Loxodonta_africana Locus ENSLAFG00000005569
snOPY snoRNA Orthological Gene Database
Loxodonta_africana ENSLAFG00000005569
Loxodonta_africana
ENSLAFG00000005569
scaffold_63455
SNORD58
1234..1298
3197
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTA
TATCTTCACTGTCTCAAACTGATGAGTCAGCCTCCAGCCCCACCAGCACTGTATTCCTCA
CTTTGCAAGAATAGAAGGAGAATTTGGACTCTCCCAACCGTGTTGACCAGGAATGTCTTG
AATTATTAACTGACAGTTTATATTTTTCTTTTTTTAAACAGAACACCCGAGAAACTGCCC
AGGCCATCAAGGGTATGCATATCAGAAAAGCCACCAAGTATCTGAAAGATGTCACTTTGC
AGAAGCAGTGTGTGCCGTTCCGGCGCTATAATGGTGGAGTTGGTAGATGTGCCCAGGTAA
GAATTCTTAGTTGCCATTCTAAAAGACAAATTGCTCATAGTACTCATAAAGAAAAGCGAT
TGTGTGGTATAAGAATGGCTAAGGTCTTTCCTGGTTGCAGTGATGACAATCTTAGGACAC
CTTTGGATTAACCATGAAAAAAAAAATATTCTGAGCAACCTTGTTGGGTAACATAATTCA
TCTTGGGCATGGTATTAGTTTAAATTGGAGAAAGTGGTTAATTGTCTCCCTTCATTTTCT
TTTCAGGCCAAGCAGTGGGGTTGGACACAGGGACGGTGGCCCAAAAAGAGTGCTGAATTT
TTGCTCCACATGCTTAAAAATGCAGAGAGTAATGCTGAACTTAAGGTAACCAAACTATTA
ACATAACTGTGTGCGTGCAGCTTGAATAATACTGCTGTTGTCCAGGTTTATTTCTCAATT
GTTTTGTTCTTTTAGTAATTAGATTTCACGTAGAGTGGTCTGGGGTCTCTTCAAGCCTAT
CCCTTAACCCCAGGCCTGGGGAAAGATTTCTCCTGTCTTTTACACTGGAAGTATTTCACC
AAGGGTTCATAAGTGTTTCTGTGCCATGGGCCTTTGTGGTACTATGGTGGTTCATGAACC
TTTGTGGGATACTTTTAAATAAAAGTGGTAAATGTATATAGGATTACAAAAGAAAGTTAG
GAAAACGTTTACATGTGGATGGACTTCTTGATCATTAACTTCCCATAACAATATCTAGTA
GTGTGTTGAAGGACCCTTAGAGTAACAGTGAAAGCACACACTGAACTGTCACGCTATTTG
AATTCTTATATTGCCTTTTGGAAATGATGAAGGCAGGGATTTGGTGGCAGGATTCGGAAT
TGGTGTTTTTCAGTGATTGAGTTTGTGGTGTTTGTTTAAAGATGATCAGATCAGCTGATT
TTGTTTTGTTCTCTCTGCACCGTTCCTTCCTAGGGTTTAGATGTAGATTCTCTGGTCATT
GAGCACATCCAGGTGAACAAAGCCCCCAAGATGCGCCGCCGTACTTACAGAGCTCATGGT
CGAATTAACCCATATATGAGCTCCCCTTGCCACATTGAGATGATCCTTACCGAAAAGGAA
CAGATTGTTCCTAAACCAGAAGAGGAGGTTGCACAGAAGAAAAAGGTAAATTACTTAGTT
GCTCTGTTTGAATTGTGTATACTAGGAAGATTGATGGTTGCTGTGATGACTATCTTAGGA
CACCTTTGGAATAACCATGAAAGAAAACATTCTGAGCAACTTCATTCACCTGTCTGTCTG
TGGCTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1135, 1386..1484, 2073..2168, 2171..2197
1001..1135, 1386..1484, 2073..2168, 2171..2194
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved