Loxodonta_africana Locus EEF1B2
snOPY snoRNA Orthological Gene Database
Loxodonta_africana EEF1B2
Loxodonta_africana
EEF1B2
scaffold_57102
SNORD51, SNORA41
2544..2621, 2918..3050
4630
GTCTAGGTCACTTGACACGGTTGTCCTCTCCCGATGAAAACGGCCTCCTCCCCTGAGAC
GGGACTGTCCTGCATTTTCCCTGCAGATGAAAGGTCACCCACAAGCATTCAGGTCAGCGC
TCCCTAGGGCCTCTTAATCCTCCTCCTCCTTTCTGCTCTCTCAGATGCCTAAGAGCCCCC
ACCTGCCCGCCCTCAGGAGTTTCCGAGGCAGTGAGGCGGGACGCGGCACCCAGTCAAGGA
CAAGAGAACTGACCACCCGGGCCGAAAGAAACAGCCCCGCCGGGAAACAAACCGGTGGCC
AAGGCATTTCATCCTTCCCACACAAACGCTGTCTCACCTTCTCGCGGGAACCGCCGAGGC
TGCTCCGCTGAACGTCTGGATTACACCGACCCCCTTAGAGGCCGGGTCACTTATTCAATA
TGGCGCCCTCGGCTAACTTCGTTTGAAGGGCTTGGTAACGGAAAGTCGGAAGGGACTAAA
AGCCCCAGATTCGACAAATTCCCGTTGAGGTCGAGCTCGGCAATTTCCGTCAACCCGACG
CGGGGCGGGAGGATAGTGGATTGGCGGGGAGGCGGCGAGGGTTGGGAGGACGGCTTGAAT
CCGCAGTTCCGCCGGAAGCGGCCGGGACTTCCCGAGTCCAAGAGTGTTCGGTAATCTCCG
GCGTCTTAAGGGGTGGGTCCCATCGTCTTCGGGAGCCGTAGAGGTACAAATTTAAGAAAT
GATGGTTTTATTAATTTATTTCCAAACAGAAAGAAAAAAACGCGGATAATATGTTAGCCA
TTTAATTCCGAGCCCAATTTTTACGTTGAGGAATGAGGGCGGTAACGCACTTTGACCTTT
AACCTTCGGCCGGGTGAGGCGAAGGGAGACGCCTCCGTCTCTATATAAGGAGTTTTCCGG
CCTTTCGCGGCCTTTTTTTCACCTTCTCTTAGCGCTCGGTGTTGACCGCTTGCGCTCCAC
TTTGCCTCTGCTGCTGCCCAGCTCCCGATACAGCCGACATCATGGGCTTCGGAGACCTGA
AAACCCCCGCCGGCCTCCAGGTGCTCAACGATTACCTGGCTGACAAGAGCTACATCGAGG
GGTGAGCAAACGGGCCGAAACTGGGCGGCGAGGGAGCGTGCGCCGGTCTGGGTCCGGACG
GGGCCACGTGGCTCCTGCCACGGGGGAAGGAGGCTCGGCGGGAAGCACCGGTTTCCGTCT
CCCGAGTCCGCTGTGCCTGCGAGGCCGGCCTGGGGGGAAGGGCTCTCGGGAAAGGGAATG
TAAAACCTAGCTTTATTGGTTTTTTTTTCGCTTGCTGGACTCAATCGAATTTTTTCGCGT
TTTTGCACGTTTAATCAAAGATTGTAGTTGGAGCTGTCATTAGAAATTGCGGTCCTTGAG
CTCTCTCTAAGTAACAGACGTTGCTGAGGATGGCACGATGACCCAAACAAATGGTTTTTG
CTTTTAAGGAGCTTATTAAAAAGTAAAATCTTAGTAGCTTAGGTAGCTAGGTAAGAAATG
GGCGAGCTCCCACTAATTAGTTTGGGATGTAACTTTGGTCAGTTATCTGTTGGTGTATGT
GACGTGTGTAATTTGTGTCATTGGCAGATACGTGCCATCACNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCTCAACAGAGATGTTCATACTGAAAGAGTAAATCATAGTGAGTATTGATTAATGTCT
CACATGGTACTAATAATGTTTGTTGGGTGAGGACTTGAACCTATAAAAGTATTTACCTGG
GAGTGTGTTAAAGGGTAAATTTTAGTAAAAAGGGGTCTGTTGATGAAAAGTGAAAACAAG
TTCTCATGTGTTTGGAGAAGGACATTATTCCATCCTAATGGTGGTTGAATTTGAATTTTT
TATTAAGCCTGCCAGGAGTGAAGAAAGCTTTGGGCAAGTATGGCCCTGCTAATGTGGAAG
ACACTACGGGAAGTGGAGCTACAGACAGTAAAGACGATGATGACATTGATCTCTTTGGAT
CTGATGATGAGGAGGTACAGCATGTTTATATGAGTCCATAAATTGATAGGCAGTACGTCA
TAGTGCTTAAACACTGGCTTTGTAGCCAGATCGCCTTGATTCGAACTCTAGCTATACTGC
TTACCTGCCTTTGAAAAATTCTTACTGCTTATGTGATGAATCAAATCAATCACCATCTTT
CGGCTGAGCTCGTGATGGATTTGTTTTTTTCTGATAAAGCTGGTCTGTTTCTTGTGATGA
CCCCACTAGCTTTAAATCTGCAAACAACTAATTAGTTTTGTGAAATACTACATTTTTCTT
TACAGGAAAGTGAAGAAGCAAAGAGGCTAAGAGAAGAACGCCTTGCACAGTATGAGTCAA
AGAAAGCCAAAAGTAGGTCATTTTATAATTCGTGTTTACCATACTTTATTAACTTCATGA
TAATGATATGAGGAATTTTTCTAAGCTTGACTCGAAAGTAATTTTCTCTACATTTGTTGA
ATAAATCAGTACTTAAAAATCTTCCTTTCTTCTAAAACTTCCACAGCTACTGGTCTGCAA
CTGTCTTCATGGTAGCAGTTGCGGCATTCCTCTGTGGGAAAGAAACTGTTACGTGATTAA
ACACCTCTTTCTTAGCAAAACAGAAAGTGGGCATATGTGTGACAGACAAGATGTTTGGCT
ATGGAGATGGTCCATTTCAAAACATTGATGTTATGTGTTGCACTAGAGTGAAAAAATATG
ATCATTTGATTAATGCTGTTTTTTGTACCTTTTTAGAACCTGCGCTTGTCGCCAAGTCTT
CCATCTTACTGGATGTGAAACCTTGGGATGATGAGACAGATATGGCAAAATTGGAGGAGT
GCGTTAGAAGCATCCAAGCAGACGGCTTGGTCTGGGGCTCTTGTGAGTTTACTCTTTGCT
TTTGGGCATCTGGAATTTGCGTACAGTTTGAACCCTTGCCAATCAGTGATTTTTCTAACT
AGTTTTTCTGTGGTGAGATACATGTAACAATGAAAGTGGGGATGTAACAATATTTGCCCT
TTTTGTGCCTGACTGACTTGTCTAACTAATTTTTCTTGTTTTAATTCTCTTTTTAGCTAA
GCTAGTTCCAGTGGGATACGGAATTAAAAAACTTCAAATACAGTGTGTAGTTGAAGACGA
TAAAGTTGGCACAGATATGCTGGAGGAACGGATAACTGCTTTTGAAGAGTATGTGCAGTC
CATGGACGTGGCCGCTTTCAACAAGATCTAAAATCCATCTTGGGTTCTTGCACTTAAATA
AAAGCTTGAAAGACAAGCAACCGCTTGGGTCTTGAGTCTGTTAAGTAGGAGGGTAGAGTA
TTTTCCTTTTTTTTTTTTTGAGGGAAATTCAGAAATGATATAAATTTGGCTAAGCATTGT
TCCAGACATTTAGCCAAAAAGAAGAGGAAACTGTTAAAAACTATTAAAAATACTATGACT
ATAGGTGGCTGTTTAATAGATTTTATAAAGAAATTAATAGTGCATTTAGTACATTAATAG
CAATTTTAGTACATTTTTGCATGAAGATGCACCCATTAGTGATGCCCACAAATGCATGAT
ACTGGTTTTACCGCAGTGTTAACACCCATTAAAAAACCCATTGGCTTCAAGCTGATTCCG
ACTCAGCAACCTTATAGGACAATAGAACTGCCCCCATAGAAAACCCAAGGAGCAGCTGAT
GGATTTGAACTGCCAACATTTTTGATTAGCAACTGAGGTCTTACCTGTGTATCAGGGCTC
CTGTGTACACACCAAAACCCACTGCCATTGAGTTGATGCCAACTCATAGTGACCCTACAG
GACAGAGTAGAACTGCATCATAGAGTTTCCAAGGAGCACCTGGCAGGTTTGAACAGCTGA
CCTCTTGGTTAGCAGCAGTAGCACTTAATCACTATACCACCAGGGTTTCCTATGTACACA
CAGCACACAAATAAGGAGTACTGGGTACGTAATAATGTCAATTGGTACAATAGTTGCCTG
TTTGGAACTGAGGTGAGGGAATTAAACGAGCCAGGACTAGGCCTGTATGTTGTTTCTAGA
TGTAATTTGTAATCTAGCATCTTCAAGGTGGGATTAGTTCATTGAAAAGTTCCATAATTG
ACAAATCCCACTTGATGTTATTAAATGCTGTGAGATTGGACATAATGTAACAGGAGGACA
CCTGATCCAGAGGAAGGAAGTAAAGTTGGAAAGCTTCCCAGAATTTGTCATAAATTACAG
GCATTTGTCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1080, 1587..1709, 2287..2413, 2705..2771, 3156..3281, 3476..3630
1001..1080, 1587..1709, 2287..2413, 2705..2771, 3156..3281, 3476..3627
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved