Loxodonta_africana Locus Mono:30:SNORA66
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:30:SNORA66
Loxodonta_africana
Mono:30:SNORA66
scaffold_55393
SNORA66
1001..1132
2132
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTTCTGACTCATAGTGACCCTACAAGACAGAGTAGACTGACCCAGAGAGTTTCCA
GGGAGCGGTTAGTAGATCAAACTGCCGACCTTTTTTTAACATTCCTTTGGCCATAGTTAT
AAACCACTTCTATTGATAGGAGGTGCTAGTTACTAAACTGCACTAATTTGAGGGTATGAC
TAGAAATAGCTTTGAAAGACCTATCAGGTAGAAATTTCCATGAAGTGTGAATCTGTAGAC
TGAGCGAAGACAGAAAAGAATTTAGCAATTGCTTGTTGAAAACCTAGTGTCAGCATCTAA
TACTACTAAGTTATGTCAGTGTTGTGATTGTCTTGGCCCCATATGTTCTTGGTCTTAATG
CTTTGTTTTTCACTTGAAAATATCATGGTCAGGAAATACTGAAAATGAATGTAATGTGTT
TTCCTGCAGAAATCAATTTGCTCTAAAGTATGGCTGAATTCTTCAGAGATACATGCAAAT
ATTTCTTGAATAAGATTGAATTGAATTTTGCGAATAGTGTCAATTGATGTATTAAAGCCA
TTACCTAAGGTAAAAATTGAGACTATTAGGAATAGGTGGGTTAAGTTTAGAAATTGAAGC
AGGTACCAAACTTGACTTAGTTTTGTTCCTTTTGAGAATCTGCCTTAGAAGGGCAAAATT
GAGCAAGTGGTAGAATATAGATGCAACTAACAACAGCATCGTTTAGGGCACGTGAAATGA
AACCAAGTACTGTTTGATTTCCTTTGTTTCAGATGGAGGAGATGTACAAGAAAGCACATG
CTGCTATAAGAGAGAATCCAGTTTATGAGAAGAAGCCTAAGAAAGATGTTAAAAAGAAGA
GGTATGTGTCTTACTGTTACGATTTTTGCGAGACAGAAGGGATTGGGAGTGATTCCCATA
CTGCCTCCTTTGATCTGGTGGGTCAGATTCCCGGTGAAGATCTGCAAACTCGATCACTAG
CTCTGCATGATGTTGCGGAAGCGAGGGGAACCAGGTTTGCTAAAGTAATTGTGGTGATAG
AAATGATTAGCCTCAGGAGCTACTGAGGTGGCCCTTTCTATCATAATACAGTATAAGTAC
CAGTTACTGCTTTGGGGAGGCTACCTAAAGAAGAGTTGGTTTTCATGGTTTGGTATTTCA
AAAGTAACAATGGGGCATCTAAACATTGCGCTGACATTACGTTGTTTGATTTCTTGGCTT
TGCACAATAGTAGCATATCCAGGGAGTTGGGGTTTGAGAAATACATGTGTTGATTATTCA
CGTCCATCTGATTACAAAAATCTCCATTTATTTACAATTAAACATTCTCCATCCTCTTTG
GCTATGATTTAAAAATATATATTCCTGTGTTTTACTTTGTTTTGCAGGTGGAATCGTCCC
AAAATGTCTCTTGCCCAGAAGAAAGATCGGGTAGCTCAGAAGAAGGCAAGCTTCTTCAGA
GCTCAGGAGCGGGCTGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved