Loxodonta_africana Locus Mono:76:SNORA70
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:76:SNORA70
Loxodonta_africana
Mono:76:SNORA70
GeneScaffold_4174
SNORA70
1001..1133
2133
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTTGTCCTGTGCTGGGGCTGACAGG
TGAGCTGGGGCCTGGGTCCACACAGCTCCTTTTCCTGGGGGGAAGGCCCATTGCCCTTGG
TTCCATAGGACAAGGGTTTCCATAACTGAATGGTCTTGTATGATTACAGGCCTAAAGTTT
GGGTGTATAGGTACCCCTCATGGACCAAATAACCTGTAGGTGGCTGATGGCAAAGCCAGT
ATGAGGGCTGGCACACGGTTTTCAATGGCCTACCCCCACCACCCATCTCCAGACCTCATC
ATAGATAAGCCTTACTATGCTTTGGGGGAGACAAGTGAAGGGAGGTGTTCCTGAAAAAGT
AGTTTCACTTGCTCAATCTGTCATCACAACCATCAATTGTCTGAAAATGCTGCAGGTTGG
GGTGATCTCACTGACCCAGTGTACTTCACAGGGTCTCTTCCTAGCTCGTTTTGGGGTACT
TACAACTCGGAATCAACGGTAGCGGGTTTGTTTTTTGTCCTCTGCAGCCAATTAAGCCGA
CTGTCCTCCTTTCCTGTGGGGGCCAGTGTGCAATGGCTGCAAACAGCAGCTTCCTCGGTA
GTGTATGCAACCTGTTGCATGTACGGGTTGCCCTAAGGGACCTTGGAGACAGCATTTCCT
TGTCTCTGACGTTGCTAATCTTTGCTGTCCCTACTTTAGGCTCCAGACAGGTATGCGAGG
TGCCTTTGGAAAACCCCAGGGTACAGTGGCCAGGGTCCACATTGGCCAAGTCATCATGTC
CATCCGCACCAAGCTTCAAAACAAGGAGCATGTGATTGAGGCCCTACGCAGGGCCAAGTT
CAAGTTCCCTGGACGCCAGAAGGTAAGCAGTGCTACCACCCCCTGCACCTATCATTCCTT
GCCTGTGTCACTGAACCCCTGACCCAGTTCTTTCTGTCTCCCCTTAGATCCATATCTCCA
AGAAGTGGGGCTTTACCAAGTTTAATGCTGATGAGTTTGAAGATATGGTGGCTGAAAAGC
GCCTCATCCCAGATGGTTGTGGAGTTAAATACATCCCCAATCGTGGCCCCTTGGACAAGT
GGAGGGCCCTGCATTCATGAGGGCCTTGGCAGCACTGCCCCACCTGACCATTGCCTACCA
ATAATTTGACTTTCTTGTCTTTATCTACCAATAAATTGAACTCCCTGTCTGTATCTGTGT
TCTGGGTTACATGCCCTGGGGTGGGTGGAGTTGAGGAACTTCTGGGGATCAGGGCCCCAG
GATTATTGTCACTTTTCTTCAGAGACAGGCTGGTGACTACTTTGAACAGGAGGGAACAGA
ACCCATCAGGGACCTGGACTTGGGTCTCCCTCAATCATGGCCAAAACTGGTCTCCCAGGT
GTGAGGTGTTAAAAGGCTATGGGGCTTCCTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved