Loxodonta_africana Locus Mono:94:SNORA32
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:94:SNORA32
Loxodonta_africana
Mono:94:SNORA32
GeneScaffold_6195
SNORA32
1001..1120
2120
TGATTCTTACATACAACTTCCTGGGAACTTGTTAGAAATGCAAATTCTCAGCCAGGAAC
TTGTTAGAAATGTGAATTCTCAGCAGGGGTTCGAGCTGGAACAAATGGTGTGAAGCCCTG
CTCTGGCCCCAGAGCACTGAGTGTGATTCTGATCTGCTGAAACGTAACCCCACTGAGCAG
CACGGTGAAACCAGCCTGGCCCCAGGAGGCCCTCTGGACACGTGTTCACCAGGCCAGCCA
GCCAGCCACACAGCACTCACACACCAGACATGGCGCCTCCTGACCCGTGCCCACCAGAAC
CGTGCCAGAGGAGACATCAACAGACTCCCACAGATATCTGGATTCCCTCTGGCCCAAGTC
TGGTTCCAGGTTCATTTTATGCATTGACCCACTGGCAGAGCTGACAAAGATCCCTCCCAG
GGATACATGGACACCAATGGAAGATGTTCACCACTGTTGACGCATGAGATGTCTTCCACT
TCCATCAACCAAGGATGCAAAAAATCTTGAGGAATTTTGCTAGTAAAGTTCCATTTCCCC
TGACATCAAATAGTGGCTCTGCAACTGATCAGAAGGTATTGCATTTTCATATTTTTAACA
CATTGGTTCAAAAGCCACAGAAATCTTCACTTAAAAGACTTCAACAGGCTAGAAAAACAC
TGTTCCCAGGTTAACCAATTGTTGCGGGTCGATACTGACTCATGATGACCCCAAGTGTGT
CAAGGTAGACCTGTGCTCCATAGGGTTTTCAGTGGCTGGATTTTTAGAAGTGGATTGCCA
GGCCTTTCTTCTGAGGTGCCTCTGAGTGGGCTCGACCCTCCAACCTTCTGTTTAGCAGCC
AAGTGCTTAACTATCTGTGCCACCCAAGGACTCCATTCCCAGGTTAAGGGTACAGATATT
AGAGTTTTTAATAGGTGACCCACCCACATCATTTTTGGCAACAAAAATCACTTAACGATG
GAAACAATGAAAAACATCTGTTTTCAAAATGATCTTTCCAAAGGTCATTACCAAGGCTTT
TAGAATGCAGTTTGATTTGCTGTGGACTTGACGGTAATAAAAACCTCCCACTAGGTTTTC
TCTTTGCGACCTTGCTAGCAGTCAACCAGCTGGGAACATTTTATACCCTTCGTTATTTCA
TTTCCATTGCCTAGATCAGCACCAATAGAAATATCATTTAAGCCACATATTAGTTTCTCT
AAGCTTTATTGTTTATACTCAATAAAACAGAATTTATATATTTTCTTGTGCTAAGGATAA
AAAAAAAAATCTATCCATAATTGAAATTCCTTGAAGAGCAGCTACTCTCTGGTTCTTTGC
TAAAACATCAGCCTTAGCTTGATGAGATGACTGTCTGTAGATTTTTTTTTTAGTATCCTC
TAGGGACCTACAACTGACAGATACTTGTCATCAGGGAACATTTTGGGAACACCTGAGTTT
TTGGAAATGAAGACTCTGTACCTCTTGAAGTCCAACAAGCCTTTAACTATTTTGCTACAG
ATACAGTACATGTAACACAAGCTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGTGATACCTGTTTCTTTAATTACGAGAGTATGAA
TTGGAGCTGACGCGGTCAAAGGCTGGGAAAAGGCTCACCAAACGAAACGAAATGAGTGGT
TCTAAGGGTAGTAGGAAACCCTGGTGGCGCAGTGGTTAAAAGGAACAGCTGCTAGCCAAA
AGGTCGGCAGTTCGAATCCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved