Loxodonta_africana Locus ENSLAFG00000017660
snOPY snoRNA Orthological Gene Database
Loxodonta_africana ENSLAFG00000017660
Loxodonta_africana
ENSLAFG00000017660
scaffold_91475
SNORD73
4572..4638
5218
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGATAACATACT
TAACTAACCAGCACTCATATCAACAAGCAAAATACTACCAGTATCATTGAAGTTATACTT
ATGTAATCCTACTAACAACCTTATGAGTTAGATAACATTATTATCCCCGTTTGACAGATG
AGGACAGTGCAGTGTAGAGACATCTCAAGGCTAAACCGTGTTGAAACCAGCATTTGAATC
TGGATCTGCTGAATAATTCCAAAGCCCATACTCTCGAGAACAGGTTTGGAGGGTTACACG
GTGAGCTCAGCTTTGAAAGATCCTGAGCGGCTGTCTCCTTCCACGGAAATTTACTTCCGG
TTGTCAGAGCCACAGTGACCACAGATAACCCTCAGGCCGCCTGCTCCCGCGCCTCAAGAG
CGCAGCCTCCCGACGAACCGTCCGCGGCGTTTTGCACGGTCTCCAAGCACACGATGGCGC
TGTCACAGCTATAGCCGGAGGAGAGCCTCTCGCGGTTGCCGCAATATTCCTGAGGCCGTA
AGTAGCGCGAGACCGAAGGTCACGCATACGGCGGCCCCGCCCGTACACCTAAGTTCTCGC
GCGAGTTGCACTTCAGCCCTTTTGGCTCTCTGAGCAGCACCATGGCGGTCGGCAAGAACA
AGCGCCTTACAAAAGGTGGCAAAAAAGGAGCCAAGAAGAAAGTGTAAGTGGTGGCTGTTG
TGGACGCTGCTTTTTGGGGTACTGCTGGAATCGGCGGGTGGGTTCTGGGTTGCGGCGTAG
GCCGGATGGTGCGGATGCCGGTCGGATTGTGCAGGCCGTGCCCAGTCGGTATACTCCCGG
CGGGCCGGTTTGGGTGCTGCATGGAGGCGGGACGGGTGCTTTACCCCGGTTTCTTGGGCC
TTGCACGCGACCCGTTTGAGCCTGATTGCCACCACCATTGGAGCCTGCCGTGTTCCTTAT
CGTGGGCTCTTAGGTCGCGTAAGTCTCGCAGACATTAACTGTCGCTCAGTTGTTGGCGTT
AGGAAGTCGCTGTTTGTTCTTGGTCCTTGGGTTTGGACCCGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAATTGGTAAGACTG
TGGTGATAGGCACTTTACCAAATAGAATATCCTAATGATCACTAAAAACCAACCAGTTGC
TAACAAGTTGGTTCTGACTCATGGTGACCATACGTGTGTCAGAGCTGAACTGTGTTACAT
AGGGTTTTCAAGGACAGATTTTCAGAAGTAGATCACCAAGTCTTTCTTCAAAGGAGCGTC
TGGGTGGACTCAAACGACCAACCTTTCAGTTAGCAGCCGAGTGTGTTAAATGCTTGCACC
AAACATGCTTATCATCACTAGTCATCAAAAAAAACACACATTAAAACCTCAGTGAGATTT
TGACACACTTGTATCAGAATGGCTGAAATTTAAAGGACAAACAATATGTGTGTTGATGAA
GATGTGGAGCAACTGGAATGCTCATAAATTGTACAAGTATAAATTGTACGGCTACTTTGG
AATACTGCTTGACAAAATCTACTAAAGCCTATGTATAGCCTATAGCCCACCAGTTCTACT
TTTGAGTACATACCTGTATTGGTCATCTAGTGCTGCTGTAACAAAAATACCACAAGTGGA
TGGTTTTAACAAAGAGAAATTTATTCTCTCAGAGTCTAATAGGCTACAAGTCCGAATTCA
GGGCATCAGCTCCAGAGGGAGACTTTCTCTCACTGTGGACCCTGGAGGAAGGTCTGTCAT
CAATCTTCTCCTGGTCTGGGAGCATCTCAGCACAGGAACATCATGTGCAAAGGACGCACT
CTGCTCCCAGTGCTGTTTTCTTGGTGGTATGAGGACCCCCATGTCTCTCTGCTCACTTCT
TTCTTTTATATCTCAAGAGAGGTTGGCTTAAGACATTATCTAATCTTGTAGATCTCATCA
ATATAACTGCCACTAATCCGTCTCATTACATCATAGTAATAGGATTTACAACACATAGGG
AAGTCACATCAGATGATAAAAAGTAGACAATCATACAATACTGGGAATCATGGCCTAGCC
AAGTTGACAGATATTTTGGGGAGACACAATTCAATCCATGACAATACCCAACATAAATAA
ATGCTTATGTTCACCCAAAAAGCAGGAATACTACCTAGAAATGAAAGGAACAAACTACTG
ATATATGTAGCAGTGTGGTAAAGAATCAGACACAATGAATATATAATGTATGATTATATA
AGGTTTAAAAACAAACAAACAAAACTAATTTAATGGCAATAGAGATGAGAACACTAGTTA
TCCTGAATTGAGAAGGTATTGACTAGGAGGTGACACAAGTGGGTTGTTGGAAATATTTTA
AATCTTGATCTGGGTAGTGGTTACATTAAAAAAAAAAAAATTGCCATTGAGGCGATTCCA
ACTCATAGGGAACCTACAGGACAGAGTAGAATTGCCCCATAGGTTCTCCAATGAGTGCCT
GGTGGATTTCACCTGCTGAACTTTTGAACAACAGCTGAGCTCATAACTACTGTGCCACCA
GGGCTCCAGTGGTTACATGGGTTATGTAAAAATTAATTGAGCTGTGCCCTTTTGGCTCTC
TGAGCAGCACCGTGGCAGTTGGCAAGAACAAGCACCTTACAAAAGGTGGCAAAAAAGGAG
CCAAGAAGAAAGTGGTTGATCCATTTTCTAAGAAAGATTGGTATGATGTGAAAGCATCGG
CTATGTTCAATATAAGAAATATTGGGAAAACACTAATCACAAGAACTCAAGGAACAAAAA
TTGCATCTGATGGCCTCAAGGGTCGTGTTTTTGAAGTGAGCCTTGCTGACCTGCAGAATG
ATGAAGTTGTATTTAGAAAATTCAAGCTAATTACTGAGGATGTTCAGGGCAAAAACTGCT
TGACCAACTTCTATGGCATGGACCTTACCCGTGACAAAATGTGCTCCTTGGTGAAAAAAT
GGCAGACCATGATTGAAGCACATGTTGATGTCAGGACTACTGATGGCTATTTGCTTCGTC
TGTTCTGTGCTGGGTTTTACTAAAAAATGCAACAATCAGATTCGGAAAACATCTTATGCT
CAGCATCAACAAGTCCGCCAGATCCGGAAGAAAATGATGGAGATCATGACCCGAGAAGTG
CAGACAAATGACTTGAAAGAAGTGGTCAATAAGTTGTAAGTATGTCATTTTTTTTTTCTT
CTTCACGCAGTACAACCCTGACTTTCATCTCAGAGTGGTGTCAGACATATGTTTACATCC
TGTCTGTGAACCCTCCTTGCTATATATCCTTTTAAGTGACTTCGAAGTGCTCATCAGTAA
ACGTGGTAAGGTTTGTTTTGTTTTTCTTTGATGAAGGTGTCTGTGGCAGTAAGATTTAAA
GGGCAAGAAATGGTTTCATCTTCATTAGAAAATATGCCAAATAGAAATCCTCCGCCATCA
GTAATGTATGGGAATAAATGATGAAAAACTGTTTCGGTCCCAGCTGATGTCCTGTGATAA
CTTGCATTTTTCTGATGTTCCCATTCAGTATACAGTTGGCTAAGACGGTGTAACGGAAAA
GACCTTAGGCTTAGAACTCAGAACGCTTAAATGCTGCTTTACCATTAACCAGCAGCGTAA
TTCAGATCATTTCACCTTTGCCTGTGAAGGGGCAGTAACAGACTATCTTAATGAGGATTT
ATGTGGACTAAAGGAGGTGGGTGTCACATGTTTATATGTGTAGGCTTATTCTAAGGCTTC
TCTCTTTTCAGAGGACATTGCTTTATCACTTTATGTGAGCACCAGAACTTTTCCTTTACT
AACCTATCTTCATTGGTGGTTTGCAGGATTCCAGACAGCATTGGGAAAGACATAGAAAAG
GCTTGCCAGTCTATTTATCCTCTCCATGATGTGTTTGTTAGAAAAGTAAAAATGCTGAAG
AAGCCCAAGTTTGAATGTAAGTGAAATTCACAAGGTTCCTGAAAGAACAAAATTGGGGAC
TTTTTTTTTTTTTTTTTTGAGGCTAGATAATGGCCCTTTTTTTGTTTCCTATGTCATGCC
TACAAAGTATTGAGGACCATTGTTTCAAAATATGTTGTGCTGTAACTAACAAAATGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1062, 3793..4152, 4154..4294, 4946..5054
1001..1062, 3793..4152, 4154..4294, 4946..5054
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved