Loxodonta_africana Locus Mono:33:SNORA72
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:33:SNORA72
Loxodonta_africana
Mono:33:SNORA72
scaffold_59469
SNORA72
1001..1117
2117
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACTGCTGCTTAGGGTTTTTGTGGCTGTG
ATCTTTACACAAGAGGTTTACCAGGCCTTTTCTTCTGTGGAGCCACCAAGTGGATTTGAT
CCACAGACCTTTGGGTCAGCAAGCCAAACAAAGCCCAGTGCCGTCGAGTCTATTCCGACT
CATAGCGACCCTATAGGACAGAGTGGAACTGCCCTATAGAGTTTCCGAGGAGCGCCTGGT
GCATTCGAACTGCCGTCCCTTTGGTTAGCAGCCGTAGCATTGAACCACTAAGCCACCAGG
GTTTGAGTCAGCAGAAGATGGCACACTGCTTGCGCCAGCCGGGCTCCTTGACGTGCACTA
TAGTTTGGGGGCGGGGGCAGGGAACAGCTTAGTATTAGCTAGAGTATGAAAGACGCCTCA
TGGAGAAGGGAGATAATTTTGTCATTGATCATCCAGAGAGAATGAGGGACATTTTGGGGA
ACAAAATGGGGACTGAGAAGACTTGTATGGTAACTTTAACACAGGCCCAGAACGAACAGA
ACTGTGTTTGTGGGGGACTGAGAACTTTGAGGCGTTCGCTTTGAGTTTCTAGTGACGATG
TTCAATGCTTTCGTAAATCAGAAACTCCAGGGTTGGTGGTTGTCATGGCTGAAATAAAAG
TAAATAAATAAATCAGCGTTAAATTCACAACTGCCACAAGGTGAGTGGTTCCGGTAAAGA
AAAAAAAAAAGTCACTGTTGATTTATGTGTTGATCAGCGTACTAACTAGCTGTTACGTGC
ATCTTTTGTTAATCAGGCTTTGAATGCAGAAATATTACGATTTAATTTCAATTTCATCAC
CAAGTAGCACTAATTTGTTTAAAAAAAACTGACATCGGGTTCTGTTAAAACTCTTTCCTA
ATCAGGGCAGGCTAAACGTCCGCCATATTAAGACCATACATGCATCCCCAGGCCTAGTTC
TTTCCCAAGGTCTGGTTTTATAAATGCTGGTGATAAACTAAGTCTGATTTACTCTGTGGC
CATCTTCTGCAGGAAATGGCAGAACTCCAGGTATCTTTGTTCAAGCTTAAGAGAAATGGC
AATATAGCTAGTGAAATAACTTACAAATAACCACTGTTAATACGCAGAGTTATGTCTAAA
GAAGGGATGAACAAAAAAAGAAAATTTTATGATTACCAGTTGCCATTAAACGTAAAGTTA
CTGTGTTTTGTTTTATTTAAAGCAAACAAAAACTCATTATAACTAGCATCTGAATTGGCG
CTATAAAAAGAGTATTTCAATATCATTAGCCCACAATTAAGGACCAAAGCTAAAGGTCAT
TTTTGATCATTAACAAAATAATCAAACTACCGAGGATGTTTTCTTTTTCTGCTCCTACGT
GGCAACACTGTGAACTGACACAGTGATCACGAGTCAAAGACAGCAACAATTATGTGTGGA
TGGCGAAGAACCTAGCAGCATTTCATTCTGTTGTACATAGGGCCTCTATGAGTCGGAACT
ACTCAAGGGCACCTAACAGCAACAGCACCACATGTGGCGATATGTATAAGAATGTAACTG
GTCTCTGGAAGTTTACTCAGGAAATAAGTACTAGGTATAGAGGAAGCAGGAACAGCCCCT
GTTATGAGGCATGAGAAAAATAAGCACCCTAAGCAAAAGAAATTCTTCCTGTTTTCTATT
TCCACTAAGAAAATTTCTACAGTATTACTCCAGTTTAAGATGCTAATAGAGAACCCAACT
TGCAAAGAAGCAGAAATAGGAACTTGTTTTCTAACTTCGTGAGTATTCTCTTAAACCATT
AATGTACCTTGAAGTAAATTGAACACCTTTACAGGCTTATGGTAAAATGCCTTTTTGTAT
TTTTATTTAGCACCATGGTTTGTTAAGCATATACTGTACGTAAATAGTCTTGATAAAAAA
TTTAAAAGACACTCATACTGTGTGCTATTGATGGATCAGAAGGGTTGCTACCTTAGTTAT
GTCCTCTAATAATAACTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved