Loxodonta_africana Locus Mono:87:SNORD87
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:87:SNORD87
Loxodonta_africana
Mono:87:SNORD87
GeneScaffold_1430
SNORD87
1001..1090
2090
TAAGGTAATGACTACCATTTCCAGCTTGGAAAGGTCCATTTATGGAATTCTTTAGGGTG
CTGTGAATCGAGTAGATGGCAATGGATTAGTCAGTAAAATGTGGGACAACTGTATAGTTA
CAAAAAAAATTTTTTTTTTTTCTCTTATGAATTTACTTTTACTGTTAAAGCACAGTATGC
AAACTTAGAAATGTGTAACTTTGGAAACATCATACACTCAGTCCCCAGAAACTTTACTTT
TACTGTTAAAGCACAGTATGCAAACTTAGAAATGTGTAACTTTGGAAACATCATACACTC
AGTCACCAGAAACTCTCGGATAATAGGTACTTGTAATTCTGTGCAGTGTCAAGGACCTAA
CTTGCTGTAACTTTGATATAAGCTCAGTAAAGCATTTAAGGTTGAGCATACTATCTAGAT
CTAAAACGAGAATATAGAAACTTTTTTAGCATTTTGGAGATTTACTTTTCACAATAAGCC
AGAAATGACCAAAGGGACTTACTCAAATCATTATAGACTTTTGGGCTTGTCAATTTTGGC
TACCAAAATTAAGCAGCAAGTATATTCCTTTATTCTGTTAAGAGATGTGTTGAACAACAG
ATAGAAAATTACTCCTTTACTGTATAATCTCAATGCTGGTAGAGGGGTTTGGGAGTCAGG
AAGGTTGATGAAGTGTGATTGTTTATGGTTCTTAATAATGAGTAGACCACTCCTTACATA
TAAGGTGCCAAACAGATGTGAACTACAAATGAGAATCACAAGGAAATATTTAATTTCCAG
ATGCAACAAAGCCTGAGTTTTGAAGATGTATAAAGGTCACCGTGATAAATGTTTTCTGAA
GATTTGTCAAAGAGAATGGCCATGAAAAAACTGCTAGGACCATAACTGCATGTTTCAAGT
AGAAGCAAAAGTTACATGTAAGTTATTGCATGTTTTGGGGGGGTATTGTACCTGGAGAAC
AATACCTGAAATGTGTATTTTGTACATAGATAGGCTTAATAACTGGCACAATGATGATTT
AAATTACTTTTTGCCGTTTACCCATCTGAGGGTTTCTTTGAAGAAAATAATCTTGAAACT
GAGGTGTCAGTAATTTATATTGATTATGTGAATTATTGAAGTACGTAATTTTTTATTCAA
GTTGGTGAAATGTTCTGTCTCCTCAGCATATAGGTAGCTGTGGATGAATGTTCAGGTCCT
TAACCATGGTATTTAAGAATTCTTCATTGCCTCAAGTTAAACAAGCAACCAAGTAAGCAA
TCACACCCATCAGTAGTTCATAGGTACTGATAAACTCTAGAAGGCTGAGGCCGTTTTCTC
TTAAAAATGCCTTTGCGTGTGAGGGGTCTGATTTCCTTTTCCAAAGGTATTTCATTTTTT
AAGTGTAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCGTAACTAAAAATCTTTATCTGCCTCCCCGTAAAAACCTGCTGTCATACCT
GAAAGACAGCTCATTGAAATATTCTAACCCTATTAATTTTGAATAGCAGTGGAATTGCCC
ATTAGTAAAGATTTTTCCTTTTGTAACCTATGCACTAAGAACAGAATTGTAATATGTAAA
AAAAAAAAATTGTTTTTAAAAATGAGCTTTGCCTTCTGAAAACTCAGTAGCTGTATAGTC
CCTGACACTATTAGGTATTCAGTAAATACATGTTGAATGAATGACTAGGAAATAAAATAG
TAAATTACTTGTCGATCTTATAGAGAGTGAGTGGGAGAACTGCCCAGCTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved