Loxodonta_africana Locus Mono:17:SNORD50
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:17:SNORD50
Loxodonta_africana
Mono:17:SNORD50
scaffold_18534
SNORD50
1001..1070
2070
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTTGTACAAAATAAAA
AAAGCTCGCGAGAATTTTTTTTTTCTTTTTTCTGCCGAAAAGTGAGTCATTGCTGTCTGC
CCACCTAAGGAAGGCCAGTTTGGCGTGACGTTCCTTCCTAAGGAACTTCCTGTGAGTACA
AGTTTTTTGATTACTAGGAGTTGGTGTTGTATCCTTGGTCTTATCTATGATGATCCTATC
CCGAAACTGAATTTCTGTTGAAAAAACTTATACGGATCTGGCTTCTGAGATGGACCATTG
CTAGAACAGTACTTAAAAGTTTATTTTAAGTAAGCTGTTTTTAATGTTGATTACCGTAGT
AAATCTCAAATGTTTTTTGTTTTCCAGGACTACCAAGAGGTTTACTTGTCTGGTGTCAAG
TGCTGGTGGTGAAAAGCCCAGGAAACATTGCATTTTGCAGACGTAGAAAGGAAAAATGCA
ATTTGGTTTTATCGAGAGAGTGTTTTAGGGTAACTTCAAATATTGTGGATTTGGATGATG
AACCAACACTGAATCTAGATTAAGTATTCACAAGATGCGAGCCACTTCTGTATAACACTA
CCCTAAAGAGTCACAAAGTATTAACAAGTAGATTATTTATCAGAACTATTTCTTAAGTTA
TAGATACTTTAATGTGAGAAGTAGAATGTGCAGTGTTCAAAAATTCTTTGTTATCGGTTA
ACCATCCTTATAATTCTGAATGACCTTATCTGTGCTCACCTGTTTGAAATGCTTAGTTGT
ATTTAAAGCTTACGTTAACGCTTGTAGAGATTTGTCAATTGATTATAAAAATAAAATGTA
TGGAACAAAGTATTTCTGGATTTCTCTAAATGTAATTTTGAAGGCTGAGGTGCTTAAGAT
CAGAAATGGATATATTGATTGGGTATCTTCATACTACTCAAAATAGAATTGGGGGGCAGT
TAAGGACTCTTTCGGCAAGTACATAACTAAGATATTGATGCACGTGTATGGCATTGCAAC
TTGCATCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGGGTATTGTTGGGGCTCCATTCAAATTGTAGAGGAAAACTGCCTTTAC
CCTTTCTTAAAAGCTGGGAAATAACCTCTTTCAAACAGCAAAGTCGTGAAATAGACAAAA
TATGTTTTGAAGCCCCCTAACCTCTCTCTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved