Loxodonta_africana Locus C6orf48
snOPY snoRNA Orthological Gene Database
Loxodonta_africana C6orf48
Loxodonta_africana
C6orf48
scaffold_106580
SNORD48, SNORD52
1282..1343, 1868..1934
3167
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGTGTGACAAGCTC
TCTGGTCCTCGGACGTAGAATCTTTTTCGTCCCTTCGGAGCCCGCCGCAGAGGCTGCCCA
TGAGCGAGAGAAAGAGCAGCTGGCCACGGCGCCACATTGCCGCGTGCAGGTACCGCAGGG
CCTTGCTGAGAGAGGAGATGTAGTCCCGAGGCTGAGAAGGATGAATTACCATTACGGACT
AGAGTTTCTGATGTTTCTGTGACGCCACTGCTCGGAACTGACCCAGCCCGGGGCAAGGGG
GAACTTGGCCGGAGTCGCTCCGGCGTCTGCTGACTCACTGCTTTCTTTCCAGGCTCCTGA
GTTCGCAGGCAGGTGTCCAGCGCCACGAGGGTAAGTATGTTGTGCGAGGTGAGGTGGCGG
TCGCCAGTGGGGAGGATGGGGATGATTGATGACCCCAGGTGATTCTGAGTGTCTCGCTGA
CGCCATCACCGCAGCGCGCTGACATCCCTACTGTCCTCACCCCGGGCAGGGATCCCTGGT
GCCTGGGCTTGGGGAGAAGGCGACGGCCATGAGCCCGTAGTAATCCTTTATTCCAGTGCC
TCATTTCTCATCTTTCAGGGGTTTTAAGACGTCCTCCGGGTTGTCATCTTTGGATGAAGG
TGAGTATTTTTTATCCAAATGCCTTTATAGATCATTTGTTCCTAAGCTATTCTTCAGCAG
GTACTATAGGGTTTATTTTCTAACGAGCGTGTGCAGCGTTGCGAAAATTGCACTTATTGG
TTTATATTTCTCTTATGACTTATTCTTTTGTAATTCTACACATTTTTGTGTAAGCCATTT
TCTTGCTCAAATATACGTGTCCACCCCACCCCAAGTGTTTTCTGCAGTTCTGTATTTCCT
ACTCCTTCACTCACTTAGACTTGCCATTTCTGAACTCTCAAATGCTATATCTTTATACCT
ACTGAGGCCCTGTACTAGATCTCTTTTGAGAATGGCTTCCCTGGATCCAAGTCTCCAGTC
CCTGAATTGGGAATGATGATTTCTCAGACTAGAGTCTCTGATGCTGGTCTTGATGTCAAA
AATAAATTCTGACTCATTTGGGGGTCTGGGTACTTGGGTCTCTGGGAAGGGCCAGCAAGT
TTCCTCAACCTCTCTGCTTATCCATCTCTTCGTTGGTTATTGTTTACCTCTTTCTAGTGT
GAGCGCTGGAAGCTCAGCCAGGGGCAGTGTCCTCCCCAGAGTGTCTGCGTTAACTTGATG
ACTGAAGGCCTAAGGATTAGAATCTACTGTCTCAGAGAAGTGCTGTCAAATGGTTGGGAA
GCCTAGTGTTGGTGGTTCCTGATAACCTAGTTATTGTCACAGGTTGTGATAAAGAGAGAG
CCATGGGTCTTCTCCACGGCTGCAATGGTGAGTGTCATCCATCTTGGCAACCAGCCCCAG
AGTGGGAATGATGACCTGGTTGGACTAGAGTCTCTGAGCTTTTCTCTGAGGATCTTCGAA
ACCACCTGATCCACTTTTCCCTCCCTCAACTCTCAGTGTCATGTCACCTGCCCACCTGCT
TTATTTGTTTTTTTTTTTACTGTCGATTGCTTTTATGGTTCTAACATGTTTTATGAAATT
ACAGGACTTTGCTGGCACAAAGAATGTTCTCTCTCTGGTGTTGGACAGATCCTAGGAACT
TGGCATCTCTTCTTTCCTGTGTTACCTGTATGAGCAGCAGGCAACTTGTGAAAAAACAAT
TTAGAAATTTTGGTTCACTTAGTAACAAGTAGATAGCTTTTACCTGTATATACTTTGTTT
TGTGTAAGTGCTTGGTTTTTTTTATAAAATGAGTTCCAATAAAATAAAGCAAATAATGAG
TTGTTGTTTTTTTTTTTTTTTTGGTCTCAATGAAAATAAGATTTAGGGAAGTGAAAGGTA
ATACCTCATTGACTTAACATTTGAGGTTTTTATTACGGTGAAAAATAGTACCATAGGTCC
TGAATTTACCTTTTCATGAATCAGCTAAAAGTATGTTGAACTTCTGTTAGAGAGCCGCCT
ATGCTAATAACAGTACTGATTCTGTTTTTTGCACCAATTTGCAAGTGCCTTTGTAAAATT
TCAGAAGAATTTGTCAGGATATGAACGTTTTAAAATTCTGACAGATAGTGCATCCTGTAG
AGGTGGTATTAATTTGTATTCCCAACACGAGTGCCTTCTTGAGATTGCTGATGTTCCCGC
CATCCTCTCACTGTCACCAGTCCGGGTAGTAATACTTCCAGCACCAGTTTTTGTACCCAT
TTGGCTGAGATTACATTTTTTTTTTCCAAATCGAAATGCTTTTATTAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1006, 1009..1098, 1110..1134, 1136..1176, 1206..1213, 2037..2067, 2070..2127, 2129..2130, 2133..2164, 2167..2167
1001..1006, 1009..1098, 1110..1134, 1136..1176, 1206..1213, 2037..2067, 2070..2127, 2129..2130, 2133..2162
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved