Loxodonta_africana Locus ENSLAFG00000003677
snOPY snoRNA Orthological Gene Database
Loxodonta_africana ENSLAFG00000003677
Loxodonta_africana
ENSLAFG00000003677
scaffold_17818
SNORD102, SNORA27
1644..1715, 1987..2113
4296
GTATGAGCTGAGTTAGGTATCACAAAATGAGGTGGCTGAGTAAAGGGGTTTGATACAGC
ATGTGAAAATTGGAAGGCCGAGTTTTGTCATGCCCTGTAAGTAGGAATTATCATTTTTGT
GACTCCAGTGCCCTTGATACACTAGCCTGGGCTCTACAGATACAGTGTGGAAGAGGCCCT
CTTGTATTTTTATGTTCTAATAGGGAAATTGTACTGGTTTGGGTTCTAGTTTCCCGTTTC
GCTACTTAGGAGTTTAACTTACATAAATCAGTTAATGTTTACAAGCCTGTATCCTCCTCT
GGAAAACTGTTAGTTTTCTTGCTTGCTTTCATAAATGGATGAAATAGTCCCAGCCTTGTT
GTTAGGTGTCGTCGAGTCTGTTAACAACTCATGCTACTCGTATGTACGACAGAACGAAAC
AGTACCCAGTCCCGCGCCAGCCTCACAGCTCTTATGTTGAGCCCGTTGTTGTAGCCACTT
TGTCAGTCTGTCTTGGTGAGAGTCTTCCTCTTTTTTGCCCCCTTCTGTATGCATGATGTC
CTTCTCCAGTGACTGGTCCCTCTTGGTAACATGTCCAAAGTTTGTGAGATGAAGTCTCGC
TATCCTTGCTCCTAAGGAGCATTCTGGCATTACTTCTTCCAAGACAGACCTGTTCGTTCT
TCTGGCAGTCCATGGCATATTCAATATTAGAGGATGATAACTTTTCTAGTAGAAAGGAAG
GAATGGAAACATGAGTAAATATATTTTAATGCTAAGAACTTAAGCATTTTTGGCAAAGAC
CTTACTTGATCTTTTTAAAAGACAAAATGAAAATTTTTGCCCTTTTAAAGAAATAATGCC
TGGTGATCCAGCTTTTTAGATTGTTCCCTAATAGTTTAATCTAACATTAACTGATAAAAT
GCAACCATCTGAAATTACAGGCTTTTTGTATAGAAGAGCAAATCTTAATTTTGAGGTTTA
TTTAAATTTCTTGTACTTTCTGGTTTCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
AGAGAAGAGGCACCCGCTATATGTTCTCTAGGCCTTTTAGAAAACATGGTAAGGTTTGCC
CTCCTTGAGAGAAAATGTGGCATACGTTTTTATTTTATTAGCATGACTTGTACAACGCAT
TCTTAATAAATGGTATCACATAACCAGCATCTACCTAACTTACTTTGTAATAAAGGCATG
ACTTTTGTATAGTAGTTTCTTAACTAAATATTGGCACATGATTAAACTTTGGTTTGAAGA
GAATTTGTGATTTAGTTGATTGATTTTACTTATAAATTTTCCACTAGCAGAAGTTTAAAA
TTTACCTGTCAAAACTGTATGTTTTTAAAAAAAAAAAAAAAGACTCTGGGCTTTTCTTTG
TCTTGATACTGACTAACAAAATATTTTGCAGGCGTTGTTCCTTTGGCCACATACATGCGA
ATCTACAAGAAGGGTGATATTGTAGACATCAAGGTAAATAATAAAATTGGGACTATAACA
CTAGAAATTAGAAAAGCTGGATTTAATCTAAAAAAAAGGAATAGTGCAGACTTTAATTAT
TGTTGAAGATGGAGATTATGATTGTAAAAATGCAGGTGAACTCTGCTCTTTTGTGACCGG
TATTTACATTCCCTGAGACTCTAGAGCTTGATGATGATTGTCTTTTTGATTGCTTTGAAG
CAATGTGAAAAACACATTTCACCGGCTCTGAAAGCTCTTGAGTTGTCATTTAAAAAGGGA
AAAAAAGTCTTAGAATATCTTGGTTACTTGAAAGTCCAGGGTGGAAAGGAAGGAGGAACT
GGTGGTATAACATTTTTCTCTTTCTCACAGGGAACGGGCACTGTTCAAAAAGGAATGCCC
CACAAATGTTACCATGGCAAAACTGGGAGAGTCTACAATGTTACCCAGCATGCTGTTGGC
ATTATTGTGAACAAACAAGTTAAGTATGTAATGTCATAGTTCTTTGTGGTTAATTAATAT
TCCCTCATACCCGCTTTTCACTTTGCCAATTGGACTTATGTCTTTATTGGTCATTCAAGT
GGGGTAAAGGAAATATCCTTTTAAAACTCAGGCAAACTAGGTGTTTGTCTTGTATCCTGT
CAGAGGAAACAAGTTGAAATAGACTTACTAGAAGGTTTTACCGCTTATGCAATTTGGTTT
TAAGCAGTTCTAGTTTTCAGAGTATAAAAAGCAGTTTAAGAAGTAAGTTTGAGTCATCTG
GTTTTGGTTAAATTCCTTTGTATTTCGGGGTCTGTCCTCAGTAGAAAAGAGCTTAAGAGT
GGATGTTTGCCTCAAGTCTTCTTCCAGTAAAATTAATAAAAAGGTTTAATGGTTTATTTA
ATAAGTGGAACTGCCAAAAATGTTTTCTAAATTTGGGTTTTTTATATGTGTATATATATT
TTTATTTTGCTTCAAGTGAAAATTTACAAATCGAGTCAGTTTGTCGTACAAAAATTTATA
TACACCTTGCTATATACTCCTAGTTGCTTTCCCCCTAATGGGACAGCACACTCCTTCCAT
CCACTCCCTGTTTTCGTGTCCTTTCAGCCAGCTTCTGACCCCCTTTGCCCCCTCATCTCC
CTTCCAGACAGGAGCTGCCCACATAGTCTCATGTGTTTAATTGATCCAAGAAGCTCACTC
TTCACCAGTATCATTTTCTATCCCATAGTTCAGCCCAATCCCTGTCTGAAGAGTTGGCTT
TGGGAATGGCTCCTATCCTGGGCTAACGGACGGTCTGGGGACCATGACCTCTGGGGTCCT
TCTGGTCTCAGACCATTAAGTCTGGTCTTTTTATGAGAATTTGGGGTCTGCATCCCACTG
GAGGTTGTATTTTTGATGAAACATTTATAAGAATTTTTGCTCTTTCCAGGGGCAAGATTC
TCGCGAAGAGAATTAACGTGCGTGTTGAGCACATTAAGCACTCTAAGAGCCGAGATAGTT
TCTTGAAACGCGTGAAGGAAAATGATCAGAAAAAGAAGGAAGCCAAAGAGAAAGGTACCT
GGGTTCAACTGAAACGCCAGGTGAGTGTTCGACAGGGGCTTTTTTGGGATTAGTTTTGGG
GGGACATTGAACTTGTTGCTCAGCGATGCTTTTTTTTTTTTTTTTTTTTTGAAGATTTAA
GAATTGAGTATATGTTTCATTGGTTTTGAGAGCATTTTACAGTTGTGTTACACTACTTTA
TGTGATTGTTCTTTTTTTTTTTTTTAGCCTGCTCCACCCCGAGAGGCACACTTTGTGAGA
ACCAACGGAAAGGAGCCTGAGCTGCTGGAACCTATTCCCTATGAATTCATGGCCTAACAG
ATGTACAATAAAGATGCCTGCAATGCCAAAATGCTAGGTCTCTGATTTTGTAGTATTTAA
AGCACTCTTTGTTTCCTAATTTGCTGAGTAGTAAGTGCCTTTTCTATTAGAATTTAGTCC
TTGATGAAAAATACAAGGTGGTTTATTGTTTGACAAGGAATATAACTCGATTAGACCTTA
GGAAACTGCTGAATGTTATTTATAAAATATATTAATTTGACATGATTCCTCTAAATCACT
GTGAAAAAAACAAGAATTTGCAAAGATGAATGGCAGATTACCTGTTGCATTACAGTTAAG
CTCAGGGAATGTTTATTACTCATGATTGTATCATCAGTAGTTGGATTTTAAGGATCAGGA
TCTTGCCTTTAAAGCCTATTACTTAAAAATAGATTGTATATATAAAGTGTCCCGTTATTT
GTGAGTTATACTAGTTCCAGATTGCACGGACCTTTCATGAATCAGTTCAGAGAATAGTGC
TTATGGTAATTTGAAACTAGAATGTGTTTTACCAAGGGCAAATATTTATAAAGCAATTCA
TATAAACCATGTGACATTCTAAGCATTTTACATTACACCAAAAGTTTGGGAAAAGGTACT
GTTACGTTGTTGGGTGCTGTTGAGTCGATTCTGACTCAGCAACCCCATAAGACACAGTAG
AACTGCCCCATAGAGTTTTCTTGACTAATCTTTATAGAAGCAAATAGCTCACTAGTTTGA
ACCACCAACCTTCCAGTTAGCATGGTGCCACCGGGGCTCCTGAAGTACTATTTTGCCTGT
TTACATAAAAGGAAACAGACAACGGTTGAGTAACTTGTCCAGAGTTGCAGGTGGTACGTG
TTAAAAATTCAAATAGTCTGGCACCATGATTGGGTCTTAATCACTAGTGTTTAATTCCTC
GTTGATTAATGGGAACAGTGCACTACTTTGTATGGTTGTAGCACATTGAGGTTATTCAGT
TGATACTTGCACCTGGATGTGACAGAAAGGTATCTCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1067, 1411..1472, 1830..1942, 2869..3019, 3207..3296
1001..1067, 1411..1472, 1830..1942, 2869..3019, 3207..3293
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved