Loxodonta_africana Locus TXNDC1
snOPY snoRNA Orthological Gene Database
Loxodonta_africana TXNDC1
Loxodonta_africana
TXNDC1
scaffold_12810
SNORA70
1231..1365
13374
TCCACCAGCCGTTCCTTGGAAACCCCATGGGGCAGTTCTACTGTCCTGTGGGGTCTCTG
TGAGTCAGAATTGACTCCATGGCAACGGATCTCGTTTTTTGGTTTAGCCTCACGTTTAAA
ATGCATAGAACTTACCGCTTTGCCAGCTTCATGGTTTTTAGTAGAAAATATTCTTCAAAA
ACTGTAAATTTTTGTCCCAAGAGGGATGATCATGTTAGAGTGCTTAACGTTGTAGCATAT
AGTAACATTTAAAAAATTTTATTATTAGGTGAAGACAGTTTAGAAGTTTATTTTTTCATC
AATGATCTGTGTATGTTAAGTTTTATTATATGTTTGCTTTATGTTTGCAAAATAGCCATA
TATTGTTATTCTTTAATTTTTAGTTTTTTTTTTTTTTTAATATTTCTTAGTTATGCTCCG
TGGTGTCCTGCTTGTCAAAATCTTCAGCCAGAATGGGAAAGTTTTGCTGAATGGGGAGAA
GATCTTGAGGTTAATGTTGGAAAAGTAGATGTCACAGAGCAACCAGGTACTGTAAGTCTG
GGGTTGGTTTTGTTTCCTTGCAGATTGGGTTGATATGCTTATCCTGTTTTCCATATTAAG
AGTTCTTAACTTCCTTTCATTAGGTTTTGAAAACATGAGGTCTGCAGCTAGTTAAGCTGA
CTGGCCTACCTCCTTGATGGGGGCTCAGTGTGCAATGGCTGCAAACAGCAGGCTCCCTGG
TAGTGTGTGCAGTTCACTCCTTGTATGTGTTGCTCTAAGGGACCTTGGAGACATCATCTT
CCCCCTGGCTGCACAAGTAACTGCTTTGGATCTCTTTTGTTTGCATCTCAGGCCCCAGAT
TAGCATGTAAGATGCCTTTAGAGAGGTCCTAGAACACTGTGGTGCCAGTGTACCTTGGCC
AAGGAACCATTTGCATCCACACCAAGCTTTAGAATAAACAAAACCAAAACCCAGTGCCCT
CGAGTCGATTTTGACTCATAGCGACCCTATAGGATGGAGTAGAACTGCCCCATATAAGGA
GCATTTATTTGAGGTTCTTTCTTTGTAGGGTCAAGGTTAAGTTCCCTGACAAGAGAAGAT
CCAAATCTCTGAAATCAGACTTTCCCAAATGTAATGGCTATGATTTGAAGACAAAAACCA
AAAAACTAGTTGCTGTCATGCTTGTGAAACCAGATCCACTCTTCACTTGGACAAGTGGCA
TGCTCTGCCTTTGAGGGTACTCCTTCCTCAGACCAGCCTCATTATCTGTTCTTGGCAGTT
AAGCCTGAGTTCCTGGCTCTGCCCATCCCAAATAGTAATAATAAAACAAAACCCACTGCT
ATCGAGTCAATTCTGACTCATAGCGACCCTATATGACAGAGTAGAACTGCCCTGTAGAGT
TTCCGAAGAGTGCCTGGCGGATTCGAACTGCTGATCTGTTGGTTAGCACCTGTAGCATTT
AACAACTATGCCACTAGTAATAATAGCTGATATTTATTGAGCACTTACCAGTTACCAGCT
TCTGTGTGTTTTGCATTTATTATTTGAACCTCACATACAACCTTGTGAGGTAGGTAATAT
CCCCATTTTACATATATGGAAACTGAGCGCAAAGAGGTTAGTTTTCAGTTTTATCAGTGT
TTGGCACATGGTTAATAGTGAATGTGGCTGTTAATGTTGTTGTCCCTTATGAAAGATTCA
TAATAACATTTTCAATTTTTTGTAGCATGTTAAAATCTGCTTTTGTTTCTTGAATGTCAG
ATAGTTTCGTTCGATTTTAGACCTTTCTAAAATGCTACTGTCATATTATGCTTTGCAATG
ACCGATCACTAGTGATCTTATCACATAGTGTAGTCAACCAAGTGTTATGTATTCACAAAT
GTCTTCAATATTCAAACTGTGTATTTTCTTATTGAGATAATGTATGGTAGTGTTTTTTTC
AAGTTGCTGCAAGTACATAGTTGAGATTTTTTATTGTTTATTACAGAGCTTAACTATTTT
AGGTGTAATTTCATGTTCTTTTCCTATTAGTATTTAAAAAGTTCCAAACCAACTTTTAAG
TAGCCAGTGATTGGCCCGTATAAGACCTGTTATGTGAATTTCCTTGTATTTATTTCTAAA
GCCTTTATGTCCTTTTGTAGGACTGAGTGGACGATTTATAATAACTGCTCTTCCTACTAT
TTATCAGTAAGTATTTGAAGACACTATAGCTGTGGAGAAGGATGCATCATAGTATAACGA
GAATAGTAGGCCTCCGGCTTGGATCACGTTTAAAGAACTGAGATAATTTCATTATATTCA
GCAAGTATATTAGAGGGCTAATTTTGCTCTTAGTGTTGTCCTAGGTGCCTTCAGATACAT
GAATGATGTTTGAAACATAGTCCCTGTTCTCAAAGACTTGCAGTTGTTTTGGAAGCTCAC
ATGAAATGGTATAACACCAGCCAGCATAATAAATGATTATAAGCTCAGAGTAGTGGCACA
AATTGTAAATTCTGTAGGAAGTGAAATAAGGGAGAAATCACTACTGGCTGGAGTGGTTCC
AGGGGAATATAGAGTTTAAACACAACCTTGGTTGTAGAGTAGAATTTTTAAGAGTGCAGG
GTAGCTATACCGTTCTAGGATGATCTCATAAACAATGATTAATAAGAGCATGGTATCTAA
GACAGTGCCGTGGCTCATCCTTGGGGAGACTAGTGAGTGATTTGGTTGTGTGCTAAGTCA
GAATGAACAAGATTATGAAGTCTTCGGCATTAGTGTTTTAGTTTGACTTCTAAACCATGG
GTTTGAAACCTCAAATCTGTGTACCTGCCCTGTACCTTAATGTCATCTAGCTGGTGGGTT
AAATACCAAGACCTACATTTATCCTTATTTAAAGTTATGAAAACGGTAAGTTGGCAATTC
TTTGTGTGTATCTGTATCTCCTATATTGCTTTTTCTTGTCATTTGTTTTTTAATGTTTGA
ATCTGTTTTTATTCACCCTTACTGTCTTTGTATCTATTTCTGTTCTATCTCTGAGTGCTT
CTCTGTCTCTCTTTTTATTCAGTCCTTCTCCCCACGTGCCTCTTAACTGACTGTAATCAG
TCTTCCCTCTTTTTTTCACTTCTCAGCATCCCCTGAACTTTTTCAGAATTTCCTGCTCCT
TTGTTTTTAGTCACATTGTTTACCATGACCTTTCTGCCTCTTGAAATCCTACCCATCCTT
CAAAGAACAGCTCCAGTTGCCACCTTCTCCACAAAACTTCTTTTTTTGGGGGTAGGGGGC
AGTGTTCACTGTGGTCTTTAACTCTGGATAAATAAAAGATCCCTTAACCCTGGATGTACT
CCTGTAGGTAGTAGGGAGCTATTGAAAGTTTTTGCACTTAAGTGACGAAATAGAAGTATT
AAGTAGGATTAGACTGGCTCTATTACTTAGGGTCATTTGGAAATGAAGATGTAGAGCTGT
ATTATTTAGGGTAGTTCGAGATGTGGAGCAAGGAGAGCATTATGGCCCTATGCCAGCACT
CCATACATTGGCACTGGAGAGGAGGAAGTGAATGTAAGGAAGAGTTCAAAGCAGACTGTA
AAGTCGAATGATTAAAAATGCGAGGAAGGGAAGCACTATACCTGCTTACTCCAGGGATTT
AAACCATGGTGGCTGTGGTGATGCCATGATGACCACAGTAACGTCTTAAAGTTTTAACCT
GATGATAGCTAATAATATGTGCCAGGGACTATTCTAACAACTTTCATGTAGTAATTCCTT
TAATATGTGTATTGTACATAAAATTTCTGAGATTATCATGTTCCATGGTTTTAGTATTTG
TAAGAGTAACGATAAGGTCTTAAGGATTATTGTTTAAACATAAACTCATTAAATTTGGGG
CTAAGATGTCATGAGATAATTAGTATAATTTGCCACCTGTGCATTACTAATGATATTAAA
TATTAGGATGGACTATAAAATGAGGTAGAGTAAGAGCAAAACAGAGTCTGTTATTTACAA
GGTATTGGTTAATTTTTTACTTTGACCCTCTTTAGTTGTAAAGATGGTGAATTTAGGCGT
TATCAGGGCCCACGGACTAAGAAGGACTTCATAAACTTTATAAGTGAAAAAGAATGGAAG
AGTATTGAACCTGTTTCATCATGGTTTGGTCCAGGTTCTGTTCTGTAAGTATAAGTAATT
TTCTCAGAGTTAATTGAAACAGTCATAGGTTGCTTAACGTCCATGATACGTTCTGTGAAA
TAGGACATTGTTATTTGATTGTTGTGTGAACGCCGTATTTACAGGCAGTCCCTGGGTTCC
AAACATCCGACTTGTGGACAGCTTGTATTTAAGAACAGACTGCCGTAAAGCCTATTAGAA
ATTTAAGTTAAATAGTGGTTTGTAATAACGAATGCGTCACCACTTTGTGACGCTCACAAA
AGCATTGCCTGGTGTGGAAGTGTTTCTTAGGTGTTTTATATGCATAGAAAGGTAAAATGT
ATATACTAAGACAAACAATTGGCTAACTGACACTAAATAAGAACTGTATGTATCGACTTA
CCTACAAATTCGACTTAAAGACGTAGGAACGGATCTTGTTCGTTACCTGGGGACTGCCTG
CATATAACTCTATTATAACTTACGGGACCACGGACATATATGTGGTCTGACGTTGCCCGA
ACGACATTATGCAGTGCGTGGCAGTAGTTGTACTTCATATAAATAAAGCATTCATGCTCA
GTTTATTTCTTGAGTTCTTAAGGTATATTTAGATTTATTACATATTAATATATATAACAT
CAAAACAGATACTTTCATCTTTGAGTTAGAAAGACACACTCTATAGAATTTAGTTGAATC
CCTTTTCAGGCATATTTTAGCTTTTTAGATATGGATCAACAGAGAACACATTACCTCCAT
CAGAGTATGAGCAGTGTAAAGCTGTCACTTGAGTTTACTAGTTTGAAGGAGAAGCCTCAA
ATGTTTACCTGCTCATGTACCTTTAGACTTCAGTTCTTGATGTTTGGTTGGTTATCCCAC
CTGCCTGATGACTTACATGAATAGTATATATGAGCAGTGACCCTAATGACATGATTAACC
ACTGACCTTTATAGATAGCTGGAGGGTATCTGTATTTCTTCATAGCATTTTTTCAACATT
TTTTTTCTATAGAGAGTAGGAGTAGGAGATGGCAAGCGTATTTCCTGCTGTGCTGTTGGT
GTACAAGGCTACAGAGGTCATCTGAGAGTCAGCAAATTTTGCTGAGGTCACCACGTGGCA
AAGTTATCTTTTCTTGTCCTCTCACCAGACTTACCCTTGGAGGATGGGGAGTTGGGATAC
CAACCATTTAAGAAATAATGTCCTGGCTTCTGGGAGTGGGAGTAATGTTAGCCCTAAGCA
GTATTTTGAAGTAGTTTATCTTTAGCACCTTTTCTTGATGTGCCGCTTTCCCTCTTCCTG
AGAAAAACCTCCGAGTTGAATTATCCTTTAGCTGTCAGAATTCCTCCACCTAATTCCTAT
GCCTAATCCAATTAAGGAACTGTATACATGATACAGAACGTCTCCAGCATCTCAGGAAGC
TTCCTCTTGCCTCTCCTTAAAACACCAGTTTGGAAAGGAATCCCTGGCGGGGTGAGGAGA
ATGGTGGTGTTCCAAGTGGGAAGGATGGGTTCAAATGTTCCCAGTTCCTTTCTCCTGAGT
TTTTTCTTCCTGAGGTTCCCTTCTCTGCTCATTCTTTGGAGGATTTTAAAGGTGCCATTT
GCTTACAGTCAGTCTAACTTTAACCAGCTGGTTTCATAGAGCCTGTGGCCTGTTACTGAG
AATATATTGGGATTTCGTATAGCTTCTCATTTGCTTGACCTCAAAAGGCAGAGGATAATT
TTTATTTTTCCTTTTATAAATGCAAAATTCAGATACTAACCCCTTCTCACTAAAAACAAC
CTAAGATACTCTTTAGATGAATTTCTTAAACAGAATTTTTTTTTTTTTTTACATTAAAAC
ACTGGGAGAACTTAAGATGAAAGGTTAATATCAGAACAATAGGAAAAAAAAATTTATTTA
CAATGAAGTTGCACGGTGGTAATTCAGAAACAGTAACTTCATTAATAAGCATTTTTTTAT
TATAGTTATGAAATCAGTGATATATCACTAGTCTTAAGACTAACCTTAAAATCTGTTGTA
TTGGGGAAATAATAAAGTGTAAAATAGAATAGACATATAGATATCCACATACATTGTATT
TCAGACTTAGGTATTTTATTCAGTTTTCCAATCATCTCTCTCTTATTTCAGGATGAGTAG
TATGTCAGCACTCTTTCAGCTATCTATGTGGATCAGGGTATGGGCTAAATTTTTATTTCT
ATTTTAAACATTTTTGGAACTCTGTTACCTTTTTTACATTACTGGTTTTTATTTTATTTT
TTCTTCTGATTTTAGGCTTGCCATAACTATTTTACTGAAGACCTTGGATTACCAGTGTGG
GGATCATACACAGTTTTTGCTTTAGCAACCCTGCTTTCAGGACTCTTTTTGGGACTTGTA
AGTACTTCATTTTCAGAGTATTAGGGAAAAATAGAATTTTTACGAATTTGATAATTTGAT
ATAATTGCAATAGCTGTATCATAGTATATGTTTAGATTTCTTACAGTGTTTATTTTTGCA
GTGTATGATATTTGTGGCAGATTGCCTTTGTCCTTCAAAAAGGCGCAGACCACAACCATA
CCCTTCAAGTAAGTATATTTTAAAATGTTTATTTTTATTCACTGTAATCCCATTCATTTC
TGTAAAGGCAATCATACGTATAATAGGTTGCCCTCCGAGCTTAAGTTCCTAAATACGGAG
TGGTGGTCTCTGTATCAGGTATGCCATAGAAAAAGGGGGAGGGAGGTACATATTTCATGT
GAGAATGCTAACCCAGTGGATTTTGGACATTGTTAATTTTTTGACTGTTATAATATGGAA
AATTTTAACATTGCATATAACTTGTAGACATTTAATAACATTGATCTGACACCATTTTAT
TTGAAATTTTTATATTCATGGATCCACTTGAATATACTTTTCTTTGAAGTTATTCATTAC
TACAGTGACCACATTTGATGATGATTATTTGTGTGCCAGCCAATTCTGTGGTTTTTTTTC
TTTTTTGGTAGGATATTGGGACAAAATTCCTGTAGCTGATTGAAGGTTAACATTGACACT
GTATTTTAAAATAAGTTCATGTAATTAGAAGCAATTATTGCTGTCTGACTTATTATAATT
ACCTACCAGTCATTTGTTTTTTAATTTTGAAAGTATAATGTTATGGAAGCCCTCATCTTT
GCAGTTTGTAAAGAACGTTCACGTATTTTTCCCTCATCCTGTTGTCATTTGCTCTCTAAA
GTAGACTGCATAGGTAATATACTATTCCCAGTTTGTGATTGAGGAAACTAAGGCTTAGAG
AGATGAAGCATTTCCATTAAAGTCACACCAAAGCGATAGAGCTGAGAGTAGACCCTAATC
AGACTTGTGGACTGACATTTCTTCCATTAAGCTGCCTTCTTGACTTAGGATCTATTGAGG
TCAAAACTTCTGAAATAAAATCAGGAAAGTATTGGTTATGGCTCAAATAAGATTTCATTT
ACAGTGTACCTTGTGCACTGAATGACTGATAGTTTGTCTGTTCATTTCCTAAATAGTTGT
ATTGATACTTGACATGTATAAAAACTGTTGCCATCGAGTCCATTCTGACTGATAGTAACC
CTATAGGACAGGGTAGAACTTCCCCATAGGGTTTCCAGTCTTCACGGAAGCAAAATGCCA
CATCTTTCTCCCACAGAGCAGCTGATAGGTTTGAACTGCCGACATTTCATTTAGCAGCTG
AGTGTTTAACCGCTTCACTGCCCAGGGTTTCTTTGACGTGTATAGAGGAGGGAATTATTT
TATCCATCGGGCACCTCTCACTCGTAGGAAAAAAAGACAGATTACTTATGGACAAATTCG
TTGCTAGGTTTAAAGTTTTTGAAGTGAAATAAATACAGTGAAACCTGTGAGAGCCAGAAC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGTTTTTGGGAGTATG
CATAGGTTGATTTCTATATCTGAGGACCTACATGTTAGAGCCCGAGCTTTACCTCTTAGA
GCAGTGGTTCTCAAGCTTGAAAATGCATCAGAATCATCTGGTGAGTATTAAAGTGGACTG
CTGGTCCCACCCCTGAGTTTCTGATTCAGAAGGTCTGTGGTGGGGCTAATCATTCGCATT
TCTAACAAATTCCTAGGTGAAGTTGATACTGGCTGGTCTGAGGACTACATTTTGAGAACC
ACTGTCTTATAGAAAATGTTTACCAGTAAGAAAATCTATAGGCCCTAGCCCTTTGTTGTT
GACCATGCAATCTTTTTGAAAGAATACTGACTCTGGTGGGCTTATGTGTATTGGATATTT
AACTGGCGTACTTAGAGGGAGTTAAGTGTTGTCCATTTAGGAAGCTAGCAACAGTCAATA
GGTACAACTTAAGTAACTCTTTTTAAGAGATGCATCTAGGGAAGCATCCAGAGAAGAAAC
TGCTTTTAGCAATTTACAAGAAAATTCAGTTTTTAAAAAGTGATTAGCTAATGCCAGAGT
ACTGTATTTTTCTGCAAATAGTATGCTCATGTAAATAACACACACATAACGGGTGGAAAT
GACAAAATTATGTAAAAAAAGTTCTGCCATAGGCGCCTGTGCATATACTGCACATGTCTT
GTGACATTTCTAGATGTGAATTTTGGCCTCATTCACTCTCATTAAATAGTCCAAAAATTT
TACTTTTGATCATACTTGTATAATAAAAGTTTAGCCATGGTCAAGTCATGGATTGAGTTT
GGTAGTACCCTGGTAGTTGAAAACTAAGCAATGAAATAAATATGTGTGTTTGTTTCTATT
AATTTAAGTTGATAATTGTATCCCCGTTGCTTTCGTTTGAGTCATCAGTTGGAACCTTAA
ACTTCCTGAAGCCTGTCAGTACATCATGTGCTATCAGTCGGAAGCCTGCACTGGTATATA
ATGGCATTGGGTAGCTAGCAATAGGAATCTCAGTGCAGTCTGCATTGACATAATTATCAG
TTATCTTCCAGAACTCTGATACATGATTGTTCTTGGCTCAGCAGTTGAATGTGAAAACCT
TATCAGATCATCTAAAGTGAAACCGTTAAGCTATGTCAGGTCTGCTTATTTCGTAGTCTC
ATTGTATCTTATTAGTGCCAATGTCTTTAATCAACGATCAATGATCATAAGTCACCTTAG
TGAGCATATAAAGAGTCTTGCTTCTTGTACACCTCACATTTGAATTTTGTGATCTGTTTG
CTAGAACCAGCCAGTTATCAATAATATTGTGCACATTTCTTCAGTTTATAAATCTAAATC
TTAGAAACTTTTAGGATCATGGCAGGAATTAACTGCAAGTCCTACACTGCAGACTTTAAA
CTGAAAGTTGTTGCCAGGGCAGAAAAAAGCAGCAGCAGAGTGGCAGCCAGAGAGTTTGAT
GTTGGAGAGTTGGTCATTCGGGAATGAAGAAAGGAGAAAAAGGAGCTGGAGAAAATGAAT
CCGCGAAAACGCACATGTTATGGGCTCAAAGCAAGATGGCCTGAGTGGGAGAAAGACTTG
AAAGAGCAGATTATTTCTTGAAGGGAAGAAAATCAAACTGTCCGTACTGTCAAAATTCAG
ATCAAAGCGAAGCTTCTGGGCAAATAAAATAGGGAATTCCAGATTTCAAGGCAGGTTTCA
CCTGTATTTCTAAGTTCGTGAAAAGGAATAAGAACGAGTAATGATGATGATGAATACACT
AAAAGAGGCTGTTTTAAGGTGAAAATACAGTTTCTTCTGGTGATATTTGTTATTCCAAAG
ACACTGATTATCAAAAATTATGCTTATTTTAAGATTTGCGAAAGCAATAAAATATAAACA
TCTTGTTCTTGTAGTTTTAGGCCTAGGATCATTTCTCATTTATTAATTTCTAGCTGTTTG
TACATTCATACTCTTTGGTTTCAACATGACGTCCCATTTCCAATATGAGCCCGTTCACTT
CACCATTGGTTGCGCTTGGTTTAGGAAAATACCTACCTTTTAAATGAAGTTTCTTTGAGA
TCAATTTTACTTAACAATAAATCTGCTAGGAAAAAAAATGAAATTGAAGTCAGCAACATG
TTAAAAAATACTGGCATAGTGCACCTATGAAAATAATGAGCAGGGGAGTGTTGTGTGGTT
CTTGAGAAAAAATGGATAAGGTGTATTTTGTATGTGTAAAGATATGCCACTCAGTTTTTC
TTGTAAAAGTTCATTAAAGAAACTTGTATCTTTAAATACCTGAATTGGAGAGACTGAAAG
GCATAAATTAATGACTTTCTGAATGCCTGCCCATGTTATCCAAAAAGGCAGCACGTGGTC
TTTGAGCTAGAGGGATCCGATGGAGCATCTCAGCTCTGCCATTTAACAGGAATGTGACAA
AAGTGTCTGTTACAACCTCTCTAAGTCTGTTTCCTCTTGAGACATGGAAGTAATTATACT
TGCCCCATTAGATCATTATGAAGCTTGTAAGTATGTAATGCTCACATTATCCTGGTGGAC
CCATAGTAAGCACCCAGGAAGCATTCACTACTCAGATGGTTATGTAATTTATTGTCCTTT
AATGACACACTGATAGTTATTAATCCATACTTTAATGCACTAGTGTCCCTTTTAAAAGAG
GCCACCTGATTTGAATTGTTTTCCAGAATGTGTATTTTTTTTGTTGTTGTACTGCAGAGA
AAGAAACCCACCTGTGGCCTTACGCAAGATAGGAATGTATTGGTTCATACAGCAAGGAAG
TTTGAGGACAGATTTGTCTGGATCCTGGGACTCAAATGATGTTGTCAAGATGCTATGTGT
TTCTGAATTGCTCAGACTCCATACCTCTGCCTGGGTTCATTCTCAGCTTGGCTGTCTTGA
GTCAGTAGCATAAGATGATGGTGGAAAGCCAAAGCAGTCATTCCTAGAGTAAAAAGCCCA
CCCACTTTCTCCTTATCTTTTGGAGAAATTCTAGTTGACTTAGCTTGAGCTTGTTTCTTG
GATCAGTCACTGTAACCAAGGTTTTTTGACCTCAGTAGAATTACTGACAATTTGGACAGG
ATAATTCTTTATTGTGAGAGAATGTCTTGTACGTTATAGGATATTCAGCAGCATCCCACT
ATATACCTAAAGTCTGACAACCAGAAATTTATTCTGACATTGCCAGGTGGGTTGCCCCCT
GCCAAGAGTCACTGCTGTAACCCATAGCATTCACCAGAATACATGTGATGGGGAATAGGG
GAAGGCCTGTTAATCCAACAGAAAGAGGGATGCTAGGCAGACCAAACAACAGATTGTCTA
CCATGCAGTGATCTCTTTTCATTGTCACTTTATTGCACCATCCCCAATTCTACTGGATTG
TTGGAGTAGGGGCAGTCTGGGATCAATGAACAGATAAAGCTTGGCCCAATTCTGTCTTAC
ATGTCTCAACATGATGCGCTCTAAACTTAATTAGCAGTAGGTCCTATAAAAAATAAAGGG
CATATATACATGTTTAAAAATTCATTGAGCTGTATACTTAAGACTTGTACAATTTATTCT
ACTTACACTTTAAGAAATTTATATATGTGGGGGAGGGGAAGCAGAGGTTCTTGAAACCAG
TTGAAAAATACATGGACATGTTTACAGCCTTCAACCATAAATGATACCTATTCTCCTGGG
AACTAAAACAGGGGTGGTGTTGAAGTTTATTTCACTACCAAACTAAAAGGTTTAATAGCA
AATTAATATAAAGTAGTTATATGTAATGCAGTGTATTTTCTTACACTTATATATTAACAG
CATTAATTGTAGTTCATTAATTTCAGTTCACTTTATAAATAGGTGGATAATTAGAATAAA
TTTGGTAAGTAGAATGGATCTTGTAAACCAGTTTTTATTTTTACAGCATCTGCTTTTTAG
AAATCCTAATATACGATAACCTGCCAAAGCAATTCATGGACATAGGAATCATTATTGCAT
TGTGAATATATCTTGATTTGATTCTAAAGCGAGCCTAGTATGTCAAGAAAAACACATTTT
TGTCTTTATCTTTAAGAAAAATTATTATCAGAATCTTCTCAACCTTTGAAAAAAGTGGAG
GAGGAACAAGAGACTGATGAAGAAGATATGTCCGAAGAAGAAGCTGCAAGTAAAGAAGGA
ACAAACAAAGACTTTGCACAGAATGCCATAAGACAGCGTTCTGTGGGTCCTTCGTCGGCC
ACGGAGAAATCCTAGTTAATTTTTATAAATATCTTAATATTATGATTTTGACAAAAACAG
AAGATTGAAAGTTTCTTTTGGTTTGGAGTGAACTGTGACTTCCTTGTACGTTGCAGGGTT
CATTCCAGATTGTCATTAGATTGAGCAGGCTACCTTCAGAAAATAAAAGTAGCACTAGGT
ATAAATGTTTGAAATATGATTTACGAACAGCATGTTGGTTTAAGTAGTTCTTTAACCTTT
GAAAAATCTGGTGCCAAGCAATAAAATTTCGGTATGTTTGTTGAATAAGAACTTGTTTGA
AGTCTGAGTTGAGAATTTACATTTTCCAAGTATTGCATTTTTGAGGTATTTAAGAAGAGG
TAGTAACGAATTTACTTTATAGAGAGAAAGATTTCTCATTTGATATGATTTTTCTCAGTT
TCACTGTGTGAAAAAAAACATATTTCCCATAGATGGGAATTTTGCCCATATTCTCAAGAA
TTGTATATTTCAGTGACAGCTCTTTGGTCTTTTTAGAGATATAGTCCAAATTTTCCTCTT
ATTTTTAGATTACACAACTAATAAAAACTATCTTTAATTACAGTTTTCTACATATGTTGA
TAATACAGGATATGCTATTGATTTAGGCAACTTTTACAAGTCCTTGATGATGTCCTGACT
TCCTCTTAAAGGTCGATGATTGCCTCTTTTGCCTCCTCTCCGTTCAGTGTATGGGTTTGT
ATTTTTCCTATTCGCCTTGGGTTACTTTTTTAATTTTCCAAATCAGATGGTAATTGTCTG
GAAATTTTTCCATGTTTTGGTAAATAGTGCTTTTTGGTCTTGTTTCAAACTGATAAAGTT
TACTGAGGGATCTTTAAAATTGAAGAGCTATCTACAAAATATTTAAAATTTTGGCCACTC
ATCTCAGATTCTACATTTATTCTTGTTGAACCTCTACTTGAACTTTTTTTTTTCTTTTTT
GGATGTGAAGTTGAACATTCCTGATTTTTATTTGGTGTTATATAAAAGCCTTACA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1115, 2710..2755, 4585..4713, 6821..6866, 6965..7066, 7191..7257, 12786..12964
1001..1115, 2710..2755, 4585..4713, 6821..6866, 6965..7066, 7191..7257, 12786..12961
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved