Loxodonta_africana Locus Poly:14:SNORD113
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:14:SNORD113
Loxodonta_africana
Poly:14:SNORD113
scaffold_44287
SNORD113, SNORD113, SNORD113, SNORD113, SNORD113
1001..1075, 1784..1858, 4101..4175, 4901..4975, 5655..5729
6442
TGAGGCCCAGCACAAGCAAGACCTAGTCTCTTCTCTCTGTTGAAAATGGTGCTATGCAC
AGGTGTTAGGAATATTCAAGGGAGTTTTGATTAAAATATTATTAAAAAATCAATAGATAT
ATCCATTGTAAATATTTAGATCCATAGGAATGTAAAGGGTAAAGCATCTTCTGTCTCTAA
AGGCATATGGCAGAGCATGGAATACTCTTTTCATATATTAAAAGCCCAAAGTTCCATAAG
AATGGTACCAAATAGGGATGGGAGGAGGTTGTCTCTTTGGCCAAAGATCATTTAGACAGT
CCACCTCAAAGTCCATGGTCTTATCCTTGGTGGTGATATGTTGGACGTTGTTAGTATTAT
TAAGAGAAGAGGATAACAGTATACCCAGGGTTAGTCAACCCCTAAAAGCATGACAAATGA
AAGGTGGAAAGTCACGATCAAAGAAGATAATGCCTCAATATTTGTATTCTCTGATCTGCC
TTGTATACCCCAAGATGGACAACCCAGAGCTGATTTCAGTTACCGGGGTCACGTGTAGTA
CAACTGACTCCATGAGTTAAGAGCATTGGCATCTATGTGAGTAACACTCAATGATGCTGT
CTTAGTGGGGGGAAATTATGTGTCACCTTAGGTATTTTATTATTATTATTATTACTTAAT
TGATGAAGTAAATAACAATAAGTGTATGTGAAGGAAGAAAAGCGGGACCAATACTGCAAC
ACTGATGACCACTGGTGGCGTCTGAGTCATGGATGATGAATAGTACATATCTGGAACGCT
GAGGTCCAACTCAGACATCTCATCCCTTGCCATGGTGGAAAATGGTCCTATGGACAGACA
GGAACAATTTTCTTGGACTTGTGTTTCCCTCTGCATGACTATAGCATTTTTCAAAATCAA
TGGAAGTATCCACAAGAATCATGAAATGAATAAAAAATGGAAAAATGGAAGCCTGGTACG
GTGATAAACACCTATGGAAGGCCAGGAATACTCTTACTATTTATCAATGTCCCTGAAGCT
CATTTAAGAAAAGCGTCATTCCAGGAAGTTCCCTCTGTGGCTAACGACCATACAGGCAGT
ATAACTCATAACATATTTTTCCCTTGGTTGGTGGCCCATGCCATGTTGTTGAAATACTTA
AGGGAAGAAGAAGTAAACATTCTCCGCAGTCAGTAATTGCCTAAATGCATAAATAAGGAA
AGGTGGAATGACCCAGTTAATGTAGTTAAGGTGTCAAGCCGTTTATCATCTTCTCTGCTT
CGTACCTTCAGGACAGTGGTCCCCATGGTGATGGAACTTTCCACCAGGGTTTCCAGCTCA
ATGGTCAGCTCTAGGTGTTAGAAGCATGGATACTGATGTGAGTAACAGTCAAATATCCTG
TCTTGGTCTGGGTGGCCTGTGTATCCTCTTAGGTATTTTTTCTCATTGGTGTGAGTTAAT
TGATGAATTCGCCAGTAAGAATGTGCAGATGCAAATGAAGAAAAAGAAGGCCAATCCTGG
ACCAATGATGACCACCGGTGGCTTCTGAGTCATGGACGATGAATAATATGTGTCTGGAAC
TCTGAGGTCCAACATAGAGAGACCCCTCCCATTGTTGGGAGTGCTAGTGAAGAGAGATGT
TAGAGGATCTGGTGCTTCTCCTTTTATGACTAATAAGTTTTGATTGGAACATTATAAAAA
ATGAATGGAAGTGTCCATCAAAAAAATTTAACTTCATAAGAATGTAAAGGGTGAAGCATC
ATCCAACTCTGTACCTGTATGGCAAATCAAGGAATACTCTTTGCTTATACTGAAAGCCCA
ACATTCCTTAAGAACAGTATAATTTAGGGATGAGGGATGATTACTTCTTTGGTGGAGGAT
CATTTGGACAGTCAAACTCAAAGTCCATGATCTTATCTTTGGCAGTGGTGGGAAGTTGTT
AGCATTCTTAAAAATAAGAGAAGGTCAGCATTACCCAGGGTTGATCATCTCCTAAGAGCA
TGTGGAATGAAAGGTGGAAAGTCTCGTGATCAATGTAGATAATCCCTCAATATTTGTATT
CTGTGCTCTGCTTTGTACCCCTCAGATGGATGTTCAGGATGATTTCCATTTCTGCTAAGG
GTCACGCGTGGTACGATTGACTCCATGCACTGGGGAGTGTGGCATTCANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAGTCAGCAT
TACCCTGGGTCAATCAACTCCTAAGAGCATGACGAATAAAAGGTGGAAAGTCCTGCAATT
AATGGATAACATGCCTCCATATTTGTATTTTCTGCTCTGCCTTTTATGCTTTAGAATGAG
TGCCCTGAACTGATTTCAGCTTCTGCCAGTGCCGTGTGTGGTACAATTGACTCCAAGCAT
TGGGAGCATGTGAATTGATGTGAGTAACAGTCAAAGACCTTGTCCAAATGAACAGCAGTA
GGTATATGTGAAGGAAGAAAAGCTGGGCCAATTCTGGACTAATGATGACCACTGGTGGCA
TCTGAGTCATGGACGATAAATAGTACATGTCTAGAACCCTTAGGCCCAATGTAAAGGGAC
ATCTCGTCACTTCTCTTTGTGGGACATGGTCCTGTAGAAAGTAATGATTTTCTTGGACCT
GCGTCTTCATGCCTAAAGAGTATCTCTTATAATATTTTGAAAATTAAACAGAAGTATCCA
CAAGAACTTGTGAAATGAATAAAAGCAGAAAAGTAGAAGCCTTGTCCAATGATCTATATA
CATGGTGTTGTCAGAAATACTGTTGCTGCTTATTGAAGCCCCTGAAGCTCATTTAAGAAA
AATGGCATTCCAGGTGGTTTCTTCTCTGGCTAAGGACCATATGTGGTAGATAGTATCACT
CAGAGTCAGTCTTCTTTGCTTGGTCATCTGCCTGGGCTCTGTTGTTCAAATCCTTAAGGG
GAGAAGAAGTAAACATCCTCCCCAGTCAGTCATTACCTAAATACATGAATAAGAAAAGGT
GAAATGGTCTGATCAAAGTAGTTGAGGTATCAAACCTTTTATCATCTGTTCTGCTTCCTC
ACTCTTCAGGATGGTTTACCCCAAGGTGATGGATTTTTCTGCCAGGGTATCCAGCTGGAC
CGTTGGCTCTAGGTGTTAGGAGCACGAACATCAGTGTGAGTAACAGTCAAAGATCCTGTC
TTAGTGCGAGTGGTTTGTGTGTCCTCTCTGGTATTTTTTCTCACGATATCAGTTAATTGC
TGAATTCACCAATAAGAATGTGTGGAGGTGAATGAAGAAAAAGAGAGCCAATCCTGGACC
AATGATGACCACCGGTGGCTTCTGAGTCATGGACGATGAATAGTATGTGTCTGGAACTCT
GAGGTCCAGTGCAGAGAGACATGTAGTCCCCTCCCATTGTTGGAATGCTAGTGAAGATAG
ATTTTGGAGATGTTTAAGGATCTGATGCTTCTCCTTTTATGACTAGTGAGTTTTTATTGG
ATTTTTATAAAAAATCAATGAAAGAATCCATCAAGAATATTTAAGTCTATAAAAATGTAA
AGGGTGAAGCATTGTCCAACTCTAAATGCCAATGGCAAATATATATAGTCTTTGTGTGTA
TATATATATATAGAAAGCCTGACGTTCCTTAAGAAAGGTATCATTTTCAGGTGGGTGGTG
GTTACCTCTTTGGTCAAGGGTCATTTGGACAGTCAAACACAAAGTCCATGGTCTTATCTT
TGGTGGTGGCATGTGGGATATTAGGATTCTTAAAAGAAGAGGAAGTCAGCATTACCCAGG
GTCCATCAACTCCTAAGAGCATGAGGAATGAAAGGTGGCAATTCTCATGATCAGTGTAGA
TAATACCTTAATATTTGTATACTCTGTTCTTCCTTTTACCCCTCAGGATGGATGCCCCAG
GCTTTTTTCAAATTCTGCCAGGGTCGCGTGCAGAATGAATGACCCTCTGTGCACAGGGAT
CTTGGAAACTGATGTGAGTAACAGTCAAAGATCTTGTCTTAAAGAATAACAATAGGTGTA
TGTGAAGGAAGAAAGGCAAGGCCAATCTTGGACCAATGATGACTACCGGTGGCGTCTTAG
TCATGGACGATGAATAGTATGTGTCTGGAACTCTGAGGTCCAATGCAAAGGGGTACCTTA
TCCCTTCCCTTGGTGGCAAAATGGTCGTGTAGACAGATACTAGCCATTTCCTTGGACTGG
AGCTTCCCTCTTCATGCCTAAAGAGTATTGATTATGACATTTCCAAAATCAGTGGAAGTA
GTCACAAGAATCAAGACATGAATAATAATAGAAAAGTGGAAGCCTTGTCCAATGATTAAC
ATATAGGGGAGGCCAGAAATACTCTTAGTTTTTATTTAAGACCCTAAGCTCATTTAAGAA
AGGTGTCATTCCAGGGAGGTCCCTCTCTGGCCAAGGACCAGATGGGCAGTATAACACATA
TAGTCAATGTTCTTTTCTTGGTTGGTGGCCTGTGCTCTGTTGTTCGAATACTTAAGGGGA
GAAGAAGTAAACATCCACCCCAGTTAGTAATTCCCTGAATGCTTGAATAAGGAAAGGTGG
AGTGGTCCGATCAATATAGTTACGGTGTCAAGCCTTTTATCCTCTTCTCTGCTTCCTACC
CTTCAGGACAATTGTCTGCATAGTGATGGCACCTCCACTAGGATANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved