Loxodonta_africana Locus Poly:18:SNORD115
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:18:SNORD115
Loxodonta_africana
Poly:18:SNORD115
scaffold_68710
SNORD115, SNORD115, SNORD115, SNORD115
1001..1078, 4380..4457, 7783..7860, 9488..9568
10258
TCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCAATATCTGAGCTCAAAAAGCTAATGG
CAGGTTCAATCCCATTCGGTAAGTGGGTCGCGAGCGTCATGACTCATTTCAGGTTCATGC
CACAGGAGGTCATGATCCGCTGAGAGTCTAATCAGGAAATGCAGGCATAACTGCTGCCTT
CCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGA
ACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATATCCAGGAGGAGATGTGA
TCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAG
TGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTTG
GAAAGCTATTCTTTTTCCAAATGTCCTCCAGCTGATTTGAAGATCCCCCGGTGCTGGGGA
CTCTTGCGTGCCATTTCCCGGGAGTCCGCACACATTGGACAGTGCCCGTGGACGCATACT
TGGCAGCCTTCAACACATCAGTCAGGCTTAATCAATGGCAAAGGCTCCTTTTGCCTGGGT
CCTCCTGAAAATTTGTGCTACATCCAGAGACCTCTCTGCCTTCTTCTGAATATTGCATGA
TTCTCTCCTGCTGTCATGGGTCAGCAGACTCCCCAGTGGGTTGCAAATGGCTGTCTTGAT
TTTGTCCCATGTGTTCGCGAATGTCTGGCTGAAAGCCTAGCCTTAGGGAAGTGAGTTTCT
CTTCTGGGATCTCTGTCTTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGGTCGATGTCT
CTTTGTGCTCGCTTTCATGGGGGTCAAGCCAACTGCCCGTGGAAACTGGGAAGAATGATG
TGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATC
TTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACATAAT
CTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCT
GTGGGAAAGTCCTTTGGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGA
TTTCTTTCACCTGCACCAAGTAATTCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTG
ATTCCTTGGCTCTTTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCA
CCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACACT
TAGGCAAGTGAGGATACAACCGCAAAAGGCAGTAGGGTTTGCTGACAACGGCTGAGGCAT
GTCCCCTGGATGTTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGG
TGGATACTTCGGAATCAGAGAATGCTGAAACATGTGCGCTGGAGTCGTCTGCGATAGCCT
GGGTCCAAGTCCGATAGGGCCTACCGAAATGGGAGAAACGGCCAACTAGAACAATGTATT
TTCCCAAGATATTTAGGAGATGTGAATGGCCCAGAGCTCTACAGGAGACTGGTCAACTTG
CTGTAATTGAAAGCGTGTGTCAGTTGAGGCTGGACTCGCAGGATTTGCGGGGCGCTTTTC
CCGTGAATCTTGAAATTGGATGAGCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAA
GTAAAGGTAGCTGCACAGATAACTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTG
TGAAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCC
CTGGAGCTCTAGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGATCAG
TGTTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGT
GCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCTCTGTGTTCCTCATT
CTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTC
TGGAAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCC
CACAGCTCATTTGAGATCCTCAGTTTTGGGAACCCTTGATGTCATTTCTGGAGTGCTCGT
GCACGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGTCGGGTTTTGTGGAAAGCTGAGACGTGTC
CCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGATA
GTTAGGAAGCACAGGAATCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCGGTTC
CCAGTCGGGTATGTCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGGGCT
GGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAAAGACTTGCCAGAGTTGAAAGCCTGT
GTCAGTTGCGACTGGACTCTTAGGATCTCTAGGGCATCTTTCCCAGACATCTCGGTATTG
GATGAAGAATTGAGTAGCCTGATACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCA
ATATCTGAGTCAAAAAGCTAATGGCAGGTTCAATCCCATTCGGTAAGTGGGTCGCGAGCG
TCATGACTCATTTCAGGTTCATGCCACCGGAGGTCATGATCCGCTGAGAGTCTAATCAGG
AAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTT
GGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATG
CTTGATATCCAGGAGGAGATGTGATCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATT
CGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTT
TAACAAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTTCTAAATGTCCTCCAGCTGATT
TGAAGATCCCCCGGTGCTGGGGACTCTTGCGTGCCATTTCCCGGGAGTCCGCACACATTG
GACAGTGCCCGTGGACGCATACTTGGCAGCCTTCAACACATCAGTCAGGCTTAATCAATG
GCAAAGGCTCCTTTTGCCTGGGTCCTCCTGAAAATTTGTGCTACATCCGGAGACCTCTCT
GCCTTCTTCTGAATATTGCATGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCCAGC
GGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTTGCGAATGTCTGGCTGAAAGCAT
AGCCTTAGGGAAATGAGTTTCTCTTCTGGGATCTCTGTCTTACCCACTTCCCCTTTTCAA
AGGGTTAGTGAGGTCGATGTGTCTTGTCCTGCTTTCACGGGGGTCAAGCCAACTTGCCCC
GGGAAACTGGAAGATGATGTGGGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAA
GACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTG
GGGTCAATGATGACATAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGA
GAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAG
AGCGGACTCCCATTTTGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGC
CGATTTTGGTCAGGCTGATTCCTTGGCTCCTTTCCTCTTTTTGTGTCCTTTAGCACAACC
TGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCC
TGGCCCCATCTGACACTTAGGCAAGTGAGGATACACCGCAAAAGGCAGTAGGGTTTGCTG
ACAAGGCTGAGGCATGTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGG
TGATGTGCGTGGGTGGATACTTCGGAATCAGAGAATGCTGAAACATGTGCGCTGGAGTCG
TCTGCGATAGCCTGGGTCCAAGTCCGATAGGGCCTACCGAAATGGGAGAAACGGCCAACT
AGAACAATGTATTTTCCCAAGATATTTAGGAGATGTGAATGGCCCAGAGCTCTACAGGAG
ACTGGTCAACTTGCTGTAATTGAAAGCGTGTGTCAGTTGCGGCTGGACTCGCAGGATTTG
CGGGGCGCTTTTCCCGTGAATCTTGAAATTGGATGAGCGACTCAGTAGTCTGATAGCTGG
CTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCATAGAAAATCTAAAGTCAGGG
TCGATGCCAGGTGTGAAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTGATGCCACAGG
AGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACAT
GTGCAGAGATCAGTGTTCCTAGAGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGACTC
CTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCC
TGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGT
GAAATCAAACTCTGGAAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTC
TTCCGAGTGTCCCACAGCTCATTTGAAGATCCCCAGTTTTGGGAACCCTTGGATGTCATT
TCCTGGAAGTGCTCGTGCACGGATCCGTACCTGTGGACACAGATTCGGCTTCCTCGTAGA
CATTAGCCGGGGCTGATCAAATGAATAGCCTGTTCTTGGCTGGGACTTCCTGAGTACGTT
TCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGTCAA
GGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGTGTCTTGATTTCGTCCCTCTTTTGGG
CTATATGTGGAAAAAGCATAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTT
ACTTCTTTGCCCTTCCTCAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAG
GGTCAAGCTACTCCCCGGGAAACCGGAAGAGGATGTGCGAACCTTCTCATTGAGGGTGAT
TGCCTTTTGGATGGACGATATCGGTGGCGAGGAAGATGACCACTCCCGTGAATTCTTCCC
TCCAGAGAGATGGCTCGGGTTACCTGAGACGCCTCCTCGTGTCTCTGACATAGATGAAGA
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAAAGGGTTAGTGAGG
TCGATGTGTCTGTCTGCTTTCACGGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGATGA
TGTGGGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCA
TCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACATA
ATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCC
CTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTG
ATTTCTTTCACCTGCACCAAGTAATCCCAAAAGACCTGGGTGGCCCGATTTTGGTCAGGC
TGATTCCTTGGCTCCTTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAGGAGTT
CACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACA
CTTAGGCAAGTGAGGATACACCTCAAAAGGCAGTAGGGTTTGCTGACAAAGCTGAGGCAT
GTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTG
GATACTTAGGAATCAGAGAATCCTGAAACCTGTGTGCTGGAGTCATCTTCGATAGCCTGC
GTCCAAGTCCGATACGGCCTACTGAAAGGGGAGAATCGGCCCAACTAGAAAAATGTGTTT
TCCTGAGACATTTATGAGATGTGAATGGCTCAGAGCTCTACAGGAGACTGGTCAACTTGC
TGTATTTGAACGCGTGTGTCAGTTGCGGTTGGACTCGTAGGATTTGCAGGGCGCATTTCC
CATGAATCTTGAAACTGGATGAGCGACTCAGTAGTCCGATAGCTGGCTCCAGCTTTCAAG
TGAAGGTAGCTGCACAGATAAGTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGT
GAAGGGCACACGAGGGTCAGGAGCACTTTCAGGTTCATGCCACAGGAAGTCATGTTTCCC
TGGAGCTCTAGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAAAGATCACT
GCTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTG
CCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCT
TTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTG
GAAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCA
CAGCTCATTTGAAAATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTC
GTGCACGGATCCGTGCCTGTGGACACAGATTCGGCTTCCTCGTAGACATTAGCCGGGGCT
GATCAAATGAATAGCCTGTTCTTGGCTGGGACTGCCCGAGTACTTTTCTCCATTGGGAGT
CCTCTATGCCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTC
ACTAATGGGCGAGAAGTGTGTGTCTTGATTTCGTCCCTCTTTTGGGCTATATGTGGAAAA
AGCATAGCTGTTAGGCAATGAATGTCTCCTCGGTCTGATGTCTGACTTACTTCTTTGCCC
TTCCCTCAAAGGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGGTCAAAGC
TACTCCCCGGGAAACCGGAAGAGGATGTGCGAACCTTCTCATCCTGCGTGATTGCGGGCT
GGATGGACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTCTCCCGGGGATTGA
GATGTCTCGGGTCAACGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAA
TCATGCTCAATAGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCCCTAACGTTAATG
ATCTGCTTTAGAGTGGGACCCCCATTTGGATCCCTTTTTCCTCCACCAAGTGATCAAAAA
CTCCTCCCTGACCGATTGTGGTCATGCTGATTCCTTGGCTCTTTTCGTCTTTTTCTGTCA
TTTCGAAAGACCTGCTTTCAGGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGAC
GGCGGTTTTCCCTTGTCTCTGGTGACACTTAGACAAGTGAAAATGGAGCCCAAGAGGCAG
TCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGA
CCAAGTGGCGGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAATTT
CCACTTGAGTAATTTTTGCTAGTCCGGTTCCCAGTCGGGTATGCCTAACGGAAGTTTGAG
AATATTTTCAACTCTCAACTCTTTACGGGACTGGGAGTGTGTAGCAGCTCTACTGGAGAA
ACCAGAGAGACTTGCCCTAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATCT
CCAGGGCCTCTTTCCCAGACATCTTGGTATTGGATGAAGACTGGAGTAGCCTGACACCTC
GCTGTAGCATTCAAGAAAAGGCAACAGCACCACTATTTGAGTCAAAAAGCTAATGCCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved