Loxodonta_africana Locus Mono:14:SNORA26
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:14:SNORA26
Loxodonta_africana
Mono:14:SNORA26
scaffold_9951
SNORA26
1001..1115
2115
AGAAGATCTATTGAAGACAGAGGTAACTCTAGATTTCATGTGTTAGACGATATCAGGGT
AACCGGGAAGAAGGCTGTAGATGTACCTGGCAATGTTACACAGTGGAAAGTCAGGTGTTC
ATATTTTCCAGAAAACAAATGTGTTTCTAGTGTTACATCTTTTCACACACGACTTATGAA
AGTATTTTAAAATGCTTCAAGATTCTAAATCCTATGTCTGTCTAATTCTTGGGTTCAAAT
ATTAGTGATAATAACAAATAGCTGTATAGGTTAAACATTAGCATTAAGTATGTTAATTAA
AAACCCACTGCTGTTGAGTTAATTCCAAGTAGTGACCCTATAGGACAGAGTAGAACCTCC
CCATAGGGTTTCCAAGGAGTGGCTGGTGGATTTGAACTGCCAACCTTTTTGTTAGCAGCC
TTTGCTCTTAACCACTCCAGCAACAGGGCCCTGGTATGTTGATAAAAGATATTCAAAAAA
CCATAAAAGACACTTCATTATTTTCTGAATTCAAAAAATTGAAAGAATGTGGCCACCCTG
TAGTGTAATGAGATGAGCTGGTAAGCATAGTGCCTCATTGTGTTCAATACAGGTTTTGAA
ATTGGGGATCTGGTTCAGCTGCTGTTAGCGCTACCTTTAGAATAAGTAGACCTAGGTGTA
GTACCATAAATTACAGGTTTATATTTAAGTGATTAAGAACCACTTCCAAGGGAATAACAC
CTGCCATCGAGTCAACTCTCACAGCTACCCTGTAGGACAGAGTAGAACTACCCCATAGTT
TCCAAGGCTGTCATCTTTACAGAAGCAGACTGTCACATCTTTCGTCCACAGAGCCACTGG
GGGATTCAAACTGCTGACCTTTTGGTTAGCAGCCGAATGCTTACAGCACCACGGCTTTTT
AAGGGAAATAATGGCACTGTAATATTTCCTTCAAAATTCTAATAACTTATCTAAGTATTC
TGTATTTCACAAGTCTCCAAAGACAACCAGCACCCTTCCTTGTGCCTTGTAAGGCTGATG
CAGTGCCCAAGGTGGCTGCACAGGAGGGTAAGTCTCCACAAAACCCAGAGAAGAGATTCT
GCAACTCCTCTTTGGATCCTGTCTGGAGTCACAGTGGGGAGAAAAAAAAAAAAAAGACAA
CCAACATCACCAAATTTTCTCTTAGGAATCAGATATTCAAAAATATACTGTTAGAAGATT
AAAATTTAAGATGACTCAGTGTGTTGCAAATGATCAAAACCAAAGTGTTTTTACTAAATT
TTTTTGGAGAGTAACAAATCTCCAGTTCTTTTCAGGCTTGGAGCCTTGAGTAAGTGAATA
AAATTCTTCAGGTTCTTAGAAGTATTTATTTCCTTGAATTCATTAGTTTTCCTGGATAGT
TACAGATTCACAGTCAGTAGGTGAGGAAGGAGAACTTGAGTGCACTGGGAGCTGAGGCGT
TAGATGGGTTACCATGTGGGGGGCGTGTCTCAGTGCACCCCTGGTTTCAGCAGGCATAAG
GGAACCAAACGTAGCACAACTAACCCCGTTAATGCCAATGCGTCATACCTCTTACAAGTG
CAAGGTATGAGGCCAACGACAACCTCGCGAGCAGTGCTTCTCCTACCTCAACGTGTAGAC
CCGTCACCTGAGGGTCTCGTTAGAATCAGGGTCCGTTCAGCAGGTTTGGCTGTGAGGTCT
GATAGTCTGCCTTTCTAACCAGCTCCCAGCAGACACGGATGCTCCTGGACCACATTTTGT
GCAGCAAGACGTTAGAACACTGGTACCCAGTGTCCAGTCAAAAAATGAGATGCGTTGGCC
AGGAGTTGTAGACCCAGGCATATATATAAGCAGCTATGTGAATGGAAAATTATATGACCT
CAAAAGGACCTGATCACCTCCTTCTATAAAATAACAGGTCTGAGCTAGTGATCTCTCAGA
GACTCTTCGGAACTCCAATATTTATAGAAATTAAGCTAACCCTTATATTTATTTGGGGCT
GTTCTATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved