Loxodonta_africana Locus Mono:18:SNORA31
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:18:SNORA31
Loxodonta_africana
Mono:18:SNORA31
scaffold_18658
SNORA31
1001..1129
2129
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
AAGTGAAATCACTCACTGAGTATTTGCCGTAGGCGGTATAGAAATGAAAGCATTCATTGT
CCTTGTTTACAGAAGCTTCCATATATATTAAGGGTACGCTGAATAAGGTTATAGAGGCAA
CAATGGACAGAAATGTCATGTGTTGCCGTACAAAATGACTTGCCAAAGGGATTCTTCAGG
CTGTATCTGAGGTTTCTGTTGGTAGAACAGAGTGTATGTAAGTCAGCTTGCTGCAAAAGA
GACTTCTAAGGAAGATGCTGCCTCTGACTTGTAAAGAAGTTCTGCATCCACTGATAGACC
TTGAACAATTTGCTGTTGTTCTTTTGGTTTGCACTAGGATGCGAAAGAAAAAATCCCTGC
GCTTTCTGCCTGTCTTTGTGGCGGCCCAGATTGAATGAGGGAATACATCTGCAGCCTAGA
TAAGTGGAGTTACTTTCACATTGGAAAAGTGTTAATACAGTCCTTCTTGTTTTTACAGTA
ACAAATTTGGTAATTATTTGGATCCTCTGTCATCCTGACTGGCTGCTGCTTTTCATCCAC
ACAACACCAGGACTTAGACAAATGGGACTGATGTCATCTTGAGCTCTTCATTTATTTTGA
CCTTGATTTATTTGGAGTGGAGGCATTTTTTTTTAAAGGAAAAAAAAAAACATGTCTTGT
AGGTTGTCTAAAAATAAAATACATTTAAACTCACTTGAGAGAATGCCTCTGAGTTCAATA
TATTTAAACTAAATTCATTCCTGTAGTGTTCATGGAGAAGCTAGAGCCTGGTCGTAGGTC
ACTACCGTGAAGACTGTCTTCAGATGACTGCTACAGCTAAACTACTCCTGGGACCGAAAT
ATCAAAACAGGAATCGAAGGTCTTAACTCTGAGTCGAAGGAAAGGGAGAGACCATGCTCA
TAGTGATGCCAGCACTGGAACTGGAGCCTTACATAATCACCACCTACAAACGGAAGTAGC
TAACTCTGGAAGAGATTACCAAAAGAATAAAAAGAGACTAAAACAGTTGGAAGCTAAGTA
TTGTCTGAGTTTATTTATCATAAATGAAGTAGAACCAAGTTGTAGAAAAATCTAGAAGTT
TTTTGGAATGAATGTGTCAAACTCTGGAGTTGGGATGGTAAAACAGGGATGGGCAAACTG
GCCTGACCTGTCACCTTTTAAGTGACTCATGAGCTAATAAGATGGTTTTTAGTGGTTGAA
AAAAAACCAAAAATGCCTTGACAAATGAAAATGTCAATGGCCAGTTTGTTGGAACACAGC
CGTGCTCATTTGCTTATGGATTATCTGTGGCCGCTTTCATACTACAACAGTGGTTGGGAT
GGACAGGAGGCTTCAGGGCCTTCCAAGCCTAAAACAATTACTATGGCCTTTTATAGAAAA
GGTTTGCCTTAGAAGATGAGATTATAGATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved