Loxodonta_africana Locus Poly:9:SNORD115
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:9:SNORD115
Loxodonta_africana
Poly:9:SNORD115
scaffold_27339
SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115
1001..1081, 2681..2758, 4380..4460, 6077..6154, 7773..7853, 11223..11303, 13377..13457, 14859..14939, 16558..16635, 18381..18461, 20302..20382
20385
GTAGTCCGAAAGCTGGCTCCAGCTTTCAAGTGAAGGTAGCTGCACAGATAAGTGCATAG
AAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGCACACGAGGGTCAGGAGCACTTT
CAGGTTCATGCCACAGGAAGTCATGTTTCCCTGGAGCTCTGGACAGTGAAAGCAGGCATA
AGTGCTGCCTTGCACATGTGCAAAGATCACTGCTCCTACAGAGTTGGTTGGAATCCTGTA
GAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGTTGATAAACA
GGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTCT
CTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAATTTGGGGCCAAAT
TCTTGGTGAAAGGCCCTTCTTCCGAGTGTCCCACAGCTCCATTTGAAGAATCCCCAGTTT
TGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGGTGCACGGAACAGTGCCTGTGGAC
ACAGATTTGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAATGAAATAGCCTGTTCTT
GGCTGGGACTTCCTGAGTATTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTTGATCT
GGGCACGTGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGT
GTCTCGATTTTGTCCATACTTGGGGCTATATGTGGAAAAAACGTAGCTGTTAGGCAATGA
ATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCTTAAAAGGATTGCAAGGTCG
AAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCTGGGAAACCGGAAGAGGATG
TGGGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGGAAC
TTGAAGACTCAGGTGATTTTTCCCGGGGATTGAGATGTCTCGGGTCAATGAAGACACCTC
AACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAATAGGATCCCGCTGAGGC
CCAGAGAGAAACTCCTTTTCACTAACATGAATGATCTGCTTTAGAGTGGACCCCCGTTGT
GATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTTTGGCCATGCT
GATTCCTTGGCTCTTTTCCTCTTTTTCTGTCATTTAGAGAGACACTGCTTTCAAGAGATT
CACCACCGAAAGAACTCAAGGTGAGTGAATGACGACGGTTTTCCCTTGTCTCTGGTGATA
CTTAGACAAGTGAAAAGGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGT
GTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATAGGCACGGGTGG
ATAGTTAGGAAGCACAGGGACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCGG
TTCCCAGTCGGGTATGTCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGG
GATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCAGAGTTGAAAGCC
TGTGTCAGTTGCGACTGGACTCTTAGGATCTCTAGGGCATCTTTCCCAGACATCTCGGTA
TTGGATGAAGAATTGAGTAGCCTGATACCTCGCTGTAGCATTCAGGAAAAGGCAGCAGCA
CCAATATCTGAGTCAAAAAGCTAATGGCAGGTTCAATCCCATTCGGTAAGTGGGTCGCGA
GCGTCATGACTCATTTCAGGTTCATGCCACAGGAGGTCATGATCCGCTGAGAGTCTAANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGCTCCTTTTGCC
TGGGTCCTCCTGAAAATTTGTGTTATCATCCAGAGACCTCTATGCCTTCTTCTGAATATT
GCGTGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCCAGCGGGTTGCAAATGGCTGT
CTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCATAGCCTTAGGGAAATGAG
TTTCTCCTCTGGGATCTCTGTCTTACCCACTTCCCCTTTTCAAAGGGTTAGTGAGGTCGA
TGTGTCTTGTCCTGCTTTCACGGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGATGATG
TGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATC
TTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACATAAT
CTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCT
GTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGAT
TTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGAT
TCCTTGGCTCCTTTCCTCTTTTTGTGTCTCTTTAGCACAACCTGCCTCCGAGGAGTTCAC
CGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTT
AGGCAAGTGAGGATACACCTCAAAAGGCAGTAGGGTTTGCTGACAAAGCTGAGGCATGTC
CCCTGGTGTTTGCTTGATCCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGA
TACTTAGGAATCAGAGAATCCTGAAACCTGTGTGCTGGAGTCATCTTCGATAGCCTGGCG
TCCAAGTCCGATACGGCCTACTGAAAGGGGAGAATCGGCCAACTAGAAAAATGTGTTTTC
CTGAGACATTTATGAGATGTGAATGGCTCAGAGCTCTACAGGAGACTGGTCAACTTGCTG
TATTTGAACGCGTGTGTCAGTTGCGGTTGGACTCGTAGGATTTGCAGGGCGCATTTCCCA
TGAATCTTGAAACTGGATGAGCGACTCAGTAGTCCGAAAGCTGGCTCTAGCTTTCAAGTG
AAGGTAGCTGCACAGATAAGTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGA
AGGGCACACGAGGGTCAGGAGCACTTTCAGGTTCATGCCACAGGAAGTCATGTTTCCCTG
GAGCTCTGGACAGTGAAAGCAGGCATAAGTGCTGCCTTGCACATGTGCAAAGATCACTGC
TCCTACAGAGTTGGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCC
AAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTT
GGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTGGA
AATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACA
GCTCATTTGAAGATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGT
GCACGGAACAGTGCCTGTGGACACAGATTCGGCTTCCTCGTAGACATTAGCCGGGGCTGA
TCAAATGAATAGCCTGTTCTTGGCTGGGACTTCCTGAGTATTTTTCTCCATTCGGAGTCC
TCTATGCCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCAC
TAATGGGCGAGAAGTGTGTGTCTCGATTTTGTCCATACTTGGGGCTATATGTGGAAAAAG
CGTAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCT
TAAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCC
GGGAAACCGGAAGAGGATGTGGGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGAC
GATATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTTTCCCGGGGATTGAGATGTCTC
GGGTCAATGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTC
AATAGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCACTAACATGAATGATCTGCTT
TAGAGTGGACCCCCGTTGTGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCT
GACCGATTTTGGCCATGCTGATTCCTTGGCTCTTTTCCTCTTTTTCTGTCATTTAGAGAG
ACCTGCTTTCAAGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGACGGTTTT
CCCTTGTCTCTGGTGATACTTAGACAAGTGAAAAGGGAGCCCAAGAGGCAGTCGGGTTTT
GTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGC
GGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGGACCTAGAAGAATTTCCACTTGAG
TAATTTTTGCTAGTCCGGTTCCCAGTCGGGTATGTCTACGGAAGTTTGAGAATATTTTCA
ACTCTCAACTCTTTACGGGATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGAC
TTGCCAGAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATCTCTAGGGCATCT
TTCCCAGACATCTCGGTATTGGATGAAGAATTGAGTAGCCTGATACCTCGCTGTAGCATT
CAAGAAAAGGCAGCAGCACCAATATCTGAGTCAAAAAGCTAATGGCAGGTTCAATCCCAT
TCGGTAAGTGGGTCGCGAGCGTCATGACTCATTTCAGGTTCATGCCACAGGAGGTCATGA
TCCGCTGAGAGTCTAATCAGGAAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAAGA
TCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCGTGT
GCCCCACGGGATCCTCTGATGCTTGATATCCAGGAGGAGATGTGATCCCTCTCTGGGGAT
TATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGC
GTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTT
CTAAATGTCCTCCAGCTGATTTGAAGATCCCCCAGTGCTGGGGACTCTTGCGTGCCATTT
CCCGGGAGTCTGCACACATTGGACAGTGCCCGTGGACACATATTTGGCAGCCTTCAACAC
ATCAGTCAGGCTTAATCAATGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGAAATTTGTGC
TACATCCAGAGACCTCTATGCCTTCTTCTGAATATTGCGTGATTCTCTCCTTCTGTCATG
GGTCAGCAGACTCCCCAGCGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCGCG
AATGTCTGGCTGAAAGCATAGCCTTAGGGAAATGAGTTTCTCTTCTGGGATCTCTGTCTT
ACCCACTTCCCCTTTTCAAAGGGTTAGTGAGGTCGATGTGTCTTGTCCTGCTTTCACGGG
GGTCAAGCCAACTGCCCGGGAAACTGGAAGATGATGTGTGAACGCTCTCATCCACTGTCC
TTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCT
GGGGAGTGATATGGCTGGGGTCAATGATGACATAATCTGTCTGGAAGAGAGATGATGACC
TAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCC
TTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCTGCACCAAGTAATC
CAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCCTTTCCTCTTTTTG
TGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGGA
TTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATACACCTCAAAA
GGCAGTAGGGTTTGCTGACAAAGCTGAGGCATGTCCCCTGGTGTTTGCTTGACCTTGCCT
GGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTAGGAATCAGAGAATCCTGAAA
CCTGTGTGCTGGAGTCATCTTCGATAGCCTGCGTCCAAGTCCGATACGGCCTACTGAAAG
GGGAGAATCGGCCAACTAGAAAAATGTGTTTTCCTGAGACATTTATGAGATGTGAATGGC
TCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTATTTGAACGCGTGTGTCAGTTGCGGT
TGGACTCGTAGGATTTGCAGGGCGCATTTCCCATGAATCTTGAAACTGGATGAGCGACTC
AGTAGTCCGATAGCTGGCTCCAGCTTTCAAGTGAAGGTAGCTGCACAGATAAGTGCATAG
AAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGCACACGAGGGTCAGGAGCACTTT
CAGGTTCATGCCACAGGAAGTCATGTTTCCCTGGAGCTCTGGACAGTGAAAGCAGGCGTA
AGTGCTGCCTTGCACATGTGCAAACATCACTGCTCCTACAGAGTTGGTTGGAATCCTGTA
GAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGTTGATAAACA
GGAGGAGATGTGTTCCTTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTCT
CTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAATTTGGGGCCAAAT
TCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTCATTTGAAGATCCCCAGTTTTGGG
AACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGAACAGTGCCTGTGGACACAGA
TTTGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCTGTTCTTGGCTGG
GACTTCCTGAGTATTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATCTGGCACGT
GTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGTGTCTCGAT
TTTGTCCATACTTGGGGCTATATGTGGAAAAAGCGTAGCTGTTAGGCAATGAATGTCTCT
CGTCTGATGTCTGACTTACTTCTTTGCCCTTCTTAAAAGGATTGCAAGGTCGAAGCCTGT
TTTCCTGCTTTCATGAGGGTCAAGCTACTCCCTGGGAAACCGGAAGAGGATGTGGGAACC
TTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGGAACTTGAAGAC
TCAGGTGATTTTTCCCGGGGATTGAGATGTCTCGGGTCAATGAAGACACCTCAACTTGTC
TCGAAGAGAGATGATGACATAAAAATCATGCTCAATAGGATCCCGCTGAGGCCCAGAGAG
AAACTCCTTTTCACTAACATGAATGATCTGCTTTAGAGTGGACCCCCGTTGTGATCCCTT
TTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTTTGGCCATGCTGATTCCTT
GGCTCTTTTCCTCTTTTTCTGTCATTTAGAGAGACCTGCTTTCAAGAGATTCACCACCGA
AAGAACTCAAGGTGAGTGAATGACGACGGTTTTCCCTTGTCTCTGGTGATACTTAGACAA
GTGAAAAGGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTGC
TTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGATAGTTAGG
AAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGATAGTCCGGTTCCCAGTC
GGGTATGTCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGGGATGGGAGT
GTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCAGAGTTGAAAGCCTGTGTCAGT
TGCGACTGGACTCTTAGGATCTCTAGGGCATCTTTCCCAGACATCTCGGTATTGGATGAA
GAATTGAGTAGCCTGATACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCAATATCT
GAGTCAAAAAGCTAATGGCAGGTTCAATCCCATTCGGTAAGTGGGTCGCGAGCGTCATGA
CTCATTTCAGGTTCATGCCACAGGAGGTCATGATCCGCTGAGAGTCTAATCAGGAAATGC
AGGCATAACTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATC
TTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGAT
ATCCAGGAGGAGATGTGATCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTG
TGTCTCTCCATGGGCTCCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTTAC
AAGTGTTGGCCAGAAATTCTTGGGAAAGCTATTCTTTTCTAAATGTCCTCCAGCTGATTT
GAATGATCCCCCGGGTGCTGGGGACTCTTGCGTGCCATTTCCCGGGAGTCTGCACACATT
GGACAGTGCCCGTGGACACATATTTGGCAGCCTTCAACACATCAGTCAGGCTTAATCAAT
TGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGAAAATTTGTGCTACATCCAGAGACCTCTA
TGCCTTCTTCTGAATATTGCGTGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCCAG
CGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCA
TAGCCTTAGGGAAATGAGTTTCTCCTCTGGGATCTCTGTCTTACCCACTTCCCCTTTTCA
AAGGGTTAGTGAGGTCGATGTGTCTTGTCCTGCTTTCACGGGGGTCAAGCCAACTGCCCG
GGAAACTGGAAGATGATGTGGGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAG
ACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGG
GGTCAATGATGACATAATCTGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTAAGACTTGCTTCTTGCTTTTGAACGTAAGGGGTAGTTGCCACAGAAATAAGTGCAT
CGGAAATCTTAAAGTTCAGCGGTCGGATGCCCAGGTTGTGAAAGGGCCCCCGAGCGTTCC
AGGTAGCCCTTTTCATAGTTTCCACGCCACCGGGAAGTTCAATGTTTCCCCTGGAGACTG
TTGACCAGTGAAAGCAGGGTGTAAAGTGCTTGCTTTGCCACATGTGCAAAGATCACTGCT
CCTACAGAGTTTGGTTGGAATCCTGTAGAGGTTCCCATAAGACTCCTGCTCTCTTTGTGC
CAAGGAAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCT
TTGAGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCT
GGAAATGCCCTAGTTGAATTTGGGGCCAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCC
ACAGCTCATTTGAAGATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCT
CGTGCACGGAACAGTGCCTGTGGACACAGATTTGGCTTCCTCGTAGACATTAGCCGGGGC
TGATCAAATGAATAGCCTGTTCTTGGCTGGGACTTCCTGAGTATTTTTCTCCATTCGGAG
TCCTCTATGCCTTGTCTTGATCTGGCACGTGTCTGCCTTTCTGTCAAGGGTCAGCAGTCT
CACTAATGGGCGAGAAGTGTGTGTCTCGATTTTGTCCATACTTGGGGCTATATGTGGAAA
AAGCGTAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCT
TCTTAAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTC
CCCGGGAAACCGGAAGAGGATGTGGGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATG
GACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTTTCCCGGGGATTGAGATGT
CTCGGGTCAATGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATG
CTCAATAGGATCCCGCTGAGGCTCAGAGAGAAACTCCTTTTCACTAACATGAATGATCTG
CTTTAGAGTGGACCCCCGTTGTGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTC
CCTGACCGATTTTGGCCATGCTGATTCCTTGGCTCTTTTCCTCTTTTTCTGTCATTTAGA
GAGACCTGCTTTCAAGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGACGGT
TTTCCCTTGTCTCTGGTGATACTTAGACAAGTGAAAAGGGAGCCCAAGAGGCAGTCGGGT
TTTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGT
GGCGGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGGACCTAGAAGAATTTCCACTT
GAGTAATTTTTGCTAGTCCGGTTCCCAGTCGGGTATGTCTACGGAAGTTTGAGAATATTT
TCAACTCTCAACTCTTTACGGGATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGA
GACTTGCCAGAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATCTCTAGGGCA
TCTTTCCCAGACATCTCGGTATTGGATGAAGAATTGAGTAGCCTGATACCTCGCTGTAGC
ATTCAAGAAAAGGCAGCAGCACCAATATCTGAGTCAAAAAGCTAATGGCAGGTTCAATCC
CATTCGGTAAGTGGGTCGCGAGCGTCATGACTCATTTCAGGTTCATGCCACCGGAGGTCA
TGATCCGCTGAGAGTCTAATCAGGAAATGCAGGCATAACTGCTGCCTTCCACATGTGGAA
AGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCG
TGTGCCCCACGGGATCCTCTGATGCTTGATATACGGGAGGAGATGTGATCCCTCTCTGGG
GATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAA
AGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCATTGGAAAGCTATTC
TTTTCTAAATGTCCTCCAGCTGATTGAAGATCCCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGCCCCCGGAAAGTCATGTTTTCCCTGGAGACTTTGGGACCGAGAGA
AAGGCAGGCGTAAAGTGGTGCCTTGCCACAATGTGCCAAAGAATCCATATTCCTCAGAGT
TGGGTTGGAAATCCCGGAAGAGGGTTCCATAAGGCTCCCTGTCTCTTTGTGCCCAAAGAA
TCCTCTTGAGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCCATTCTTTGGGAA
TGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGAGATGAAATCAAACTCTGGAAATG
CCTAGTTGAATTTGGGGCCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCT
CATTTGAAGATCCCCAGTTTTGGGAACCATTGGATGTCATTTCCTGGAAGTGCTCGTGCA
CGGAACAGTGCCTGTGGACACAGATTTGGCTTCCTCGTAGACATTAGCCGGGGCTGATCA
AATGAATAGCCTGTTCTTGGCTGGGACTTCCTGAGTATTTTTCTCCATTCGGAGTCCTCT
ATGCCTTGTCTTGATCTGGCACGTGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAA
TGGGCGAGAAGTGTGTGTCTCGATTTTGTCCATACTTGGGGCTATATGTGGAAAAAGCGT
AGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCTTAA
AAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGG
AAACCGGAAGAGGATGTGGGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGAT
ATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTTTCCCGGGGATTGAGATGTCTCGGG
TCAATGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAAT
AGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCACTAACATGAATGATCTGCTTTAG
AGTGGACCCCCGTTGTGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGAC
CGATTTTGGCCATGCTGATTCCTTGGCTCTTTTCCTCTTTTTCTGTCATTTAGAGAGACC
TGCTTTCAAGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGACGGTTTTCCC
TTGTCTCTGGTGATACTTAGACAAGTGAAAAGGGAGCCCAAGAGGCAGTCGGGTTTTGTG
GAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGT
GATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAA
TTTTTGCTAGTCCGGTTCCCAGTCGGGTATGTCTACGGAAGTTTGAGAATATTTTCAACT
CTCAACTCTTTACGGGATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTG
CCAGAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATCTCTAGGGCATCTTTC
CCAGACATCTCGGTATTGGATGAAGAATTGAGTAGCCTGATACCTCTCTGTAGCATTCAA
GAAAAGGCAGCAGCACCAATATCTGAGTCAAAAAGCTAATGGCAGGTTCAATCCCATTCG
GTAAGTGGGTCGCGAGCGTCATGACTCATTTCAGGTTCATGCCACAGGAGGTCATGATCC
GCTGAGAGTCTAATCAGGAAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAAGATCA
TTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCC
CCACGGGATCCTCTGATGCTTGATATCCAGGAGGAGATGTGATCCCTCTCTGGGGATTAT
TGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTT
GAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTTCCA
AATGTCCTCCAGCTGATTTGAAGATCCCCCGGTGCTGGGGACTCTTGGGTGCCATTTCCC
GGGAGTCCGCACACATTGGACAGTGCCCGTGGACGCATAGTTGGCTGCCTTCAACACATC
AGTCAGGCTTAAGCAATGGCACAAGACAACATATTACCTGGGTCTTCCTGTAAATTTGTG
CTACATCCAGAGTCCTCTCTACCTTCAGAGGAATATTGCATGATTCTCTCCGTGTGTCAT
GGGTCAGCAGACTCCCCAGTTTTTTTGCGGCTGATGGACGATATGGGTGGTGAGGAACTT
GAAGACTCAGGTGATTTTTCCCGGGGATTGAGATGTCTCGGGTCAATGAAGACACCTCAA
CTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAATAGGATCCCGCTGAGGCCC
AGAGAGAAACTCCTTTTCACTAACATGAATGATCTGCTTTAGAGTGGACCCCCGTTGTGA
TCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTTTGGCCATGCTGA
TTCCTTGGCTCTTTTCCTCTTTTTCTGTCATTTAGAGAGACCTGCTTTCAAGAGATTCAC
CACCGAAAGAACTCAAGGTGAGTGAATGACGACGGTTTTCCCTTGTCTCTGGTGATACTT
AGACAAGTGAAAAGGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTC
CCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGATA
GTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCGGTTC
CCAGTCGGGTATGTCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGGGCT
GGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCAGAGTTGAAAGCCTGT
GTCAGTTGCGACTGGACTCTTAGGATCTCTAGGGCATCTTTCCCAGACATCTCGGTATTG
GATGAAGAATTGAGTAGCCTGATACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCA
ATATCTGAGTCAAAAAGCTAATGGCAGGTTCAATCCCATTCGGTAAGTGGGTCGCGAGCG
TCATGACTCATTTCAGGTTCATGCCACAGGAGGTCATGATCCGCTGAGAGTCTAATCAGG
AAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTT
GGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATG
CTTGATATCCAGGAGGAGATGTGATCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATT
CGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTT
TAACAAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTTCCAAATGTCCTCCAGCTGATT
TGAAGATCCCCCGGTGCTGGGGACTCTTGCGTGCCATTTCCCGGGAGTCCGCACACATTG
GACAGTGCCCGTGGACGCATACTTGGCAGCCTTCAACACATCAGTCAGGCTTAATCAATG
GCAAAGGCTCCTTTTGCCTGGGTCCTCCTGAAAATTTGTGCTACATCCAGAGACCTCTCT
GCCTTCTTCTGAATATTGCATGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCCAGC
GGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTTGCGAATGTCTGGCTGAAAGCAT
AGCCTTAGGGAAATGAGTTTCTCCTCTGGGATCTCTGTCTTACCCACTTCCCCTTTTCAA
AGGGTTAGTGAGGTCGATGTGTCTTGTCCTGCTTTCACGGGGGTCAAGCCAACTGCCCGG
GAAACTGGAAGATGATGTGGGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGA
CATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGG
GTCAATGATGACATAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGA
GGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAG
CGGACTCCCATTTTGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCG
ATTTTGGTCAGGCTGATTCCTTGGCTCCTTTCCTCTTTTTGTGTCCTTTAGCACAACCTG
CCTCTGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTG
GCCCCATCTGACACTTAGGCAAGTGAGGATACACCTCAAAAGGCAGTAGGGTTTGCTGAC
AAAGCTGAGGCATGTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTG
ATGTGCGTGGGTGGATACTTAGGAATCAGAGAATCCTGAAACCTGTGTGCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTCACTTGGTGGAGGAAAGGGATCACAACGGGAGTCCACTCTAAAGCAGATCATGT
CATGTTAGTGGAAGGAGTTTCTATCTCGGCGGCGAGGAACTTGAAGACTCAGGTGATTTT
TCCCGGGGATTGAGATGTCTCGGGTCAATGAAGACACCTCAACTTGTCTCGAAGAGAGAT
GATGACATAAAAATCATGCTCAATAGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTC
ACTAACATGAATGATCTGCTTTAGAGTGGACCCCCGTTGTGATCCCTTTTTCCTCCACCA
AGTGATCAAAAACTCCTCCCTGACCGATTTTGGCCATGCTGATTCCTTGGCTCTTTTCCT
CTTTTTCTGTCATTTAGAGAGACCTGCTTTCAAGAGATTCACCACCGAAAGAACTCAAGG
TGAGTGAATGACGACGGTTTTCCCTTGTCTCTGGTGATACTTAGACAAGTGAAAAGGGAG
CCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGAC
CTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGAAC
CTAGAAGAATTTCCACTTGAGTAATTTTTGATAGTCCGGTTCCCAGTCGGGTATGTCTAC
GGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGGGCTGGGAGTGTGTAGCAGCTC
TACTGGAGAAACCAGAGAGACTTGCCAGAGTTGAAAGCCTGTGTCAGTTGCGACTGGACT
CTTAGGATCTCTAGGGCATCTTTCCCAGACATCTCGGTATTGGATGAAGAATTGAGTAGC
CTGATACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCAATATCTGAGTCAAAAAGC
TAATGGCAGGTTCAATCCCATTCGGTAAGTGGGTCGCGAGCGTCATGACTCATTTCAGGT
TCATGCCACAGGAGGTCATGATCCGCTGAGAGTCTAATCAGGAAATGCAGGCATAACTGC
TGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTC
CATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATATCCAGGAGGAG
ATGTGATCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCATG
GCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTATAACAAGTGTTGGCAGAA
TTCTTGGAAAGCTATTCTTTTCCAAATGACCTCCAGCTGATTTGAAGATCCCCCGGTGCT
GGGGACTCTTGGGTGCCATTTCCCGGGAGTCCGCACACATTGGACAGTGCCCGTGGATGT
GTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCAC
AAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAA
GCCCTCTTCCGAGTGTCCCACAGCTCATTTGAAGATCCCCAGTTTTGGGAACCCTTGGAT
GTCATTTCCTGGAAGTGCTCGTGCACGGAACAGTGCCTGTGGACACAGATTCGGCTTCCT
CGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCCGTTCTTGGCTGGGACTTCCTGAG
TATTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATCTGGCACGTGTCTGCCTTTC
TGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGTGTCTCGATTTTGTCCATAC
TTGGGGCTATATGTGGAAAAAGCGTAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTC
TGACTTACTTCTTTGCCCTTCTTAAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTT
CATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGGATGTGGGAACCTTCTCATCCTG
CGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTT
TTCCCGGGGATTGAGATGTCTCGGGTCAACGAAGACACCTCAACTTGTCTCGAAGAGAGA
TGATGACATAAAAATCATGCTCAATAGGATCCCGCTGAGGCCCAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved