Loxodonta_africana Locus Mono:53:SNORA11
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:53:SNORA11
Loxodonta_africana
Mono:53:SNORA11
scaffold_163887
SNORA11
1001..1127
1535
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTCCTATAGTTTTAATTAAAGGAGGTGAAATTAAAAGACGCCTTTTTTTTTTTTTTA
ATATCAATGGACTCAAAGAAACAAATCACTGGGAAGGGAGGATGTGCTACAATGACAAAG
AATGCAAAGATGGAAGACTAGGAGTGTCAGAGTAAATCTTACTAATTTTATAACATTTGC
AAGGTCAGACAAGTTCAAAGGGAGACTTTGGTACCTTTCTAACATCATCTACCACCTTTG
AACTCCATGCAGACACAATAATTAAGCTCATTATTATATTGGATGCCTCTCAGTCTAAAA
TGAAATGTGTCAGTGTGCAGGCTAGAAATAATATCCACTTAATGTGGAATTTATATTATC
TTTTTTTAATCATTGAAGTATAAAATGGAATATGTAGTTCATAATGAGTGGAAGTGGGTT
TTTTTTAATGAAGGTATCTAGAGTACAGGGTTTTTCTAATATTTCACAGAAGGAAAGGCA
GATGCTAACTTGGAACTGTGCTTTCTAATAAAAAAAAAAAAAAAGTGTAGAACATCCAGA
ATAAATTTCCTCTGGCAGAAAAATCTGTAAGTGATATGGTTGCTTCCTCACGGAACATTC
CTTAATTCCATTATTTGCCTAAGAAGAGCCATCCCCTAATGTAAGACTTAATTTTAGATG
GTAACAACCAAGATCATTTCAATCAAAAATCACATGGAGAGTGGGTGTACTCAGAGCAGG
GGGCCTCAAGCGTGGCTTCTCTGTTTATAACACACCCAAGAGGAATCTGGGCTCATTGTG
ACAAGGGGCACACAGCTCATGGCCTTCCTATGAACAACGCCCACACAGGTCTTCCTGTAC
CTCCAGGTTGCTGCTGGGTAGGGCCAGTAGGAGAGGACTCACTATTGGAGGAAAAACTGC
AGCATTTAGTTGGAGAGGTTGCCAGTCCATGCATGAGCCATGGGTGAACCTCTCTTTTCA
AGGGAAAAAAAAAATGATTGAAATGAGGAAACAACCAGGCAAAGCCAGAGTACGGGACAT
TCTAAACGTCACTGGCCTGGATGTCAGTGTCAGGAGCTGAAAAAGCGGAGGTGGTTTTAA
GAGACTAAGGACACAACAACCAGAAGTACTGCGTGTACCTTGAGTTTATCCTGGATCTAA
AAAAAATTTCCCAAAAACCATTTCTGGAGTAATTGGGGAAATTTGAATATTGATCATATA
CTAGATGATACAGAATCATCAACAGTTTCTTCTGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved