Loxodonta_africana Locus Poly:3:SNORD115
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:3:SNORD115
Loxodonta_africana
Poly:3:SNORD115
scaffold_9943
SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115
1001..1081, 2714..2793, 4416..4496, 6115..6192, 7810..7890, 9509..9586, 11269..11349, 12968..13045
14045
GGAAAATTTCCCATGAATCTTGGAATTGGATGAGCTATTCAGTAGTCTGATATCTGGCT
CTAGCTATCAAGTAAAGGTAGCTGCACCGATATCTGCATAGAAAACCTAAAGTCACGGTC
GATGCAAGGTGTGAGGGGGACACGTATGTTATGAGCAGTTTCAGGTTCATGCCACAGGAA
GTCATGTTTAGCCGGAGCTCTAGACAATGAGTTCAGGCATAAGTGCTGCCTTGCACATGT
GTAAAGATCACTGTTCCTACACATTTCATTGGAATCCTGTAGAGGTTCCATAATACTGCT
GCTCTGTGTGTCCCAAGGGATTCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTG
TGTTGTAATTCTTTGGGAATGAGGTGGCCTGGGCCATGTCTCTACATGGCACAAGGGTGA
ACTCAGATAGGTAAAGGACTTCGGAAACTTCTAGGAGAAGTTTTGGTCAAATTGCTAGAG
AAAGCACTCTTCTGAGCATACTACAGCTCAATTGATGATCCCTAGTTTTGGAAACCCTTG
GGTATCATTTCCTGAGACTGTTCATGCTTGGGATAGTGCCTGTGCACATAAGTTTGGCTT
TCTTCTATACACCAGCAAGGGCTGATCAAATGAATAGCCTCTTCTTGGCTGGGAATTCCT
GAGAAGTTTTACTACATTTAGAGACTTCGTGACTTGTCCTGATAAAGGGTCAGGAATCTC
CCTAATGGGTTACAAGTGTGTGTCTTGATTTTGTCCATATTTTTGACTGTATCTGGGAAA
AACCATAGCTGTAGGGCATTGAACTTTTCTTGTCTGATGTCTGTCTTACTATTTTGTCCT
TTCTAAAAGGTTTGAGTGGTCGATGTTTGTTTTCCTACTTTCATGAAGGGTCAACCCAAC
TCCCTGGGAATCTGGAAGAGGATGTGTGAACACTCTCATCAAGCGTGACTGTGGTAAGGA
CTTTGAGGATTCAGTTGATTTTTCTGGGATCCATATGTCTCGGGTCAATGATGACACCTC
AACTTGTCCTGAAGAGAGAAGATGACATAAAAATCATGCTCGATAGGACTACCCTGAGGC
CCAGAGGGAAACTCCTTTTGTCCAACCTTAATGATCTTCTTTACAGTGCACCCCATTTTG
ATTTTTTTTAACTCCCACAAATGATCAAAAACTCCTCACGGACTGATTTTCGTCAGGTGA
TTCTTTGGCTCCGTTGCTCTTTTTCTGTGATTTCGGAAGACCTGCTTCCCAGAAATTCAC
CATTGGAAGGGCACAAAGTGAGTGATTTACAGAGATTTTACCATGTCCCTTGCTGACACA
TAGACAAGAGAAAATGCAGCCCAAGAGGCAGTCAGGATTTGTGCAAAAGCTGAGACGTGC
CCTTTGTTTTTAGCTTGACCTTGACTGATTGACTAAGTGGCGGAGATATGCATGGGTGGA
TAGTTAGAAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGATACTCCAGT
TTCCAGCCTGAAATGTCTATGGAATTGGGAAATTGCAACTAAACAAAAGTGTTTTCCTCA
AGTATTTACAGCATGGGAATGGCTAGGAGCTCTACTGGAGAAACTGGAGAGACTTGCCAT
AGTTGAAAGCTTATGTCAGGTGCGACTGCACTCTTAGAATCTGCAGGGCATCTTTCCCAC
GAATCTTGGCATTGGATGAACAATGGAGTAGACTGATACCTCACTGTAGCATTCAAGAAA
AGGTAGCAGTACAAATATCTGTGTTAAAAACCTACTGTCACTTTGGATGCCATTTGTTAA
GTGGGATGCCAGCAGAGTGACTAGTTTCAGGTTCATGCCAAAGGAAGTCATGATCAGCTG
ACACTCTAGTCAAGAACTGCAAGGATAAGTGCTGCCTTCCACATGTGGAAAGATCATTTT
CTTGACAGACATTTGGATTCCTGTAGAGATTCTATGGAAATCCTCTTCTGTGGGCCCATT
GCGATCCTCTGATGGTTGATATACAGGAGGAAATACACTCCCACTTTGGGAATTATTCAG
GATTGAGGTAGATTGGATTCTGTCTCTACATGGCTCAGTGGTGAAATCAAAGAGTTGAAG
GACTGTGGAAATTTCTAGAAGAAGTGTTGGCACAATTCCTGGAAAGGAATTCATCTCCAA
ATGTCCTTCCAGCTGATTTGAAGATCCCCAGTTACCGGGGACCCTTGGGTGCCATTTCCC
GGGAGCCTGCTACCACAGGATCCTGCCCCTAGACGCATATTTGGCTGCCTTCAATACATC
AGTCAGGCTTAACCAATGGCAAAGGCTCCCTTTGCCTGGGCCCTCCCGAAAATTTCTGCT
ATGTCCAGAGACCTCAATGCCTTGTTCTGAATCTTGCATGATTCTCGCTTTCTGTCAAGG
GTCAGCAGTCTTCCCAGTGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCTCGA
ATATCTGGGTGAAAGCATAGCCTTAGGGAAATGAGTTTCTCTTCTGCGATCTCTGTTACT
GATTTCCCCTTTTCAAAGGGTTAGTGAGGTCAATGTCTGTTGTCCTGCTTTCATGGGGTT
CAAGCCAACTGCCCTGGAAACTGGAAGATGATGTGTGAACCCTCTCATCCAGTGTCATTC
CTGGGTGGAAGGGAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGG
GCGTGATATGGCTCGGGTCAATAATGACACCTCAATGTGTCTCGAAGAGAGATGATGACC
TAAAAACATACTCAATGGGATTTCGCTGAGGCCCTGCTTTGCGGGAAACTCCTTTGGCCC
AGGCGTACGGATCTTCCTTAGAGCGGACACCCATTTTGTATCCTTTCATCCCCAGGAACT
GATCCAAAACACCGGGGTGGCTGATTTTTGTCAGGCTGATTCCTTGGCTCTTTTCCTCTT
TTTGTGTCATTTAGAAAGACCTGGTTCCCAGAAATTCACTGTTGCGAGGACACAAGGTGA
GGGATTTCCCGTGATTTTCCCGGGCCCCATCTGACACATAGGCAAGTGAGGATATAGCCC
AAAAGGCCGTAGGGGCTGCTGACAAATCTGAGGCATGTCCCCTGGTGTTTGCTTGACCTT
GCCTGGTTGACTAAGTGGCTGTGATGTGCGTGGGTGGATACTTAGGAATCAGATGATCCT
GAAAAATATGCACGGGAGTTATCTTCGATACCCTGGGTCCAAGTCCGATACGGCCTACAG
AATTGGGACAAACGCACAACTAGAAAAATGTATTTTCCTAAGGTATTTATGAGATGTAAA
TGGTTCAGAGCTCTATGGGAGACCGGTCAACTTGCCGTATTGAAAGCACATGTCAGTTGC
GGCTGGACTCATAGGAACTGCAGGGCACTTTTCCCATGAATCTTGAAATTGGATGAGCGA
CTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTACA
TAAAAAATATAAAGTCAGGGTCAAATCCAGCTGTGAAGGGGACAGGAGGGTCATGAGCAG
TTTCAGGTTGATGACACAGGAAGTCCTGTTTCCCTGGAGCTTTGGACAGTGAAAGCACAC
GTAACTGCTGCCTTGCACATGACCAAAGATCACTGTTCCTACAGAGTTTGTTGGAATCCT
GCAGAGGTTCCAAAAGACTCCTGCTCTCTTTGTGCCAGGGGATCCTCTGATGGTTGAAAA
ACAAGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTG
TCTCTCCATGGCACAAGGGTGAAATCAAACTTGGAAAATTCCTAGGAGAAGTTTTGGACA
AATTCTTGGAGAAAGCACACTTACAAGTGTCCCACAGCTCATTTGAAGATCCCCAGTTTT
GGGAACTCTTGGGTGTCATTTCCTGGAAGTGCTCGTGCACGGAACAGTGCCTGTGGAAAC
ATTTGTTTTCCTGCTATACATCAGCCAGGCCTGATCAAATGAAAAACCTCTTCTTGGCTG
GGGCTTCCTGAGTACTTTTACTACGTACAGAGTTCCCTATGCCTTGTCTTGATCTGGCAC
GTGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAAAGGGTTGGAAGTGTGTGTCTTG
ATTTTGTCCATGTTTTGGGCTACATGTGGGAAAAACGATAGCTCTTAGGCAATGAATGTC
TTTCATCTGATGTCTGACTTACTTCTTTGCCCTTCCTAAAAGGATTGCAAGGTCGAAGGC
TCTTTTAATTCTTTCATGAGGGTCAAGCTACTCCCCGGGAAACAGGAATATGATGTGCGA
ACATTGTCATCGTGCATGATTGCAGGCTGGATGGATGATATCAGTGCTGAAGACCTTTAA
GACTCAGGTGATTTTTCCCGGGGATTGAGATGTCTCGAGTCAATGAAGACACCTCAACTT
GTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAGTAAGATCACGCTGAGGCCCAGA
GAGAAACTCCTTTTCCCCACCGTTAATGATCTGCTTTAGAGCGGACCCCAGTTTGGATTC
CTTTTTCGTCCACCAAGTGATCAAAAACTCTGCACTGACCGATTTTTGTCATGCTGATTC
CTTGGCTCTTTTCCTCATTGTCTGTGATTTAGAAAGGCCTGCTTTCAAGAGATTCACCAC
CAAAAGCACTCAAGGTGAGTGAATGACGGCGGTTTTCCCTTGTCCCTGGTGATACTTAGA
CAAGTGAAAATTGAGCCCAAGAGGCAGTCGGGTTTTGTGCGAAAGCTGAGACGTGGCTCC
TGCTTTGAGCTTGACGTGACCGATTGATCAAGAGGCGGTGATATGTACGGGTGGATTGTT
AGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGATAGTCCGGTTCCCA
GTCGGGTATGTCTACGGAATTTTGAGAATATTTTCAACTCTCAACTATTTATGGGATGGG
AGTGTCTACCAGCTCTACTGGAGAAACCAGAGAGACTTGCCAGAGTTGAAAGCCTGTGTC
AGTTGCGACTGGACTCTTAGGATCTCCAGGGCATCTTTCCCAGACATCTTGGTATTGGAT
GAAGAATTGAGTAGCCTGATACCTCACTGTAGCATTCAAGAAAAGGCAGCAGCACCACTA
TCTGAGTTAAAAAGCTAATGTCAGGTTCAATCCCATTCGGTAAGTGGGTCGCGAGCGTCA
TGACTAGTTTCAGGTTCATGTCACAGGAGGTCAGGATCTGCTGAGAGTCTAATCAGGAAA
TGCAGGCATAAATGCTGTCTTCCACATGTGGAAAGATCATTTTCTAGAAAGATCTTTGGA
ATCTTGTAGAGATTCCATAGGACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTT
CATATACAGGAGGAGATGTGATCTCTCTCTGGGGATTATTCGGGCATGAGGTAGATTCGA
CTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAA
CAAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTTCTAAATGTCCTCCAGCTGATTTGA
AGATCCCCCGGTGCTGGGGACTCTTGGGTGCCATTTCCCGGGAGTCCGCACACATTGGAC
AGTGCCCGTGGACGCATAGTTGGCTGCCTTCAACACATCAGTCAGGCTTAATCAATGGCA
AAGGCTCCTTTTGCCTGGGTCCTCCTGTAAATTTGTGCTACATCCAGAGACCTCTATGCC
TTCTTCTGAATATTGCATGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCCAGTGGG
TTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGGTGAAAGCCTAGC
CTTAGGGAAGTGAGTTTCTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTTTCAAAGG
GTTAGTGAGGTCGATGTCTCTTGTCCCGCTTTCATGGGGGTCAAGCCAACTGGCCGGGAA
ACTGGAAGATGATGGGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACAT
TTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTC
AATGATGACATAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGT
TATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGG
ACTCCCATTTTGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATT
TTGGTCAGGCTGATTCCTTGGCTCTTTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCT
CCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCC
CCATCTGACACTTAGGCAAGTGAGGATACACCTCAAAAGGCAGTAGGGTTTGCTGACAAA
GCTGAGGCATATCCCCTCGTGTTTGCTTGACCTTGCCTGGTTGACTAGGTGGCGGTGATG
TGCGTGGGTGGATACTTAGGAATCAGAGAATCCTGAAACATGTGCGCTGGAGTCATGTTC
GATAGCCTAGGTCCAAGTCCGATACGGCCTACCGAAATGGGAGAAACGGCCAACTAGAAA
AATGTATTTTCCTGAGGTATTTATGAGATGTGAATGGCTCAGAGCTCTACAGGAGACTGG
TCAACTTGCTGTAATTGAAATCGTGTGTCAGTTGCGGTTGGACTCGTAGGATTTGCAGGG
GGCTTTTCCCATGAATCTTGAAACTGGATGAGCGACTCAGTAGTCCGATAGCTGGCTCCA
GCTTTCAAGTGAAGGTAGCTGCACAGATAAGTGCATAGAAAATCTAAAGTCAGGGTCGAT
GCCAGGTGTGAAGGGCACACGAGGGTCAGGAGCACTTTCAGGTTCATGCCACAGGAAGTC
ATGTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCA
AAGATCACTGTTCCTACAGAGTTGGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCT
CTCTTTGTGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGT
TCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAAT
CAAACTCTGGCAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCACTCTTCCG
AGTGTCCCACAGCTCATTTGAAGATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTG
GAAGTGCTCGTGCACGGATCCGTGCCTGTGGACACAGATTCGGCTTCCTCGTAGACATTA
GCCGGGGCTGATCAAATGAATAGCCTGTTCTTGGCTGGGACTGCCTGAGTACTTTTCCCA
TTCGGAGTCCTCTATGCCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCA
GCAGTCTCACTAATGGGCGAGAAGTGTGTGTCTTGATTTCGTCCCTCTTTTGGGCTATAT
GTGGAAAAAGCATAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCT
TTGCCCTTCCTCAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAA
GCTACTCCCCGGGAAACCGGAAGAGGATGTGCGAACCTTCTCATCCTGCGTGATTGCGGG
CTGGATGGACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTCTCCCGGGGATT
GAGATGTCTCAGGTCAACGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAA
AATCATGCTCAATAGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCCCTAACGTTAA
TGATCTGCTTTAGAGGGGACCCCCGTTTGGATCCCTTTTTCCTCCACCAAGTGATCAAAA
ACTCCTCCCTGACCGATTCTGGTCATGCTGATTCCTTGGCTCTTTTCGTCTTTTTCTGTC
ATTTCGAAAGACCTGCTTTCAGGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGA
CGGCGGTTTTCCCTTGTCTCTGGTGACACTTAGACAAGTGAAAATGGAGCCCAAGAGGCA
GTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTG
ACCAAGTGGCGGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAATT
TCCACTTGAGTAATTTTTGCTAGTCCGGTTCCCAGTCGGGTATGTCTACGGAAGTTTGAG
AATATTTTCAACTCTCAACTCTTTACGGGATGGGAGTGTGTAGCAGCTCTACTGGAGAAA
CCAGAGAGACTTGCCCTAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATCTC
CAGGGCCTCTTTCCCAGACATCTTGGTATTGGATGAAGACTGGAGTAGCCTGACACCTCG
CTGTAGCATTCAAGAAAAGGCAGCAGCACCACTATCTGAGTCAAAAAGCTAATGCCAGGC
TCAATACCATTCGGTACGTGGGTCGCGAGCGTCATGACTAGTTTCAGGTTCATACCACAG
GAGGTCAGGATCTGCTGACAGTCTAATCAGGCAATGGAGGCATAACTGCTGCCTTCCACA
TGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTCC
TTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATATACGGGAGGAGATGTGTTCCCT
CTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAGTGGTG
AAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAAAG
CTATTCTTTTCCAAATGTCCTCCAGCTGATTTGAAGATCCCCCGGTGCTGGGGACTCTTG
GGTGCCATTTCCCGGGAGTCCGCACACATTGGACAGTGCCCGTGGACGCATAGTTGGCTG
CCTTCAACACATCAGTCAGGCTTAAGCAATGGCAAAGGCTCCTTTTGCCTGGGTCCTCCT
GTAAATTTCTGCTACATCCAGAGACCTCTCTGCCTTCTTCTGAATATTGCATGATTCTCT
CCTTCTGTCATGGGTCAGCAGACTCCCCAGTGGGTTGCAAATGGCTGTCTTGATTTTGTC
CATGTGTTCGCGAATGTCTGGCTGAAAGCCTAGCCTTAGGGAAGTGAGTTTCTCTTCTGG
GATCTCTGTCTTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGGTCGATGTCTCTTGTGC
CGCTTTCATGAGAGTCAAGCCAACTGCCCGAGAAACTGGAAGATGATGTGTGAACGCTCT
CATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAG
GGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACATAATCTGTCTGGAAGA
GAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCC
TTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCTG
CACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCTT
TTCCTCTTTTTGTGTCCTTTAGCAAAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACA
AAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGA
TACACCGCAAAAGGCAGTAGGGTTTGCTGACAAGGCTGAGGCATGTCCCCTGGTGTTTGC
TTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTCGGAATCAG
AGAATGCTGAAACATGTGCGCTGGAGTCATCTGCGATAGCCTGGGTCCAAGTCCGATAGG
GCCTACCGAAATGGGAGAAACGGCCAACTAGAACAATGTATTTTCCCAAGATATTTAGGA
GATGTGAATGGCCCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTAATTGAAAGCGTGT
GTCAGTTGCGGCTGGACTCGCAGGATTTGCGGGGCGCTTTTCCCGTGAATCTTGAAATTG
GATGAGCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTCAAGTAANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTACCATTCGGTACGTGGGTCGCGAGCGTCATGACT
AGTTTCAGGTTCATACCACAGGAGGTCAGGATCTGCTGACAGTCTAATCAGGCAATGCAG
GCATAACTGCTGCCTTTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCT
TGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATA
TACGGGAGGAGATGTGTTCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGT
GTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAG
TGTTGGCAGAATTCTTGGAATGCTATTCTTTTCCAAATGTCCTCCAGCTGATTTGAAGAT
CCCCTGGTGCTGGGGACTCTTGGGTGCCATTTCCCGGGAGTCCGCACACATTGGACAGTG
CCCGTGGACGCATAGTTGGCTGCCTTCAACACATCAGTCAGGCTTAAGCAATGGCAAAGG
CTCCTTTTGCCTGGTTCCTCCTGTAAATTTCTGCTACATCCAGAGACCTCTCTGCCTTCT
TCTGAATATTGCATGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCCAGTGGGTTGC
AAATGGCTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCCTAGCCTTA
GGGAAGTGAGTTTCTCTCGTCTGATGTCTGTCTTACTTCTTTGCCCTTTTCAAAGGATTG
CAAGGTCGAAGCCTGTTTTCCTGCTTTCATGGGGGTCAAGCTACTCCCCGGGAAACCGGA
AGAGGACGTGCGAACGCTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGG
TGAGGAACTTGAAGACTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGAT
GACACCTCAACTTGTCTCGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTAT
GCTGAGGCCCAGAGAGAAAGTCCTTTTCCCTAACGTTAATGATCTGCTTTAGAGGGGACC
CCCGTTTGGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTGTG
GTCATGCTGATTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTTCGAAAGACCTGCTTTCA
GGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGGCGGTTTTCCCTTGTCTCT
GGTGACACTTAGACAAGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCT
GAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCA
CGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGCT
AGTCCGGTTCCCAGTCGGGTATGTCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTC
TTTACGGGATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCCTAGTT
GAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATCTCCAGGGCCTCTTTCCCAGACAT
CTTGGTATTGGATGAAGACTGGAGTAGCCTGACACCTCGCTGTAGCATTCAAGAAAAGGC
AGCAGCACCACTATCTGAGTCAAAAAGCTAATGCCAGGCTCAATACCATTCGGTACGTGG
GTCGCGAGCGTCATGACTAGTTTCAGGTTCATACCACAGGAGGTCAGGATCTGCTGACAG
TCTAATCAGGCAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTG
ACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGA
TCCTCTGATGCTTGATATACGGGAGGAGATGTGTTCCCTCTCTGGGGATTATTGGGGCCT
GAGGTAGATTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACT
GTGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAATGCTATTCTTTTCCAAATGTCCT
CCAGCTGATTTGAAGATCCCCCGGTGCTGGGGACTCTTGGGTGCCATTTCCCGGGAGTCC
GCACACATTGGACAGTGCCCGTGGACGCATAGTTGGCTGCCTTCAACACATCAGTCAGGC
TTAAGCAATGGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGTAAATTTGTGCTACATCCAG
AGACCTCTCTGCCTTCTTCTGAATATTGCATGATTCTCTCCTTCTGTCATGGGTCAGCAG
ACTCCCCAGTGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGG
CTGAAAGCCTAGCCTTAGGGAAGTGAGTTTCTCTTCTGGGATCTCTGTCTTACTGATTTC
CCCTTTTCAAAGGGTTAGTGAGGTCGATGTCTCTTGTGCCGCTTTCATGGGGGTCAAGCC
AACTGCCCGGGAAACTGGAAGATGATGTGTGAACGCTCTCATCCACTGTCCTTCCTGGGT
GGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGA
TATGGCTGGGGTCAATGATGACATAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCA
TGCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATC
TTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACC
TGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCTTTTCCTCTTTTTGTGTCCTTTA
GCAAAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTG
ATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATACACCTCAGAAGGCAGTAGG
GTTTGCTGACAAGGCTGAGGCATGTTCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTA
AGTGGCGGTGATGTGCGTGGGTGGATACTTAGGAATCAGAGAATGCTGAAACATGTGCGC
TGGAGTCGTCTGCGATAGCCTGGGTCCAAGTCCGATAGGGCCTACCGAAATGGGAGAAAC
GGCCAACTAGAACAATGTATTTTCCCAAGATATTTATGAGATGTGAATGGCCCAGAGCTC
TACAGGAGACTGGTCAACTTGCTGTAATTGAAAGCATGTGTCAGTTGCGACTGGACTCGC
AGGATTTGCGGGACGCTTTTCCCGTGAATCTTGAAATTGGATGAGCGACTCAGTAGTCTG
ATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCATAGAAAATCTAA
AGTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTGAT
GCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGCGTAAGTGCTGCC
TTGCACATGTGCAGAGATCAGTGTTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTCCA
TAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGAT
GTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGC
ACAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved