGCCGACTAGAAAAATCTGATCTGCAAACCTTTTCTTAGC
CAATTCTGCTCCCTGAGATGGAGGTCCTCCAGAGGCAGCCGGTGTCACAGGTGTCCTGCC
TGGGCTTATACCTGTGGTCTCTCTCCTCAGATAACTGCACAGCAGATGGCTGCACAAGGC
CAGCAGCAGAAGGTGACCTATGCCACCCAGCCAGCACTGAAGACCCAGTTTCTCACGACG
CCCATCTCCCAGGCCCCAAAGCTGGCAGGGACTCAGCAGGTGCAGACACAGATACAAGTG
AGTGTGCTTGCTGGGGCTACGGCTAGTGTAAGCCTTCCGTTACCCAGCACACACATAGGA
GCAGTGATACCACGGACGCTCTGTAATCTCCTGCTGGCTGCCACTGCTGGAGGCCTGTGC
GTGCACCTGCCCACATCTTGTCCTGACCTGTGTGACTCACCTGTCCCGACCTATGTGACT
CACCTGCTTTTCCTGTGGCTTCACCATCTCTGTTGATAAAGCGAATGTTGCAGTCATGCC
ACACGTGGCCTCTGTGACTTGCCGCTTTCCCCGCACGTGCTTGTGAGGTTCCTCGGGTGT
CTGCACTTGTCATTTCACCTTATGGACAGTTTTCCCTCTGCTGGTGGTGGCAGTGGGATG
TTCCCAGTGTTTGGCCTCCTCCAACACGGCACCAGGCAGCTTTTTCCTGTCCCCTGGTGG
TGCTGGGCTGTGGGCAGTGCACGTTCACCGTCTCCACAGTGGTGATGCCGCTGTGTGCTA
GCCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGACTCCTCAGCATACATCCTGCCGGTGTCCTGGGTGTAACCCTGACCCTTC
CCGTCTTCGAGTTTTCACCTGAGGTCATTTTCACTCTGCTTGACACTTATTCTTTGGAAT
CACCTCCAGTGTTTGAAAAATGCCTCTTTTTCACTGTTACTTGTGAAAGGCACGTAGCTT
GGCATCGTACTCTAGACAGATGTTTGTTTTCTTAGTGCACTGTGAGGCACCGTTCCTGTG
TTCTGGGTCCCTTTGTTGGCAATGGGATGTCACATGTAGTCTAATGTGTCTCTGCCTTGG
AGGACATCTTTTCCCTTTGTGCCCTTTAAGGCACCTTGCTCGTCTTCACGTCGTGCAGTT
CCGCTATGATATACCGAGCGTGGATCTGTGGGCATCTGGAATTGACCTCTCCCATCAGCC
ATGGCTTGTGTCCATGTTGCCTCTGCCCTGTGTTTTCTACTCCGTCTCTTAACGTCATTT
ACGTTTTCTATTTCTTTGTCTTTCTGTACTGCGTTCTGTGTGATGCCTTTTGTAAAACTA
TAAAATAAACCTCACGTTACGCGTGATCACTGATGAGGAAGTCGGCCTTGTCCGTGTTCG
AGGTGGAGAGATGCCTGCTCTGCCACTGCTCTGTGCGGCCGTTTTGTGGAGGGCTCTGCT
GTGTCATCTGGTCGTTGGCTTTCTGCATAAAGAACCAAGAAGGGAAAGGAAGAACGTCCC
CTCTTTTTGCGTGCACTCTCTTCAGAATGCTACATTTGGATTTTTCTCTTTTGTCAAAGG
TTGCAAAACTTCCCCAAGTTGTCCAGCAGCAAACAACTGTGGCCAGCATCCAGCAGGTCA
CCCCCGCGTCCCAGCAGGTAGGGTCTGGGGACACAGCCATGGAGGGAGCTCACAGTTCCG
GTGCCCATGTGCACTGTTTTAAAAATTTCAGCTTGCCGTTTTATGAGAATTCTTGGTTTT
CATCCTCAGAAAATAGAATTTTAGAGGATCACTTTCAATGCAGAAAAGGTTAACTTTGGG
GAAAGCTTGTTAGCCTCAGGAGAGTAGGAAAATCCTGCAGACCCATACGTGTTCACACCC
TTTGTCAGTGTGCTGAAGGAGCTTCTCTTCTGTTCATGTCCAGGATCATCTGTTCAGCCA
GCCCTCTCGGGTATGTCCTCCCAGCCCAGGGCTCCATGCTTGAGTTGGGGGGATGCAGAA
GTGAAGGACATGCTTGGAGGGGCAGTGATGGCCTTGACAACCACATGGCATCTCAGGCTC
ATACTGTCCTTGTTTATGACTACAGGGTGTGGCCATGGACAAGCAACGTTTTATTTAGCT
CAAGGTCACACTGGTTTTACTTTTCAAGGAACCAAACATATTAGAAGCTTTATAACAACA
ACAAAAATAAGTCCCTCGATCCCACCCTTACCTTTTCCCAGACACATCGCTTTTAGTCAG
AACCCAACAACAGCTTGTTCTGACTTTCTGCTTTGGTTCGCTTGGAAGCCAGAGGTCATA
TCCTGGTGTCGTGGTTTTTACGTTTTACAAAAGCATACTTGGCCCAGAGGATGTTGTGCA
TGGGGGTTGCTCTGTCTGCGGGTTCTAGATCACGTGTCTTCTCCGATGCAGGCCTCTCCA
CAGACAGTGACGCTCACGCAGGCAGCTGCAGCCGGCCAGCAGGTCCAGATGATCCCCGCA
GTGACGGCCACGGCCCAGGTGGTACAGCAGAAGCTCACGCAGCAGCAAGTGGTGACCACG
GCTTCTACCCAGCTTCAGAGCCCTGGGGTCCCGCACCCAGCACAGGGGCCGGCAAGCTCC
GACAGCCCGAGTCAGCAGCCCAAACTGCAGATGCGAGTGCCTGCTGTCAGGCTGAAGACC
CCCACCAAGCCCCCGTGCCAGTAAGCGGGCGGACACGGCCTCCAGGCTCCAGCTGCAGCT
GAGAGCAGACTGCCCTGGACGCCTCACCATCCAGAGCACAAGTCTGCCGCCTCACGGAAA
CCGTCCAGCTGGTCTGAATCCGGGACAGTGTCATGTAAGGTACCCGGCACTGGGATGGCT
GTAACTGAGACAGGACCATGTGGTCATCTTGTTAAAACACGTCCTGCACTCAAGAACATG
ACCGTTGAGTGCCGCCTTGCTGTATTATGTGACTGATTGAAAAAGTGACAGTGGCGATTT
TTAAAAAGCATTTAAATGTTTCATTTTTCCACCATTCAGAATGTCTGTTCATGTACAGTG
TTTGCACATGACCGTGGCAGTGTGGGACGTGCATCGAGTCTTAAGCTACACCACGGTCTC
GGTGTCCGCATGCTGTGTCCTTACGTGCCCAAAGGACACATCGTGGTCCTGAGAGGATTT
CATTCCAAAGAAAGCCACTGGGGTTTTCCTCTTCCCCTAGAATAGGACTTGTGTTCACTA
TTGCCAGGAATGTTTGGGACTGATGCCCATCTGAGCACATTCATGACATGCCCCCACCTG
GGTTCAAGGTCAGTGGCCTGTGTTTGAACTTCCATTCCAAAGAGTGCCAGTGTACCCCTG
CCCCCCTACCCCTTCCAGTGGTGTGTGGCCACTTGAAGGGCCTCTGTGATGGAACCTGGT
AAGCACGGTCATGCTGCAGCTCCAGCATGGACTGCTGACATGGCTCCAGGCCTTCGTGAC
ACTCGCGTACCACACAGTATTTACGCTGCTGTGTTACTTTGCCACCTGGGCAGTGGACAT
GGGGGGCATCAGGCAGAGACAGGTTTGTCACAGGCTCCTCTTGCTTGCATAGCCCCTAGG
TCTCATCTGGAGAGAAGGGTCTTTTACAAGGCGGCTTATTTACGAATTTGGTTACACAGA
AATGGGCTCAGTATGCTTTCATAGATTTGTAGCACAACTGTGAACACACTTGCAAATGAC
AACA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1030, 1032..1081, 1083..1772, 1775..2159, 3808..3918, 11841..11931, 13519..13626, 14423..14808, 17051..17347, 18159..18272, 18275..18307, 18310..18336, 18340..18342, 19121..19263, 19265..19266, 19676..19677, 20002..20080, 22184..22233, 22839..22896, 24919..25008, 29638..29745, 30718..30908, 37256..37433, 37653..37789, 39537..39706, 40690..40864, 40965..41101, 42706..42892, 44352..44518, 45932..46101, 47068..47298, 49071..49235, 49804..49962, 50063..50157, 56144..56394, 57783..57851, 57853..57900, 57902..57990, 58148..58212, 58214..58218, 58220..58319, 59990..60186, 61270..61381, 61497..61640, 61930..62088, 62301..62384, 62807..62941, 63272..63316, 63402..63555, 63900..64141, 64238..64411, 65048..65184, 65317..65373, 67778..67856, 67967..68215, 69183..69228, 69304..69413, 70676..70883, 70992..71176, 72951..73166, 75094..75289, 75712..75836, 76470..76616, 78899..78976, 79731..80003
1001..1030, 1032..1081, 1083..1772, 1775..2159, 3808..3918, 11841..11931, 13519..13626, 14423..14808, 17051..17347, 18159..18272, 18275..18307, 18310..18336, 18340..18342, 19121..19263, 19265..19266, 19676..19677, 20002..20080, 22184..22233, 22839..22896, 24919..25008, 29638..29745, 30718..30908, 37256..37433, 37653..37789, 39537..39706, 40690..40864, 40965..41101, 42706..42892, 44352..44518, 45932..46101, 47068..47298, 49071..49235, 49804..49962, 50063..50157, 56144..56394, 57783..57851, 57853..57900, 57902..57990, 58148..58212, 58214..58218, 58220..58319, 59990..60186, 61270..61381, 61497..61640, 61930..62088, 62301..62384, 62807..62941, 63272..63316, 63402..63555, 63900..64141, 64238..64411, 65048..65184, 65317..65373, 67778..67856, 67967..68215, 69183..69228, 69304..69413, 70676..70883, 70992..71176, 72951..73166, 75094..75289, 75712..75836, 76470..76616, 78899..78976, 79731..80000
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved