Loxodonta_africana Locus RABGGTB
snOPY snoRNA Orthological Gene Database
Loxodonta_africana RABGGTB
Loxodonta_africana
RABGGTB
scaffold_5986
SNORD45, SNORD45
1324..1403, 2793..2862
6227
GGGAGCATCCAGTATTGGTGAATTCCAGACTTAGGCCGTTAGGTTGTTCCCTCCAACCT
TGGAGTTAATACTATTTAGTAGCAGTGCACGGAGTTATGGCCATGAGTGCTTTTTTCCAT
AGATGATTAAAGGGACAGGGCTTGACATTCTCCTGTCTTTTATCTACTTCTGCTCACCCT
TCCCCCTTTTAACCCCAATTTTGGGCTTGCAGCATACTAAGAAACCCAAACTCGCTGCCA
TCTAGTTGATATCCCCCTCATAGCCAGCGATCCTATAGGACAGGGTAGCACTGCCCCATA
GGGTTTCCCAAGGCTGTGAATCTTTACAGAAGCAGACTGCCACATCTCCCATGAAGCAGC
TGGTGGGTTGGAACCACTGAACTTTTGGCTAGCAGCTGAGCATTTAAACCACTGTACCAC
CAGGGCTCCTACTAAGAACCAGCATGATTGAAAACCTCAAAATGTGATGCATTGATGACT
GCAGCAATTTCTGGACTCTAGAGATTTTCATGTTTCCTTGTCTTATCCCCTGTATTACCT
TGAACAGTTATCTTGAGTGTTGTGGGCATTTTGGTTTCTAGAAAGGTAGATATGTAATTT
ACTAATAGATAATAGGCTATGTAGGTAATGAAAGAATGGGCATGTATTAAATACAATGTA
TGGACATTTTCTTCCCAAGCAGAGTTAACTTATTTCAACTGTGGTTGGCTCCTGGGTGAG
ACCAAACTCTTAGGACAAATTGTCAGCTGCAGATAAATTTTATAATATGCATCTCAGATA
ATACTTGATTTTTCTGATTAATAGATCATGTTTGAAAGTGGCACCTAAATTTCAGAGCCA
CAAATACAAACTAACTATATATTAGAATCGGGAAGGAAAAAACAGCAGTGTGCTAGTTAG
CCTTATGTGTTGAATCTCTCTCTAATACTCAGCAATTTTTGAAGTACTAACAACAGTATA
TTACCGTATTTTGTTCTCAATAAAGTAATTGTGTGTTTTAGGAATACTGTATGTCTGAGT
ATTTGAGAATGAGTGGCATCTACTGGGGTCTGACAGTAATGGATCTCATGGGACAACTTC
ATCGCATGAATAGAGAAGAAATACTGACGTTTATTAAGTCATGTCAACACGAGTCCGGTG
GAATAAGTGCTAGTATTGGACATGATCCTCATCTTTTATATACTCTTAGTGCTGTCCAGG
TAAATGATAATTAAAATTCAGTCTTGGCGTAATGTATTCTAACCTAAAGTGGGAAAATTG
AAACAGTATTAGAATGATGACAAAAGTCATGCAGTCTTTTCACGTGAAGTCTGTAAACCT
ACAAGGTCAATGATGTGATGGCATGTATTAGCTGAATCCGAAGTTGATGTGTATCATCAA
GCTCTAGAATTACGCTGAGACCTTGGAAGGTATCTAATACCTGAAAATTACTAGGTATGA
GTTACATGTTTCGAGTTTGATATTAGGATCCATAAACATTTGGATTTAAATTTTGTGTGT
TAGTATATTTAACAGTATCCTGGGATGCTAAGTGTAAAATTTAGATGTAGAAAAATAATG
CGTTGAGTTTTAAGGGTTGAATTCTGTTGTAATAAGATGTATAATTTTCTTATTGCATCA
CAGAGTGTGTTCTGCATATTTGAGAAAAGTTTACCTTGTACATAGACAAAAAGTATGTTT
GCTTCGTAATTTAAGATGTAGAAGTTGAGCAAGAATAGCCTTAGAATATTTAGCTATTTT
TGAAGAGATAAATTTACTTAATATGGGTTTTTTTTTGTTGCAGATTCTGACTCTGTATGA
TAGTATTAATGCCATTGATGTAAATAAAGTTGTGGAATATGTTCAAAGTCTACAGAAAGA
AGATGGCTCTTTTGCTGGAGATACTTGGGGTAATGTCAAAATTTAGTTCGTGATACCTAA
AATACCAATATTAGTGCCCTGTTTTTGTGTATTCTAGGACTAAGCTTTGGTATAAAGTCT
CTTTGAGATTAAATAATACTAACTTAGTTCTTGGCACATGATTGTTTTTTAAAGCGCAGT
GAATTAGAAGCTTTGCTAGTGATCAGTTTATAAGGAGATAATGGAACAAAGCTTCTGTGT
CTACATGTGTTAGCAGAAACTGAAATTTTATTTTTTTTAAGTTTTTCATCTTTTCAGGTC
CCACTAAGCAGCTGGTCTAACGGAAGTAACTGGTCTGCTGGAAGTTCCAGCATACACTGT
GGTAGTTATTTCAGCATACAGGAATATTGGAACAAAGGGGGCCAGTCTAAAAGTTAAGGT
AGGTAAGGCTTTTTCCCCCCCAATGTTTGGTGGCTTTGTAAAGTTATTTTAATATTGGAA
ATGGAGCAATATGAAAAAAACTTTACAAATTTACTGAATATTTTAGTGGAGGGAGGGAGT
AGAATTTTACTTGATAAATATAGGTAATCTCTGCTTTAGGGCTATACATAGTGCAGGCCA
GAGAGACCAGCTGCTTCATGGGATGTGAAAATCTACTTTTATGAACCTAGGGTAAGTTTA
ATGGTGTTAAAACTTTACTGTGCGTTTCTGTTAATTTTCTTCCCTTACCCAGCACTCTAA
GCAACTCAAGCTAATTTGCTGTGTTTGTGACAGAGCCAATTTTCTAGTTCTTAGAAGTAA
TTTAATTTCAGATTTAGCTTTGTTCCTCACTGTCTAATATATACAAGTTAATCTGGAACT
CTTGGAGAAACTTAACATGATAATTGGTAGTTGTACAGATTTTGGTAATTTTAGTTGGAC
TATATATTCAGAAGCCTCTGCTGGTTTTTTGGGTCGATGGTGAGATGACATGTATTCTGA
ACCTCAAGATTAATATTATTTTGGCTCTAGAATTACTCTGAGAGATGGAAAATATGTGGA
TCTTAAATGAAAGTTTAGTTAAGTGTAAATATAATACTTTGGTTTGGTTCTTTTAGGAGA
AATTGATACAAGATTTTCTTTCTGTGCGGTGGCAACATTGGCTCTGTTGGTAAGTTTCCA
CTGTTGTACTGGAATCGTATTAAGCACAGGTGAATATTATGGAATTTAATAGGCATTTTT
TCTGTTTGTAGGGGAAGCTGGATGCTATTAATGTGGAAAAGGCAATTGAATTTGTTTTGT
CATGTATGAACTTTGATGGTGGATTTGGTTGCAGACCAGGTTCTGAATCCCATGCTGGGC
AGGTAATTTATGATAATGCTAATTAAAATTTAGCATCAATTTCGAAGAGAACTAGTGTAG
TAAACTTTAAAAATATATGGACAGTAATTACAGTGTCTGCAATACATATGAAGTTAATTG
AATGTAATGTGAATAGGTGTGTAGTGTGAAATATTAAATACCAGTTGCTGATTCAAGAAG
GTGTTTGTTTTACAGTTGTTTGCCTTATATATACCTTCCCCTCCGTGGAACCCTCTGACA
AGGCAAATGTGAGAAATAAGGTCATAGACACCAAAAGTAACATTTTATTTCCCATTAATT
TTTAACTGGCTATGCATATTGAAACATTCTATCTCTACCCCCAAGCTAAATTGGCACCTG
TTTATTTCATGTGCTGGAGAAAACAAAATGAGAAATTTTGACAGCCTTTGAATGCAGAAT
TTGATCGTAGCAATAATGTACTTAGGTGTCCTCAAGTAGCTAGGTGGTGTGAAATGTTCG
AAAATGTTTTAGTTGACAGATAAAAAGTAAAAATATTAGAAAATAGAATTTTACTGTTGA
AAAGTTAAAATAGTTTTTATACACGTATACTTTATGTCTGTAATTTTAGATCTATTGTTG
CACAGGATTCCTTGCTATTACTAGTCAGTTGCATCAAGTAAATTCTGATTTACTCGGTTG
GTGGCTTTGTGAACGACAGTTACCATCAGGTGGACTCAACGGAAGACCAGAGAAGGTAAT
TAGTTTTAATATAAGCTATTTTTTTATTACTAGCTTTGTAACCTTGAGAGAATACTGTTC
TTATTTCTGCATGTTTAAATATTACACTTGTCAATTGAACATGAAGATTTTGTCTTCATT
CCTTATTTTTCACTGATAGCTCTAAGACTGGTCATTACTAAAGCAGAGCACCTAGGGTTG
AAGTATTTATTAATCCCGATGTCAATTTACAGATATTTGAAGGAAAAGTATTTGTAATAC
CGTCTGATTTACTTTTTAAATATCTGTTTTTTGATCTTTCATAACCTATGCTTTAGGACT
TCAGGGTTATCTGCCAGAGAATGAGCTACAGTCTAATAATGGAGATACACCAGATACTCT
TAGCTTAAAGTATTTGTATGCAGGCATTGTATGAAGTAAACGTTTTGTTTTGTTTTAATG
AATTAATACTTTTTAACTTTGGACAGTACCCAAGAAGTCAATCATGCATAAAAAGCTTTA
CACTTGGTGGCTAAAGAGTACCGTTTGGTAGAAATAAGCATTTTATACAGAAATTTCCTT
GTCCCAGTTATGAATGTGAAAAGACTATTGATTTTCAAAATCAAAGAGATTTTTTAAAGT
TGGTTTTTCTAATTTTTTATTCAAAATCTTTATTTTTAAAAGAAAAGCCAGCCAGTTTTT
GACATTTTGGTTTAGAGGGAGTAAACTAAAGTTTATTCCACAAATCTTCGTGGTTCTGGT
TTTAGATCTCACATACTGTGCCCTGTCTACCTAAAGCAGGGGTCCGTAAAGAGCCAGATA
GTAGATACTTTCAGCTCTGTGGTCCAAACAACCGCATAACCCTACAATGTAGATCAAGAG
CAGCCATAAAAAAATCAGGAAAAAAATGGGTGTGATTGTGTTCCAATAAAGTTAGACACA
CCTTTCAATTTCATACGGTTTTCATGTCACTAGATAAAAGGTAGCTGTTTGCTGATACAA
ACATTTAGCATAGGTAAATGTGAGTTGGCACTCTTTCCCAATCATCTTTAATTCCCAGCA
GTTGTATTTGACAGGTTTCAGCGGGTCAAACCCTGCGTGTCAGAATATTCCTCCCCTACT
GATGAACACTAGGTTACTTTAGAGCTTGAGGCAACCCACTTGTAAATTGTTTGTTCTTCA
CAACTATGGCAACTCTCTGCTCTTTTTTTTACTAGTTGCCAGATGTATGCTATTCCTGGT
GGGTTTTGGCTTCCCTAAAGATAATTGGAAGGCTTCATTGGATTGACAGAGAGAAACTGC
GTAGTTTCATTTTAGCATGTCAAGATGAGGAAACGGGAGGATTTGCAGACAGGCCAGGAG
ACATGGTAAGTATATCAAGGATATTCATGTATACCATAGTTTGTTGTGTATTAGCTTGTG
TTACCTTTTATGGTTCTAGACATTTCCAGACTTAGACATGGATTGTATTCCAAGTTTTCT
TTGAAAGTGACACAATACATCATTTCAAAAGCGGGACCTATTAATTCATTATAGCTTTTT
TTTTTTTTTTAATGTGTGAAGTATACAGAAATTTCTCAAGTACTGCCAATATTACTGAGT
TTGATCTTATATTAACCACCACAATTTATTATTTTTTTTTACTTTTGGAAATTTTTAAGC
ATGTGCATAATTTGATAAAGGGATATTATGAATTGTAGACAAGCAGCTGGAAGCATTCTT
AAAAAGTTACTGAATTGAGGTATGGGCTTGGTCACTTGAGCACTGCGAATTTGGTAAGAG
TGAGTGAAAAAAGGTTTTGTTGGGACCATATTGATAGAATGGTGTATACATTAGAACGTA
TAGTTTAAATAGAGCCATTTTTTTTTTTTTTTTTTTGATAAATTTCCATAACACATTTCT
TAAATTTGTGTGGGCCAGGCGCTGCTAGATACTACCCATACACAGTGACTAGTCTTTTTG
GTGGAGCAGTTTCAGTACTGTGATTAATGCCATGGTGGGAAATTGTAGGTCACTAGGAAT
GCCCAAAATAGAATTCAGGCTTAAGAAAAAGATGGAGGAAACAATGGCATAAGGCAGTCA
TAGTAACTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1198, 1783..1888, 2936..2988, 3071..3181, 3769..3894, 5075..5227
1001..1198, 1783..1888, 2936..2988, 3071..3181, 3769..3894, 5075..5227
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved