Loxodonta_africana Locus Mono:90:SNORA28
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:90:SNORA28
Loxodonta_africana
Mono:90:SNORA28
GeneScaffold_1141
SNORA28
1001..1122
2122
GAATCAGAATCAACTCAATGGCAACTAATTTATGTATGTATATGTGGGTCAGTATGGGG
CTCTGTCCACTGAGAGGGCCTAGAAGAAATGGCACCCCAGTAGTAACAAGCACACCCAGC
CCCCAGATTTTGGTTTCTAATACCACTCTCCAATCAAAGCAACCAGGGCTCCTTAGAGAA
ATGGCTGGTTGTAGGTTTGGGGCCAGAAAATACCAGATAAGCCTGGAGCATGTGACAGTG
CCAGAAAATAATGAAGTGCTCAAAAAATAAAAGGATAGGGGTATGTCAAAGGGACACACA
GCCAACCTGAAAGAGCTCCCAGTGGCAAAAGCTGGAACAATTTGAGCAACAAAATGAATA
ACACAGTATTGGATTAAACTCAAAGTATAAAATAAATACCCTTGAGTCCATGCTGATATA
AATGACTGAATAAATAAATAGATGTGGGAGAAGAAACAAATCTTCCTTACAGAAGAGTTC
CAAATAATTTATGTAAATACTTCCCCCTACCCTTTCCCTTGTGCAGGCTTTACTTGGTGA
CTTGCTTCTAAAGACTAGAGTATGGAAAGGTGGAAAATGTCACTTCACGGTAGAGAAGCC
TGGAAACACTACCCTGGCCAGGTGATCCAGGCTAACGTCATCAGCAATAAGTCACGTTGG
TAGGATGTGACCCTGGTCTGATGTGATGAGATGGGCCCATCTGTGGTCCCCTGGGGTATT
CTTCCCCCACATAACTCCAGGCTAACCATGAGAAAAACATCAGACAACCCAAACTGAAGG
ACATTATACAAAATACCTGACCAGTACTCCTCAAAACCGTCAAGGTCATGAAAAACAAGG
AAGGTCTGAGAAACTGTCACAACGAAGAGGAGGCTAAGGAGACATAACTACATGTAATGG
GGTGTCCTGGAGAGACAGCAAGGCCATTAATGGGAAAACTAGTGAAACCTAATAAAGTCT
GGAGTTTCGTTTTTTTAAAAATCACATATTACAATGCGTGCAAGCAACACTCAGTGGCAG
ATGATGGAAACTGACACAATTTGTGCTTGCTATAGCAAGAAAATCTAACCTATTCTGGAG
TTCTCTACTCGGTGAGACAAGCTGTTATATAGACTTAAATAGTGTAAAAATTATATATTA
TATAACATTCATTTTATAAAATTTGGAGCATATGGAAAAGATACCATTTACAAAAGGAAC
TAAAAGATGGAAAATACCCAAGAATACATGTGGGAATAAATGTGCGTGCCAAAACTTTTA
AATGAAGAAAATTTAAAATATTACAAACAGATGTAAAAAAAGGCATGAATCAGTGGGACG
GCATCTACTCCCGTGCTTGGATATAAAGATCAATATTATAAATGTTTGATGTGATCCAAA
TAAAAATAGCATCCATTTTTTCTAAAACAAACTAGTTCTGAAGTTAAAACTGGAAGAAGA
GGGGAGTAAGGGGGTACTTATAAATTATCTCCTCAAGGTAGAGTCAACCTTAATGATGTG
CATAGAGCCAAGCTTTCGGGACCTTCATCTGCTGATGCAGCACGACTTAAAATCAGAACA
GCTGCAAACATCCATTAATAATAGTAATGTGAAACGTAGGAAGTATGAATCTAGGGAAAT
TGGAAATTTTCAAAAATGAAATGGAACCCATAAACATAAACTTCGGTATCCTAGACATTA
GCGGTTGAAATAGACTGCGTATGTGGCGCATTTTGAATCAGGCAATCATATGGTCTACTA
TGCTGGGAATGACAAATTGAAGAGAAATGGTATCGCATTCATCATCAGAAAGAACATTTC
AAGATCTGTCCAGAAGTACAACGCCGTCAGTGATGGGATAATATCCATATGCCTACAAGG
AAGACCAGTTAATACAACTATTATTCAAATTTACATGCCAATCATTAAGGCCCAAACACG
AAGAAAACTGAAGATTTTTTACCAACTTCTTCAGTCTGAAATTGATCAAACATGCAATCA
AGATGCATTGATGATTTCTGGAGATTGGAATGCAAAAGTTGAAAACAAAGAAGAAGGTTA
AGTGGTTGGAAAATACGGCTTTGGTGATAGAAACGACCCCAGAGATCACATGATGGAATT
TTGCAAGATCAATGGCTTCTTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved