Loxodonta_africana Locus NOL5A
snOPY snoRNA Orthological Gene Database
Loxodonta_africana NOL5A
Loxodonta_africana
NOL5A
scaffold_47558
SNORD110, SNORD86, SNORD56, SNORD57
2205..2272, 4107..4191, 4627..4697, 4951..5021
7255
AACTATTAAAGCCAGAGTAATTTCAAAACAGTCTTCTGCGTGCTCTAAAGCCTCTCTGG
AGTACGGGAAAGCAGCTCGCCTCACTCGGATGTGAAGAATCTAGGACTCGTCTACGCGGG
CGAGCTACACGTGGCTCTGCAAAAGGAGCTGGGGAGCAGGAAACTCGTCTCAGCAACAAG
TGGTATGGTCTTTTCTACTTTACTGCTACTCCTCATTAAAAGCAACATAATAAGTTTACN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCTTTTTAACATAAAAAAAA
AAAACAACCCCAAGAGGCACGTTTCTTGCAGGGTCTACGCCGGCTGGCCCCAAACCCGGT
TCCAGTCCCGGGAAGGAGGAAAAGGTGCGCGGCCTGCGGGGCTTGGGGGGCGGGCTGGGG
GAGGGAGAGTCGCCCCTGAAGGGCAGGCGGGTACGGAGAGCCCTGCGGGACGTGGAAGGA
GGGGTATGGGATCCAAGACCACCCGTGGAGCCCAGAGCGGGCTCCGCCACCGTTTCTGTA
GGGATGGTCGCCACGCCCCATGCAGTGCAGCCCACACCTATTTCACAGAGCTCTGCTGCC
TGTAACTTATATGATCAAAACATGAAGAACCTGGACTGTTATCCAGAAAAAAGCGCTTTT
GCGGCCTGCAGCGCCCGGCCTCACCCCGCTCAGCCCCGGCAACCGCGCCAGCCCGCTGCA
GCAAGGCCGGAAAAGGCCGGCTACCCCTTGGCGCCACTCTCCCCACACGCCGCCCTCGCC
CTCTAGGCGATACCATCCCAGATGCACCCCTCCGGAGGACCCGAAATGGTGCCGTCCTCG
GCCTCTGATTGGCTGACTCGGCGAGGGCGTGGCCTCCGGGGCCAGGTTCCGCGCGCTGGA
GCCCGCTCGCCGCATTGCGAGCCGGGCAAGGAGCGAGCGCCATGGTGAGGGCTGGTTGTG
GGTTGCGGGCGAGGCGAAGGCCGTGGCCTGGGCCCAGGCTTTGGCGCGGACCTAGGCCCA
GCCGGTGTCTGCCTTGGGATCGGGGGCCCGGCGAACGCTGGGCCCGCGCTGATGCTCGAG
CCCCGGCTTCCGTTCCAGGTGCTGCTGCACGTGCTGTTTGAGCACGCGGTCGGCTACGCG
CTGTTGGCGGTAAAGGAGGTGGAGGAGATCAGCTTGCTGCTGCCGCACGTGAGTGGAACC
GGTGAGTTCGGCAGCCGGAGGGGCTGCAGCGCGGTCGGGCGAGTCCCCAGCGCAGGCCCC
AGCATGCACCGCGCGTTCCCACGTGGTCGGCTGTGTCGGATGGGGGGTGGGGGAACGAGC
CTAGAGAGCTGTAGAGCCAGGGTCCTCGCCTTGGTTCATGACAAGAATAACTTTAGGAGC
TTTTTTAGATAAGCCATTTCTTTTCCATTACGGACTAAAGCAGAACCTTGAGAGATGGAG
CCCAGGCATCCCTGTGTTTTAAACGCTTTCTAGGTGGTTCTTGGATGTGTCCAAGGCTGA
GAACCTCGGCTTCACTGCGGTTTAGAGTCAAAATAGTCAAAGAGTGTCGGGAGGAACCGC
TCATCCTGTTTCTCCCACCCCAGGTGGAGGAGTGCGTGCTCAATCTGGGCAAGTTCCACA
ACATCGTTCGTCTCGTGGCCTTTTGTCCCTTCGCCTCCTCCCACGTTGCCTTGGAAAATG
CCAACGCCGTGTCCGAAGGTGAATTGGCCACCCCGAAGTTTTAGGGGAGATAGGATATGT
GATTCCTGCTGCAGTTCTCTTGGGGGATTTGTGATAAAAAAAAAAAACGAAATGCTGTCA
TATTTAAAGCTATCTCTAGAATCGAGATTTTGTTTTCTTACGAGTATTGGGGTGGTAAAT
AATTCTTAAATGAAATCTTGGGTGGGTGGGGGACCCCGGTTTAAAGCCCATTTGTGCCCG
AAGCTTGCCTAAACCCAGTCACCTGAAGGGTTCCCTGCTGCATCATTCATGTAGTTGAAT
ACATGTAAGCCAAGAAGACTGTTCTGAAACAGTTGTGGTCCCAGGAGACAAATAAGATAC
TTGCTGCTTTTATCATGCTGGAGCTTGTGTTTTAAGCTTTATTTGTATATTCCAAACTGG
TGCTGTTGGACCTGAGCCCTGTTCCTCCCCTAGTTGAGCCAGGCTTTGCAGTGATGACTT
GTGTCTGTCAATCCCCTGAGTGCAGTCACTGATGTCTCCATGTCTCTGAGCAATGCCTGA
AGGGGGAGGGTGCCTAGGCATGGCATCCCAGCATGCTCTGCAGAACCAGTTTAAGATCTG
CTATCACTTAATCAGCTCTGTAACAAGACAGGATCCCTTCTATACTTTAAATGTCCTAAA
GCATGTTAGTAAGAGCTGTTTTTTTACCCGGAGGTGTTGTTCATGAGGATCTTCGCCTGT
TCTTGGAGACATACCTGCCATCCAAAAAAAAGAAAGTAGTCTTGGGAGTTGGGGACCCCA
AGATTGGTGCTGCTATACAGGAGGAGTTAGGGTACAACTGCCAGACTGGAGGTGTGATAG
CTGAGATCCTGCGAGGTGAGAACATCTGTGGCACTTATGCCATTCTTGACAAACTTGGCC
GGGGAGGCGGGGGGGTGGCGTCCTGAAGGTGCTTAAGATTACTTCTGGAGGCCTTGCTTG
CCTGATGGGTGGAGAGCTAGCTCAGGCCCTTTCCATGCTCATAGCCCTACCCTTCTCCAG
GAATTCGCCTGCACTTCCATAATCTGGTGAAGGGTCTGACTGACCTGTCTGCTTGTAAAG
CTCAGCTTGGTCTAGGACACAGCTACTCTCGTGCCAAAGTTAAGTTTAATGTGAACCGGG
TGGACAATATGATCATTCAGTCCATTAGCCTTCTGGGCCAGCTGGATAAAGACATCAATA
CCTTCTCTATGCGTGTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGCCAGGCAAGGCCATTCTAGATGCCTCACGGTCTTC
CATGGGTCAGTGCAGAGCCTGGCAGCCAGGTGTAACGTGTGGGGCTTTGAATGTCTGGTT
CCTGCATTCACATTTGGTGTTCTCTAGGCATGGACATATCTGCCATCGACTTGATAAACA
TCGAGAGCTTCTCCAGCCGAGTGGTGTCTCTATCAGAATACCGCCAGAGCTTACATACTT
ACCTGCGCTCCAAGATGAGCCAAGTAGCCCCCAGCTTGTCAGCTCTCATTGGGGAAGCGG
TATGTCATGGGGGGCTCGGGAATGTTACCATGTAAGTCTGCGCTGCTGTATTTTCTGACT
TGCCATATCTTCCCTAGTTGTGCATGATGGGGAGGAGGTAAGCAGGGATTATGTAATTCT
TAGGTCAGCAGTTTCAGCTTCTGACTTCTTTGTGTCTTTCTCCAGGTAGGTGCACGTCTC
ATTGCACATGCTGGCAGCCTCACCAACCTGGCCAAGTATCCAGCATCCACAGTGCAGATC
CTTGGGGCAGAAAAAGCCCTGTTCAGGTACCAGTGAGGGCACCTGCCCACTTCAGGTGCC
ACTTCTGGTGCCCACTACTTGTTTGGGTATCACAGTGATGGCTGACCAGGGCCCCTGACC
TATACAGACCTCTGCTATGGGGGTGATGGCCAGTCCTGGTGTCTGAGTGATTCCCAGGGC
CCAGCAAAAGGGACCAAGCTTCCAGGTCAGCGACATTGATGCCTTTGTACCCCCTGCCTC
TGGGAGCTGTGGGTTGGTGTGAGGTGGGGGAAGAGCCAATCCCAGCCTGAGACTCACTCA
GAAGACTTGGGAAAGCGGGAGATAAGGAGCTGGCCTGACTATTGCAGTTGAAGTTTGATT
TTACATTCTGCTGATCATTCTTCTCTCAGAGCCCTGAAGACAAGGGGAAACACTCCCAAA
TATGGACTCATTTTCCACTCCACCTTCATTGGCCGAGCAGCTGCCAAAAACAAAGGCCGC
ATCTCCAGATACTTGGCAAACAAATGCAGTATTGCCTCCCGAATTGATTGTTTCTCCCGG
TATGGGTGGGGGACAGAGGGCTGGGAGAGGGGGCCGGGGGGAGGGGGAGGGCTGACTACC
TTAGCTTCTACAATGATGGCAATATTTTTCGTCAACAGCAGTTCACCCAGTGAGTGTTGA
TACTTTGGGTCTGAGTAAAGCTGAGGGTAGAGGGAATACTACGGCAGATGGGTAGTTCAT
CCCTTCTAGAGCTGACAGGCTTTGCTTACCCCCATACACATCCAGAGGTGCCCACGAGTG
TATTTGGGGAAAAGCTTCGAGAGCAAGTCGAGGAGCGGCTGTCCTTCTATGAGACTGGAG
AGATTCCACGAAAGAATCTGGATGTCATGAAGGAGGCAATGGTTCAGGTCAGTTTGGGCT
TTGTTGGGCAGGAAGAACCACAGCTGACTGTTGGAAGTGATGAACTGTCTTAGCCTGACT
TTGTAAAGTGGAGGCAAAAAACTGATTTAATGAGCCTGATCCAACGAGGTGGGGAAGGCA
GCCTGCAGGGATGGGGCTTCCCGTCCTTTTCAGCACTGTTTCTCTGGCCAGGCAGAGGAA
GTGGCTGTGGAGATTGCTAGGAAGCTGGAGAAACAGGAGAAGAAACGCTTGAAGAAGGAA
AAGAAGCGACTGGCTGCGATTGCACTCATGGCTTCAGAAAACAGCGGTAGTACTCCTGAG
GAGTGTGAGGTCAGTGGGCAGGTCAGCCCCAGGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCAACATGCTAGCAGAATCCTCTTCCAG
AGATTGCCAGTGAGTGCCCAGCTTGTTAACTTGTTTCAAGGGCTCCTCTGAAACCTGGCA
TGATGATAAAAGGTTCTGTTCTGACTAGCTTCTTTTACTGAGTATGGTGGATCTTCTATA
AGATAAACAGTGGGTTTAGATATTTTTTCATCACATGGTCTCCCTAGTGGTGATAGCCTT
TGGGGTGAATCTGCAAGTCATGTCCATACAAGTTTTTAAAATCCCAGAAATACTGAGCGA
TTCTAGCAGTGCTTCTACAAGTCTTCCTGCCCTGACTCCTTCGTCACTGATCCTGTGTGG
GTGGGTGTGTTCATCCACTGGATGACACTGTTCTCATGTTCTCTCTCCCCTTTAGGAGAC
GGTTGAAAGACCCAGAAAGAAGAAAAAGCAAAGGCCCCAGGAGGCTCCACAGGAAAATGG
AATGGAGGACTCATCTAGCTCAGTTCTCCCCAAACCCAAGAAAAAGAAGTCTCTTTCCAA
GGCAGAGTTGGTTAGTAGTGATCTCGAAGAGACAGCTGTCAGCACAGGTTTCCCCAAGAG
GAAGAAATCTTTGCCGAAAGAGGAACCAGCTAGTGATCCTGAAGAGGTGGTTAACAGTAG
CAGCGTCCCCAAGAAGAAAAAGAAACTTTCTTCCAAGGAGGAGCCACTCAGCAGTGGACT
TGAAGAGGCTGCTGGCAGCAAGAGCAGTAGCTCCAAGAAAAAGAAAAAACTCAAAAAAAT
ATCCCAAGAAAATTAGAATGGACAATGGATATTCCCTGGGGGGTATACCCAAGGTGACTT
CCCAACCCATCTCCCAATAAAAACAAAAATTCACAAAAGTTGATACACATGTTTTATTGA
GCACCTTACATGGGTGCAGGTGGGACCTGTGGGCGGGGCAGGGCAGCAATGACAGCCTCA
GTGAAGTCGTGGCAGGTAGCATAACCACCCATGTCAGAGGTTCGAACCTGTGGGGGAGAA
CTGTCATCATAATCTGTGACCTGGACCCTACCCCTAAAAACCCCACCAGACAGTTCCTAA
GGAAACCAGACCCAGGGCAACCTAGGCTCTGCCCAGAAAGGTGACTTTATGGTCCGCTGT
TTAGAGGTAAGTTTCTGGTCCAATGTACTGAAGGGATGTGTAGGTAGTATGGTCCTTGGG
AGTTGGAAGGAACAGAGGGCTCTAGCCCCCATGGGGGTGCAGGTGGCCGATGACAGACTT
GATGAAGTCAGATGTGGTGCTGTAGCCGCCCATGTCTCGAGTCCGTACCTACAGCCCCCA
CCAGTGGAGCAGTGGGGAAGAAAAGAGAGCCCATGAAGAGGGGTGCAGGATAGTGTGATG
AAGGAAGCCCTTGATTTCAAGGATCCAAGAAGGTGACAGAAGGCCAGAAAGATGCTGCAG
AAAGAGAAGTTTGTAAGCATGGACTGCTTACAAACAGTGGGCCAGCACGCTCCCANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1158..1247, 1643..1757, 2433..2594, 2760..2958, 3350..3503, 3511..3544, 3627..3778, 3945..4045, 4409..4554, 4556..4558, 4785..4906, 5091..5228, 5875..6255
1001..1003, 1158..1247, 1643..1757, 2433..2594, 2760..2958, 3350..3503, 3511..3544, 3627..3778, 3945..4045, 4409..4554, 4556..4558, 4785..4906, 5091..5228, 5875..6252
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved