Loxodonta_africana Locus Mono:73:SNORD113
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:73:SNORD113
Loxodonta_africana
Mono:73:SNORD113
GeneScaffold_59
SNORD113
1001..1062
2062
CAAAACAATATGCTCATTTGCAGAAGCTAAACACAGGATGAAAAAGTAGTAAAAGGATG
GAACATAACATTTGTGAAAAACTTTCTAGTCAAAGCTTCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTTTCAAGCAATTCATTTCCTCATCC
ATATGTCCTCTTTCTGCAGAACTGACCTTTGAGAATGGCCTGCATGTTCAAGCAGGCTCT
TCTTTTCACATCTCCTCTTTCACAATTAACTCTTTCCTTATTTTATAAAATAAAGGCATA
TGCAACAATATGGTTGAATCTTAGCAATATAATTTTAAGTAAAAAGGTAATTCCCAAAAG
ATTATAAACAGCATGACACCCTTTTATAAAATTAAAAACAACTAAAGTAAAATATAACTT
CATATGAGTACATATAGATGGCAACAAAAGTATATACAAAGAAAACAAGGTAGAAGAAGG
CAAGGGGATGGGTCGGTGGGAAGAGGCGGATATGATATGATCCAAGTAGGTTATTTTCAG
GGTTCTAGCTTTTGTTTGGGCATGGTGGGTTCATGGCTGCTTATAAACATTACTAAAAAT
AACTAATTAAGTAACTAAAATAAATAAAATAGAGCCATGCATGGACCAATGATGAGTGAA
ACAAGGATTATGATTAAACCAAGTCTATGCACCTGAGGTCCAAAAAAAAAAAAAAAAAAA
CAAAGGCATACCTCTCAGCCATCTTACTATGGTGCATTGCCTCAGCGTGTAAAAACCTCC
TGGAGTAACAAACAAAGGGACAATTTGAAATATTGATACTGGGAAGCCTCTTTAAAGCAT
CATAAACCTGCCAAAGACTCTCCTTCCTTTGTTCAGTGTGTGTGCGTGTGCGCATGCGTG
CATGTGTTACACAATCTGTGGCCTTAGCCTTTGCTGGGATACTATGAATTCAGATATAAT
GCAGTCCTGCAGAGTGGGTTAACTGACTGTCAGGGAAGGCACTGCTCTCGTGGCAGAGAC
CATGAGAACAAAGCAAAGAAGTAAATCAAAAAGGGCTTTCGTTCCCTCCTACAATTTAAA
GGTAAGAGATTTTTTATGGATGTTCTCAATACTCATCTGTAGGAAAGAAAAACATTACCC
AACACATAGGTAAAACCATACAGGTTAATAATGCTGATTCTTTTCAAGTACAGGTAGTCC
CTGACTTACAACAGGGTTCCATTCAGACGACTCCATCATAAGTCCGTTCTGTCCTAAGTT
GAATACCCTTTTTTTTTTTTTTAAGTTTTCATTATTATTGCCTTTTATTATCAGTATCTT
TACAAATCCAATCTTTATTTTGGAGGACAGGAAACTTCATATATAAACTTACAGATACTC
ATTGCAACACTGTATGTAGTACATATTACTAACAAGATGTTAAAAAAAAAAAAAGGGAAG
TCGTAAATTCGGTTCATCGCAACTCAAATATGTTATCAGTCGGGGGCTACCTGTACCAGG
AATGCTTTCTAAGATGACCTAACTTTTATGTGCTTTCTGAAGGTTCAAATGCTGGCTCAG
CCACTTACTTTGTGTGTTGCAATAGGCAAGTGACCTCTATGTGCCTCAGTTTCCTTATCT
TTAAAAATAGGAACAATAGTATTTACCTCATGGGGGAGAGGTAATATAAGTTAACATATG
TAAAATGCTTAGATCATGCCTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved