Loxodonta_africana Locus Mono:36:SNORA70
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:36:SNORA70
Loxodonta_africana
Mono:36:SNORA70
scaffold_69500
SNORA70
1001..1133
2133
CCCAAAAAGGAAGGGGCTTATACTTCACCTCGGCAATCCCATTTGTAAAACTAGAATTG
TTTTTATGTGCTTCAGGGGTATTGGTTATAATTAACAATTAAACTGTTATGAAGTATGAA
TGAATAGTTGCTTAGTTGAAATTATATGCCTGTTTTTCTTCCTTAAGGATCAGTCATAAG
AAAGGAAAGGAAACAAACAAACTAGAGTTCCTTAAAGAATTAAAATTACATTTGAAGAAT
TTGGTATCACAGGGAAAATATATTACCTTATAGGTTGATATTTATCTTATAATGTCCTTA
AGGATGTTGTAGGATGAGTAATCTTCACTATGTATTAGTGAATAGTTGTGTGTAATATTT
TAACAAGATTTAGTTGGTAAGATTGATATTCAACATTACTTTCATTACTGTTTGAAAATC
AACCATTTTTTTCCAACAATGGATATTAACTCACCTGAAAAACAGGGGAATTACCTAATG
GTCTTATCGTTAGACCTTGAAGTATTGACTATGTCTCGCAATTAATTTTTTTATCCCATA
TCTCTTTGTTCTTTATTTCTAACTTATAAAACATCTGTTTTATATGAGGTGGCAGCACAC
TATATATAAAAATAATAATAAATAAATACCCAAATTTCCCAACATAATATGCTGCTAGCA
GTGAACAGTGAGTAGGCCGATGAGATGATAGATGTATGTGAGAAAAATATTCTGCTAAAA
ACTATGTCCTTTATTTTGCCCTTCCTTCTACTTGAGATTAGGAACTGGAGCTCTGGTAGC
ATTTTCTTCAATGAGTTCATCATGTTGGTGAATCCAGAGGATGACAAAGCAGAGAGAAGG
AAGCCTAGGTCCCTGAATAAGATGGAGTTTAACACAAATTCAAAACTTCTGACCCCAATT
TATTTTATGTGAGAGATATATAAATGCCTGTCTTGTTTAAGCAATTCCAATTTTTTTCTT
AATACAAGAAATAAGATAATATGATGCAAAATGTTAAATATCTGCAGCCAATTAAGCCAA
CTCCCTTCCTTCCCTGTGAGGTCAACAGTGCAGTGGCTGCAAACAGCAGCCTGCTTGGTA
GTGTATGCAACCTGTTGCATGCATGCATTGCCCTAAGGAACCTTGGAGACAGCCCTTTCC
TGCTCTTTAATGTCTCTAACCTCATTAATCTCTGCTGCCCCTAATCCATGCTCTAGACAG
GTATGCGAGGTGGCTTTGAAAAGCCCCAGGGTACAGTGGCCAGGGCCCACACTGGCAAAG
TCATCGTGTCCATCTGCACCAAGCTTCAAAACAAGGAGCATGTGGTTGAGGCCCTATCCA
GGGCCAAATTCAAATTTCCTGGGTGCCAGAAGATCCAAACCTCCAAGAAGTGGGTCTTTA
CCAAGTTTAACGCTGGTGAATTTGAAGACATGGTAGCTGAAAAGTGCCTCATCCCAGATA
GTTGTGGAGTAAAATACATCCCCAGTCGTGCCCCTTGAACAAGCAGCAGACTTGCATTCA
TGAGGGCCTTGGTAGCACTGCCCCACCTGACCTGTGCCCACCAATAAATTGACCTTTGTG
TCTCTATGTTGCCCACAAATAAATTGAACTTCCTGTCTCAAAAAAAAAAAAAAAAAGTTA
AATATATGGTACACAACAGTTTATAAAAAAATGTTTAAGTAAAAAAACAAGTAAATAAAT
TGGACAATATATCATATAAGACAAATGAAAATTGTGAAATAACAAAAACTAAGTATGTTA
TAATCTGTAATTAATATAATAATTAAAAAAATTAAAGTCAATAAAATGAAGTTAAATTGT
AAATAACTTTAAATAATAAAAGTAAAGTATACTCAGAAGTAATAAGAAAAATAGTATTGA
AAGAAAAAAATCTTGAAAAAAGCTAAAATATAATGCTCCTAAAGTGTTAAAAAGCATGAC
AGTAAAATTGGAGGGAGGATACAATAAATAAATAAATACGTACGTATCAGGATGTACCAG
TTGCCATCAAGTTGATTCCCAATCATTACAACCACATGTGTGTCAGAGCAGAACCATACT
ACAAAGGTTTTCATGTCTAGGCCTTTCTTCTGAAGCACCTCTGGGTGGACTCTGACCTCC
GATTTTCAGTTACCAGTGGATGGTATTAACTGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved