Loxodonta_africana Locus ENSLAFG00000006690
snOPY snoRNA Orthological Gene Database
Loxodonta_africana ENSLAFG00000006690
Loxodonta_africana
ENSLAFG00000006690
scaffold_34157
SNORA68
2236..2367
3090
CTGCATAGGGTTTTTCTGGCTATGACCTTTCAGAAGCAGATTGCCAGCCCTTCTGAAGT
TCCTCTGGGTGGATTTGAATCGCCACCCGTTCAGTTAGTAGTCAAGCACTAAACCTAACT
TCTTGAGCCACCCAGGGAGGCCTCAGCTTTGCTTTGTATGTCAAGGGAAGGGGGAGGTTG
AAGACTTCTCTGGTTGATAAGGGTGGATCTCTTCAGCTTGTCTCCTTCAGATGTTGAGTC
TCTCTGCAGGGACTTTTCCCAGACCTCACCCTATGTGTACGTTTATTTCTGTTTGTATTC
TTTGTATCTCTGTTACCATAAAGTTGTTGAAGAAAAGGGGAGGGAGAGCAGCATTGAGCT
CTCCTGGAAAGCCCTGTCCAGCTTTTCTGACAAGCAGAACAAAGAGCTCTCCTGCACAGA
TTCCCCAGGAGGCCGTGGGGTGATGCTTTGGGCTGGGAAAGGGGGTGGGTGTGTCTTCCA
CTTGAGGGCTCTGGGTGATGGTCCCACCTCTTGTCCTCTCTCCCCCTCAGCTTCGTGAGT
ACAAGGTGGTGGGGCGCTGCCTGCCTACCCCCAAGTGTCAGACTCCACCCCTTTACCGCA
TGCGCATCTTCGCCCCCAACCACGTTGTTGCCAAGTCCCGCTTCTGGTACTTTGTGTCGC
AGCTGAAGAAGATGAAGAAGTCTTCGGGGGAGATTGTGTACTGTGGGCAGGTATTCCAGG
CGTGGGGCGGAGCAAGGTCTGGGTGTGGCTCTGCCTTCAGGGAATGGGGGGGACAGCCAG
CATCCTTGGGAGTGACGCAATTCACAGCCTGGTTGTGCTCTATGAGGACGGTGTGTCCAG
TCCCTGGTGAGAAAGTTTGAGCACACAGAGGGGTGCAGCTGGAAGGGGCCACACCTCACT
GAGGCAGTTGAATCTCCCCAGACTTTAACTATAAAGTAGGAGAAACGGTGCTGGGTCCCT
GAGGTGCCTTCAGGAAAGGAGACACGGGGTGGCGCTGTCACCTGGGTACTTCTGATGTGA
CAGGCACTGACTTGGTGCATAAGACCAGGCCCAGACCAGGGGGAGCTGTCTGGGGAGGAG
CTCTGTTGGTCCACATGGGGGAAGCAGCCCTGCCCAGTCCTGCCCCACGCTGTGGGCTGT
TACTGTGGGGTTTTCCTTAGGTTGCACGCTCCCTAGTTGCCTGATGGTGTGGAGATTGGA
AAACTGAGGCTCTGAGAACTGGGCCCTGGAGGAGGCCGGGTGGCTGGGCTCCTGAGTGTG
TGAAGAGTGGAGGTCCCTTTCTGCTCTTCTCACCCAGCTTCACCCGGGCAGTGTTGAGAA
TCCCCACTGCGGGTGAAGAACTTCGGCATCTGGCTGCGCTACGACTCCCGCAGCGGGACC
CACAACATGTACCGGGAGTACAGGGACCTGACCACTGCAGGCGCTGTCACCCAGTGCTGT
AAGCACCCCATCTCGCTCCCCCAGACCCGGGCAGGCTAGATACAGAAGACATCGGGACGG
GGGTGGGTGGCAGGTTTGCAGAGGACACCCTATGCTCCTGGCGTGCCTTTCTTTGGAACC
TGGCAAGAAGCAGACCTTGAGGGTTGTTGGGGATCTGCTGAGCTCCCTGTCTGAGCAGCT
CTGCTCCCCAGAGCCTAGTCCAGCTCTCTGTCTAGTTGGGAGCCTGTGCCATTTCCCACC
TGAGGCTGCGTGTCCCCAGAACCTGTTCTCCAGTGCCTGCCAGTGTGGTTCACCAGCCAG
GTCACCTGAGAACCCCGTGCCTCTGCTTGCACCCAAACCCAAGAACCGCAGTTTCTCGTA
GCGGCGGTTTAAACAGTGGTGCACACAGCAAATGGACCTTGTCGCCTTTGGGGAGCTGTC
CCATGCCCCCCAGAGTGAATATGGAGGTTCTACACCCCTGGTGGCCAGGCTTCAGAACCA
TGTGGGGTCACTCGGGACTGAGTGGTACAAGGTAGGAGGTTTGTGTTCATTCTTCTGGCA
GACCGCGACATGGGCGCTAGGCACCGCGCCCGCGCTCACTCTATCCAGATCATGAAGGTA
GAGGAGATTGCGGCCAGCAAGTGCCGCCGGCCTGCAGTCAAGCAGTTCCACGTGAGTATC
CAGGTCCCCTGGGACTGGGGGAGGGAGGGGATGACCTCCCAGAAAGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1180, 1781..1783, 1786..1788, 1791..1908, 2452..2561
1001..1180, 1781..1783, 1786..1788, 1791..1908, 2452..2561
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved