Loxodonta_africana Locus RPS7
snOPY snoRNA Orthological Gene Database
Loxodonta_africana RPS7
Loxodonta_africana
RPS7
scaffold_13093
SNORA73
7825..8032
9186
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGCCGACAGCGGGCGCGTGTTGACGGG
CCGGGAGAGCCCCTTCCTGGGAGCTGGCGGTGGGTGAGCAGGCCGACGAGACTGTGGAGG
GTTGGTACATTTAATTCCTTCTTTGTTTTCAGGAAAAGGCCATGTTCAGTTCAAGCGCGA
AGATTGTGAAGCCCAATGGCGAAAAGCCGGATGAGTTCGAGTCTGGCATTTCTCAAGTAG
GTGAAAGACTGGGGAGAGGGGCTGTGACCCCACACTTGCGCGTCTCCGGAACTGACGGGT
GGCTTTCGGGGTATGTGTGCTCCTGGTAGAGTGGCCATGTGTGTCCGGCTGGGTCTCCCG
GGTCCCCTCCCAAACACCACCGGGATGGTAGCTTTTTCGCCCCTGGGCAGCACTTGCTAC
GTTCCTGCAGGTTGTGACAGGTTTTGGTGGTGGCGGGACGGGTGCCGGCGTGTTGACGGC
CCTGTAGACATTGAGGTTTGGCTTGTGCTGTTTTCTCTTTCTTTAGGCGCTGCTTGAACT
GGAGATGAACTCGGACTTAAAGGCTCAGTTGAGGGAGCTGAATATAACCGCAGCCAAGGT
AAACTTAGTTTTTCCTTTGTTAAAACGAAGGGAGAAGCGTAGTGTGTACTCTGGAAACAG
TGCCTTAGAGGAGTTGTTTTATTGTTGAATGACGACGTAAATTTAATGCCAATTTGAGGC
CTGGTCCCTTGATACAGCCTTCAGAGAAGATTGGGGTATATTGTTATATACAGTTACATG
TGCCCCATTTGAAAGTGGAATTGGAGTTTACCTGATCAGTTGCATAATGCAGAAAAATAG
TATGAACTGGGTTCATTTTTGGATATATCTGGCGTTATTTAGTAGTAAAGATAGTAAGAT
GTCATAGGAAACTAAACTTAGCTTGGAATTAAAGCATAGTGTTGGTGCAAAAGTGGAAGT
AGCAGTCTGTCATGGATGTTGGCTTTAACAGTGACATGTAGTCTGAGGGAATGTAGATTG
GTGGGAATAATTTGTTCTGAGTTGAAGTCCGGTTTTTATTCCTCCTTGTTCCTGGAGTAA
GAAAGTATAGAAGTTGAGAAATTCTCTGAGGGTTGGCCTTATTAACATGTGGTGTATTTA
TATTAAAAATGCCTGTTAGAACATTCAGGAGTTTAGAATTTTCTCTTTATCTCTAATTTG
ATGTCAACATTTTATTTTTTGAAGTAACAATCTTGACTCATAACTGCTTAATGTACAGAT
TATTTTAAGTTTATGTTTTTATAATCTACAGTTTTTTTGGACAGTTTAAAATTTGAATAG
GATTGTGTAGAGGACCATTCATTGGCCATCATTTTCGCTTGCGCAAAATTTAAAATTTTC
TGTAGTAAGTTAACCATGTGTATGGTTACCAACAAATTCACAAAGTTTTGTGTGTCAGCT
TTGTCAGGCATGAGATAGACTTAGTGGAGCCGTGGTTTATGGCAATTATGAGCTAATGAA
AATGCTAAAAGGGGTCTTAATGAATCAGGCATATATTGCAGCCAGTATTTGCGTTGAACG
GTAACCCACAGGACTGTTTGAATGGGAAGGATGGACGTTATGAACTTAAAATAGTATTGA
CTTTTTTGCTCTAGGAAATTGAAGTTGGTGGTGGCCGGAAAGCTATTATAATCTTTGTTC
CCGTTCCTCAACTGAAGTCTTTCCAGAAAATCCAAGTCAGGCTAGTACGCGAACTGGAGA
AAAAGTTCAGTGGAAAGCATGTTGTCTTTATTGCTCAGGTACGTTACGTTGTTACATGAT
CTACGTTCAGACCTGGCCTTGGTGTCAGCTGAGTTCTGGCGGGGGGATTAAGTGCCAGAT
TGATCAGGAATACAAGAAATACTCTTCTGGGTGGCTGTGAATTAACTTGACAGCCACGGG
TTAGGCATTTTAGTACCTACATTGGGCAGTGGGTGTAATTGAATGTGTAGTATTTGTGGG
ATCAGATCAATCATGAAGCAACCAAATTTCTTCCATAGCATTTTAATATAAACAATGAAT
TAGTGGGAAAATTAGGAAGTAATAATCACAGAATGACTTTTCAGCAAATTAGGTTATTTT
GCTTTCTTGACCTTTGAACTTATTCTGTTACTACGTTGTTTTGCTGTTGAAGCAGTTTGA
CAGCTTTTAGTCTTCTGTCAGCTTACAGCCCTTTTTTGCATTTTGTTGCATGGTAATTTT
TACCTTACAGAGGAGAATTCTGCCTAAACCAACTCGAAAAAGTCGTACAAAAAATAAGCA
GAAGCGTCCCAGAAGGTGAGTATTTTTATCAGCAAAAAAAGTATGTGTNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNAGAATAAAGTGCTGCACCCAACTGATTGCAAAC
TCTGCACCTTAATATCCCTTGCCTTCCAGGCTGTGTTTTCAGGTAATGGCTTTACAATGT
TCCTAGTGTCCTGTCTATAACTAAAGCATAACTGTCTCCCTCACAACTAAGATATAATTG
GTAGGTGTTGTGTATTGAATTATGTCTCCCCAAAAACATGTTATAAATCCTAATCTCTAT
GCCCTGTGGTTAGTCCCATTTGGGAATGGGCTCTTTGTTATGTTAATGAGATAGGGTTAG
CATAGGGTGTGTCTTGAGTTAATCTCTTGGAGATACAAAAGATTAAACAAAAGAGTGGGC
ACAGACAGGGTAAGATAGATGCCAGCACACATGGAAGATCTCCAAGGAACCAGGAAGCTG
AAGAGTTAAGGACCTTTCTTCAGAGGCGACAGAAAAAGCCTTCCCCTAGAGCCAGCACCC
TGAATTTGGACTTTTAGCCTGCTAAACTGTGAGAAAATAAACTTCATTTGTTAAAGCCAC
CTGCTTGTGGGATTTCTGTTATAGCAGCACTAGATAACTAAGACAGTAGGTCACAGGGAT
TCTACCACTCTTCTGATCTGGGTTTCTGCCATTAGGTTTATTTCTCTCAGTCCTTCAGTA
GTTATCTTCTACACAGATTGAAAACATTTTCTTTGGCTTCTGCTGTCTGTAGCAGGGTTA
CAATTATTTTTCCTCTGAAATCCTTCAGCTCTTGTTTGTAATATAAAGATGCATTGCCCC
CCTGTAAAAAATTTTAGACAACAACATTGCCATCTGACTTGAAGAGTAGCTTTCATTCTA
CTCTGGCTTTTTTTTTTTTTTTTGCTTTTTCTTGTGTCTTTGTATAAGTGAGGTCAGATA
ATATTTGTCCTCTTGGGATTGACGTTTTTCATTCAGCGTAATGTCTTCAAGCTTCGTCCA
TATTGTAGCGTGTATCAAGACTTCGTTTCTCCTACTGACAGTAGGATTGTGTGTATGTAC
CAAGTTTTGTTTATCCACTCGTCTGTTGATGGGCATTTAGGTTGTTTCCACTTTTGGGCT
GTTGTGCATAGTGCAGTGAACATTGGTGCTACTCTAATTTTTAAACAAAGTCATGAACAA
ATTTCCATATTAGTGTGCTTTTCTAGCACGCTCAGAATCTGCTTAAGTAATGAGTAGCAG
TGAACAGCTGAGCTGGCTGCCTAACTTGCTTTCTTGAAAGGTGCTAAAGGCTTTGGGAGG
TGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCATTTTAATCAATCAGTAAGTTGCTTCT
CCAGTTAGGTTTTGGTGTGATTACATTACATGTAGCTAGTCTGTTTGAAAATCAGTTTGA
ATGAAATTTGCCATTTACATTTTGAATAAAGAGGGGCCTTTCTGGTATTCACCAGAGGGT
AGATATTGTTAGATCCTTAAGTTTGTAATTGTTTTCTTTAAGCCGTACTCTGACAGCCGT
ACATGACGCGATCCTTGAAGACTTGGTCTTCCCAAGTGAGATCGTGGGCAAGAGAATCCG
TGTAAAACTGGACGGCAGCCGGCTTATCAAAGTGCATTTGGACAAAGCACAGCAGAACAA
TGTAGAACACAAGGTAACAGGTTAACTTTTTTATTACGGAAAAGTTGAAAGACAGATAAA
AGTAAAGTGCCGTGTTATATGTCTTTCTGTTGTAAACACATGGCTAAGCCAGTCTACTCT
CATTTGGGTTATGTGTGTCAGGTTTTGAATTGGGAATGTTTTTTAAAAAATTGGATACTT
GGTAAAATTAGGAAAAATACAGCAAACAATTCATGGTCTTACTTTTAGCAAGACTGGATG
CCCTTGATAAATTATAGACTGGGTCGAGGAGGGTATTAGGATCTGGGGAGAACTGTCACT
TTCCTGAAGACTTGGTAGAAAATGATCAATGTGGACAGCCATTGGGGGTCACTGAGTGGC
TATGTCCGTGTGCTGTAAAGGAGCACAGCGCTCCGGTGCAGTGGTGTAAAATCCTGTCCC
ACGACATTGGAGACCAAATTCCCAGTCTTTGGACTGGTGAGGGCATGGTCCTGCATATTT
CTTATCTTCTCAGTACCTAGTTGCTGAGGAGAAAAACCATACGGGGCACAGTTTCATAAA
AGCTTTATGTTTTAAGGTTATTTATATTTAAAAGTTTTTGATGAGTTATTTCTTCTTTTG
TAGGTTGAACTTTTTCTGGTGTGTATAAGAAGCTCACGGGCAAGGATGTTAATTTTGAAT
TCCCAGAGTTTCAATTGTAAAAAAAAAAAAAAAATGACTAAATAAAGAGCCATTCACAGT
ATTCTGTCTTAGGAATGTTTTTCAAAATTCCAGAGACATGAATGCACTGAGCTGTCTACA
TTACTCAGCTTCCTACAAAAACTGAAAGATACAAGGTGTTGCACCAACAGAAGACACTAA
AACATGGAAGATTTTGAGCAGAGAGTGCCTGTAAGTTTGGTACATATGAGGATATATATG
TAACCAGTGAAGTCGTAATAGGTTTAATCATAAGAAATGGCCAGAAGTGGTAAAAAATTG
GCACTTGGTCATGGTTCAGCTTAAAAATATGCAGGTACTCTGAAGTGTGGATAATGGGCA
GAGGTTTGCTCAGAAAGGAATGGCTTAATTTTGGACTGATAAAAGCAACAGCATAGAAAG
GTCAAGATTCCAGGTTTTGGAATCATGCTTTTACATCCTATTTGTATTATGGTGGATGCG
GAGACATACCTTGAAGGGTCTACAGGACAGTGCTTTCTTTTTGTTTTGGGCCATAGTTCT
GTTGACTAAAGTACATAGTAAAACATTAATATATTAAATCCCCTTGCTCCCAGCACAGTG
CATTAACTTCAGGAGGATAATACTGTTTGTCCTGGGAAGCCATACAAATAGTTGGCCTTA
AGAGAAAGAGGACAGGTTTCAGAAGTACCCAGCACAGGCCAAGAATAGTTCCTGAAAAAC
TGGATGATAGAAACCTCTTTTTTTCCAAGAGTAAAACCTGTCAAGGAAGTGTTTTGTTGT
TGAATTTTTATATTTAAATTCATATTAGGTCTTACGTGTATGTTAGAAATTGAAGTGTAA
GGGTACACTTAATATACCCCAAACAATGTACAATGAAAGCTGTGAGAGCCGGAACTTGAC
TGCCTCGTCTCCCATGTTTGCTGCCTTTGACATGGTGCAGCGTTACCACTTTCCTACTGC
TTGTTTTTGTGGAAAATACTTGAGTTTTCCTTCTGGCATGCTGTTTGGTTTACACAGTTT
CAGGCCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1075, 1366..1437, 2474..2617, 3070..3134, 7362..7512, 8103..8105, 8108..8177, 8185..8186
1001..1075, 1366..1437, 2474..2617, 3070..3134, 7362..7512, 8103..8105, 8108..8176
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved