Loxodonta_africana Locus Poly:27:SNORD12
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:27:SNORD12
Loxodonta_africana
Poly:27:SNORD12
GeneScaffold_2627
SNORD12, SNORD12
1001..1086, 2300..2391
3391
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGTGGGGAAGGTTAAGCGCGAAGCTGGACA
GCCCCACGGCTAACGTACGGGCCCGAGGTGCCCCCAGGCATGGTATTAAGTGATGACTTG
ACTTTTTTCCCCATCATATCGACAATGCTGATGTCTTTGAACACTTGCCAGTTGGTTCTG
ATATACCAGTCTCAAACGGCCCGGCCCTGTTTATTTCTGATCGTGGGAAGATGGTGATCC
ATGCCCTTCCATTGTTCGCAGGTTAGCGCGGCCGGAGCGTGCAGGATGGCTGTTGAAGTG
GGACGCCGCTGGGCCACCGAAGGCACCCGGTGCGGACTTTTCCAGCCTTCGGTCTCCTGA
CCTCTGGGGTAAGCATTTGTCTACTGGCCTGTTGAGGGGACTTTTAGTTCGCTAGAAAAA
ATTAAAAATTGGAAGGTTTAATAATTGAGCATCTCTTAGGTAATAGGTACTTAAAGTGTT
TTGTATGCTTTATTGCAGTTCTCACGACCAGGCTTATTGGTGAAACTGAGGTTCAGGAGA
ACTAATGGCTCGATGTGAAATGATCTTTTAATTGTAAAAGGTGTTCAGTGCCCCTTAAAC
CACGATTTGGGCTTCCACTCATTTGTGTTTCTGGGCAAATAGATTTCTTATGCCTTTAAA
CTTCCAAGTGGGTGGATAATGTGTGGACTTTCCAGCTCTCTTATGAGAACTACTTTCTGT
TGAGTTAGCCACTCGAACTAATTCCCAACTGCATAACTTTCTCACTTCCTTGAGTCCAGG
GTTGAGACACGAAAGGGCAGAATTTCTTGGGAGCACGTGGTTATCTCTTATCTTCCTAAT
CTTTATGAAAGTCACTTTCCCCAGCTGCACTGGCCTCTCATAGGGGTCCAGAGGTATTTG
TTGTGCCAGCAACAGGACACAGCACAGAAATGTTCAAATGTTGAATAACTTTGCAAACGT
GGACGCAGACCAGCTAGATCTTACTCTTCGTTCAAGGCACTTTCAGTGTCTATATTGAAA
TAAAATACCTGCCTTTAGAGGCAGCTGTCAAAGCTGTAAGCTTCCTGCTGGCATATATGA
TGACTGAACTTTTTTCCCCGACAGATCGACCATGTTGATCTAACTTCTCTAAGCCAGTTT
CTGTCTGATATGCCAGTTTGAGCAGCTCCTCTGCCCTGTCTCCCTTGGGGATGTAGCTGG
CAGGAGCTGATCTTTCTGTGTTTTCATCTTAGGTTTGCTGCTGGCGGGAATCTGAATGGA
CCAGGAGGAGTCCTGGGGTGTGGAAAAGGTTTGGTAAGTGATGCCCACATTTGTTTCTGT
CACCCGAGTAAGATTTGGGAGAGGAGGGACAGTAACTGTTTCATATTGGTTGTTAACACA
GGGTTGCTTCTTAGTTTCTGGCCATTGCAGCTGATGACAGAACTTTTTTCCCCATCAGAT
CGACCATGTTGATCTCTTAACTACTAGCCAGTTTTTTGTCTGATGCATTGCCCCCAAGGA
TGAAATCTTTGTTTTTTAAGTAGGTATTGGCTTGTTCTCCCCACAGCCTGACAGCACCCC
CCCCTCAAAGGAATTATCTGTTTTCTTTGTACAGGTCGGGAGGCACGTGTCACAGGGCAA
GAAGTGGGTTGATGACACAGCCTGGTGTCTTCCCCCGGCTTGTCTGTCTTCTGTAGTAGG
TGAGTTTTCTGCAAGGTGGCGGTTTCTTCAGTGAAATGGTAATTAAGTAGGGTAGTGGTA
GAGAGGCCCAGTTGGGAGTAACCTCAGGGCCCAGTTCCACCTTGGGTATAAAGCAGGAGG
TTAAGAATGACTCCCCTCTCGGTACGACTGATACTACCCTGGCGGCACTACTAGGTCTTT
CAGGAATAAAGAAAGGAAAAAAGCTTATTGAACATTTTTAGTTACTATGTATGCTTTGGC
AGATAGTGTACCTTTTAAAGTTTTCCGGTAGTGTGGGTCCCATTCTAGATCTATTGCTTC
TGTTTCCTGTAAAGATTTGTTTTAATAATGAGATTAAGAATTTAGACAACATAGGTATTG
GATTGTAGATGGTAGGTGGTTTGTCTCAGTGATTGGAAGTCTCTTGGCTCCCTTAGTCTG
CTACTTGTTTGTGCATCCACCTAGTTCTTTCTGAATAGCTAAGTCTCAAACAGATGCTCT
CCATTGCCCTAACAAGTAGCATTTTACACTCAGAATGGAGTACTAGCTAATGCACGTTTT
TGTTTTATTTTTAGTAAGTTTCTCAACCATGGATTTTGAATACAAGGCCTTTTGAAAAAC
ACCCTGTGTGTTACTGAGAGGTGGAACAGACTGCACCAGAATCCTAGGGTGATTGTGTAC
ATAACTTCAGCAATATCCAGAGTTGAAAAACCTGTGCTTTTTTTTTTTTTTTAGTCTTTG
TGATCTTTTCTAGCTTTGTTTTCCGATTTGGAAAAAGAAAATAAAAATCTTTTAAATCAG
TGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved