Loxodonta_africana Locus Mono:44:SNORD12
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:44:SNORD12
Loxodonta_africana
Mono:44:SNORD12
scaffold_102563
SNORD12
1001..1083
1320
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGTTTCTCAGTGCAGTGACCATGAGTACGAAGGAGGTGCTCTGC
TCCTAGCACTGCTTTCTTGGTGGTATGAGGTCCCACATCTCTCTGCTCACTTCTCTCTTT
TATGTCTTAAAAGAGATTGACTTAAGACACAACCTAATCTTGTAGACTGAGTCCTGCCTC
ACTAATATACTGCCACTAATCCCACCTCGTTAACATCATGAGGTAGGGTCCATAACACAC
AGGAAAATCACATCAGATGACAAAATCTTAGACAACCATTCAATACTGGGAATCATGGCC
TAGCCAAATTTACATACATTTGGGGGGACACAATTCAATCCATGACAATTGTGTGTTAGA
GTTGGGGTGGACTCCATCCAGAGGCTCCTGTGATAGGCCAGTTAATAAGGACTGGATTAG
AGGGAGAAATGGGGACAGATCTGAGTGATGCAGGGTTCCTGTCTGGGTGATGGGTGGGTG
GATGTCACACAGGAGAGTTGTCTGGGAGAAGGCAAGAAGTTTGGTGTGGTCATGCTGCGT
TTGTGGGAGGAGAACTCAGAGAGAGGTCTGGGCTGGAGTAGAGATTTTAGGGCTGGTAGC
TAAAGCCATGGGGTAGATTGAGATGTCCCGAGATGCTAGAGAAGGCAGAAGGACCCTGAA
TAGAACCCTGGGGAATAACGGCCAGAGAAACTCCGAGAGGGAGGAGGAGAATCAGGCAGG
GATGGAACGTCAGAGGCCAAGGCAACAGAGGAGCAGGAAAAAGGGCTTGGCCACCAGCCT
ATGGGCTCTAAGAGGGAGATATGCAATCAGGAGGTCACACAGCATAGATGATGGCTGAGC
TTTTTCCCCCGACAGATGGACCATGTTTATCTAACTTCTCTAAGTCAGTTTCTGTCTGAT
ATGCCAGCTTGAGCAGCTCCTGGGCTCCTGCTCCACTGGGCATCTATCTACCTGGTGGGA
GTTCATCTTTCTGTGGTTTCATCTCAGGTTTGCAGAAGCTAGACTTTGAATGGACCACGA
TGAGTGTGGGAGAGGATTGGTTGGGAGCCATGTGTGCCACTGGGCAATTAGTGGGTTGAT
GACAAGGGATGCCTTCCACAGCTTGGTTTAATCTTTCCTCTGTAATAGCAAGTTCTCAGT
A
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved