Loxodonta_africana Locus Poly:21:SNORD113
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:21:SNORD113
Loxodonta_africana
Poly:21:SNORD113
scaffold_92351
SNORD113, SNORD113, SNORD113, SNORD113
1001..1075, 1814..1888, 4159..4233, 4967..5041
5059
AGAAAGCAGGGCCAATCTTGGACCAGTGATGACCACAGGTGGTGTCTGAGTCATGGGAG
ATGAATAGTATGTGCCTGGAACTCTGATGTCCAATGCAAAGGGACATCTCCTCCCTTTTC
TTGGTGGGAAATGATCCTGTAGACAGATATCAGCAATTTCCTTGGACTGGTGCTTCCCTC
TTCATGCCTAAAGATTGTTGATTATAACATTTCAAAAAATCAATGAAAGTTTCCACAAGA
ATTGTGAAATTAATAAAAATGGAAAAGTGGAAGCCTTGTCCAATGATAAATGCATATGGC
AAGGCCAGAAATGCCCTTACTATTTATAGAAGCTCATGAAGCTCATTTAAGAAAGGTGTA
ATTCCGGGGGGTTCCCTCTCTGACCAATGACTATATAGGCAGAATTTTTTTTTTTTATGA
TCCATAGTCAGTTTTCTTTCTTGGTCAGTGGCTTGTGCCATGTTGTGCGAATCCTCAAAG
GGAAAAGAAATAAACATCCACACAGTCAGTAATTACCTAAATGCATGAATAACAAAAATT
TGAATGGTCCTTTCAATTACCGTTATCGTGTCAAGCCTTTTATCATCTTCTGTGCTTCAT
ACCCTTCAGGACGGCTGCTTGAGAGGTGAAGAAACTTTCCACTAAGGTCTCCAGCTCGAG
AGTTGGCTCTAGGTGTTAGGAGCATGGATATCAATGTGAGTAATAGTCAAGATCATGTCT
TGGTGCAGGTGGTTTGTGTGTTCTCTGGTATTTTTTCTCATGGGTGTCATTTAAATACTG
AATTCACCAATAAGAATGTGTGGAGGTGAATGAAGAAAAAGAAGGCCAATCCTGGACCAA
TGATGACCACCGGTGGCTTCTGAGTCACGGACGATGAATAGTATGTGTCTGGAACTCTGA
GGTCCAATATAGAGAGATGAGTAGGCACATCCCATTGTTCGAAGTGTTTGAAGACAGATG
TTAGAGATGTTTAAAGATCTGGTACTTCTCCTTTTATGACTAATGAGTTTTGATTAGAAT
GTTATTAAAAATTAATGGAAGTATCTGTGAAGTATATTTTAAACCCATTAATATGTAAAG
AGTGAAGCACAGTACAACTTTAAATGTGAATGGCAAAAAAAAAAGGAATACTCTTTGCAT
ATATCAACAGCCCGATATTCCTTAATTAAGAACAGTATCAGTTAGGGGTGGGGTGGCTAC
CTCTGTGGCCAAGGATCATTTGGACAGTCAAACTGAAAGCCAACATCTTATCCTTGGTGT
TGGTGTGTTGGTTATTAATGGCATTCTTAGGATAAGAGGAAGTCAGCATTACCCTGGGTC
AATCAACTCCCTAAGAGCATGACGAATAAAAGGTGGAAAGTCCTGCAATTAATGGGATAA
CATGCCTCCATATTTGTATTTTCTGCTCTGCCCTTTTTATGCTTTAGAATGAGTGCCTGA
ACTGATTTCAGCTTCTGCCAGTGCCGTGTGTGGTACATTGACTCCTAGCATTGGGAGCAT
GTGAATTGATGTGAGTAACAGTCAAAAGACCTTGTCCAAATGAACAGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTGATGTGAGTAACAGTCAAAGA
TCTTGTCTTAAAGAATAACAATAGGTGTATGTGATGGAAGAAAGGCAAGGGTTGGATTGG
ACCAATGATGACTACCGGTGGCGTCTTAGTCGTGGACGATGAATAGAATGTGCCTGGAAC
TCTGAGGCCCAATGCAAAGGGGTACCTAATCCCTTCCCTTGGAGGCAAAATGGACGGGTG
GACTGATTTTAGTCATTTCCTTGGACTGGAGCTTCCCTCTTCATGCTTAAAGAGGATTGA
ATATGAAATTTCCGAAATCAGTGGAAGTAGTCACAAGAATCAAGACATGAATTGACATAG
AAAAGTGTGAAGCCTTGTCCAATGATTAACATATAGGGGAGGTCAGAAATACTCTTAGTT
TTTATTTAAGACCCTAAGCTCCTTTAAGAAAGGCGTCATTCCAGGTAGGCCCCTCTCTGG
CCAAGGACCAGATGTCCAGTATAACACATATAGTCAATCTTTTTTTCTTGGTTGGTACTT
TGTGCTCTGTTGTTCGAATACTTAAGGGGAGAAGAAGTAAACATCCACCCCAGTTAGTAA
TTCCCTGAATGCTTGAATAAGGAAAGGTGGAGTGGGTTCGGATCAATATAGTTACGGTGT
CAAGCCTTTTATCCTCTTCTCTGCTTCCTACCCTTCAGGACAATTGTCTGCATAGTGATG
GCACCTTCCACTAGGATAACCAGCTTGATGGTTGGCTCTGGGTTTAGAGTGTGGACATCA
GTGTGAGTAACATTTAAAGATCCTGTCTGGGTGTGGGTGGTTTCTACGTCCTCTTAGGTC
CTGTTTTTTTCTTATGGGTGTCAGTTATTTGCTGAATTCACCAATAAGAATGTAGGAGGC
AAATGAAGAAAAAGAGGGCCTATCCTGGACCAGCGATGACCACTGGTGGGGTCTGAGTCA
TGGACGATGAATAGTGTATGTCTGGAACTCTGAGGTCCTACATAGACAGACATGCAGGCC
CATCCCATTGTTGGAGTGCTAGTGAAGACAGATGTTAGAGATATTTAAGGATCTGGTGCT
TCTCCTTTAATGACTAATGAATTTTGATTGGAATATTATAAAGAATCAATGGAAGTATCC
ATAGAAAAGATTTAAATTCATAAGAACGTAAAGGGTGAAGCATCCTTCAACTCTAAGTGC
ACATGGCAAGGCATACTCTTTGCTTATACTGGAAGCCCAATGTTCCTTAAGAATGGTATT
TTGGGGTGGGGAGGGGTTACCTCTTTGGCTAAGGATGATTTGGACAGTCAAACCCTAAGT
CCATGATCTTATCCATGGCATTGTTATGTTGGATATCGTTAGCATTCTTAAGGGAAGAGC
AAAGTCAACATTACGGAGGGTCAATCATCTTCTAAGAGCATGACGAATTAAATGTGAAAA
GCCCCTCTATCAATGGAGATAATGCCTCAATATTTGTACTCTCTGCTCTGCCTTATATCT
CTCAGAATGGGCGCCCTGGACTGATACCAATCTCTGCCATGGTCAAGTGCGGTAAAACTG
ACTTCATGAGTTAGGGGCATGGGAATCAATGTGAGTAACAAAGATCTTGTCCTAGTGGGT
GTAGATGGTGTATCCTGTTATGTATTTTAAAATTATTATTATTTTATTTAAAAAATAGTC
AACAGCAATGGATGCTTGTGAAGGAAGAAAGCAGGGCCAGTCCTGGTCCAGTGATGACCA
CTCGTGGCATTGAGTCATGCATCGTGTATAGTATATTTCAACAACTGTGACCTGCAACAG
AAAGAGATGTCTTCTCCCTTTTCACAGGGGGAAACGGTTCTCATTGCTGTGGTACTTCTC
CTTTTATGCTTAATGAATATTGCTTATAATAAAATATAAATGTAAGTATGTATAATAAGT
CCTTAAATAAATAAAAATGGAAATTTCAAAGCCTTTTCCAATCGTTAAGTGCATACTGTA
AGAGGAGAAACTTGCTTAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved