Loxodonta_africana Locus Mono:12:SNORD93
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:12:SNORD93
Loxodonta_africana
Mono:12:SNORD93
scaffold_8544
SNORD93
1001..1075
2075
CAGGGGCCCTCGGGGAGGAAGATATGACAGTCGGCTTCTGTAGACATTTAAATACAGCC
TTAGCAACCCTCTAGGACCACTGTGAGTCAGAATCAACTCTTACGTCTGGGTTTGGTTTT
TTGTTTTACATATGGGCCCACAGCATATGGACATCTTTCCCTGTTCTGAATAAATCTTTG
GCAAGTAGCAAGAGAAATGCAATGTTCGGACTCTTATTAAGCCACAGCTGTTTAAAAAAT
TCTGTCTGGGAGAGAAGGGCTGAGAAAGCCAGGAAGCAGGGAGGCCAGTGTCTATTTTAG
GAATGTGGAAACCAAGGGGGTTGGATTGCTGGGCACTAGAAACCAGCTCCCTGGTTTCCA
CCTCAGGGTAAATAAGTTTCATGCTTTGGTCTTTAATAAATCTGTTAAAGATTTGTTTCC
ATTTTTCCTAATAATGTATTTTTCTGCAAATAACACTGCCCCATGCTAATTTTTTTTGCA
TACTGCTGTAAAAATTAGCATAGCGAGCAGAGGGGAGTGGGGGGGGAGGTGTTGGCAAAC
AAATGTAGGTGTGTGTTACTTGTAATAAAATACGGCACCATTTCCAGTCCAGGATACAGT
ATGTAATTTTTTTCCAACATTGATAATTTTGCATGCTAATTTAACAAGTTTGAAAAGCTG
GTGACTGCTGACATTGTGTTAAGTGGATTCCGAGAATATGGTAAGTTGATGTAATTCACT
TTCATTTTGCTCCTAGCTGGAAATTCCAGAATATTCCAAGTTGTTGGGGAATTTGGAGAA
TGTGGCTTTGTACAGGAATTATTTAAGGGTAGATCTGTATTTATCAAATGTAGCTAGTCG
ATAGCAGCAATAAAAAACTGCTCTAAATAAATAAATAACACCATAAAGTTATTCTGAACA
TTGTTCTTGTCGCTTTTCTACCAGGCTTGGTGTCAAGTTCAAGTTGCTGATGATCTTCAG
GTATGGTTCACATGGAAAGAATTTGGCTTGAATATAATTCTTGGCCAAGGATGAGAACTC
TTAATCTGATTGGGCATGCTTGTGCTCTGATGGGTTAAAGGATTTACCTGAGGCCAATGT
GATTGCAGGAATCCGCTAAATATACTTACATCACCCCTCCCCCTTTAAAAAAAATTATGC
TTTAAGTTAAAAGGAAGAACAGGGTTGTTTTAGAAAAGATGGATTTCTAAGTGACATTAA
ATCTTTGAAAATGTTTATTTTCTAATGGTGACCATTTTGATAGGTTATAGTCATTTGAAA
AGCTTTTGAATTTCAATTTTCCAGAAAATTAAGGCAAATTGTTAGCGTTAGTAAGATAAC
ATTTTTGAATACACTAAATTCACTTTGTTTTTATATCAGAACATTACTATGACATACTTG
ACAATGTACGGTGAAGCCTGTGAGAGTTGGAACTTGCCAGGAGGACTGCCTTGTTATTCC
ACTTTTGACAGGGTGCAGTCTTACCACTTAACTATATAGTGGAAAATATTTGCGTTTTTC
TTTCCTGACAGGTTTCTACATTATACAGGTTACGGCTTTCGAAGGTTTTACTGTATGTTA
GGAAAGTATTTAGAGTCTAGGCTTGACTGTATTTTTTTTTTTTTTTTTTAGTCGTATCTC
TTATTATTTCCTGGTCTAATTACCTACTGTAATATTTCTTTCTAGGGCTGCTGCTTGAAA
GACATCCTTTTTCAAGTTCCTAGAGGTATATTTGAGTATAAGACAATGGATACATTCAAA
ATAGAGGTTTTTACTTTCTTTGTCCCTCTTCTGGCAAGGATGAATTTTGAGAGGAAGATG
TCATATGACTTAGGAAATAAAAATCGACATCTTTTGTTTATGCATATAAGGAATGTGACC
TAGCTGGAGCAACAAGGACACATCAAACTGGGTCCTGAGCTCAAAAAGCAATAGCTAAGA
CAATCTTGGAAAACATCTTTTAGAAAATCTTTCACACAAACAAGATACTTAGCGCACATA
AGACCCACCTATTTTCCACTCTTATCTTTTTCCCTCAAAACCCAAACACCAACCCCTTAC
TATTAAAAACAAAGAAAAGAAAAATTCTGAGCCTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved